A soybean low phosphorus tolerance gene GmAK1 and its application

Abstract

The present invention belongs to the technical field of plant genetic engineering, and specifically relates to a soybean low-phosphorus tolerance gene GmAK1 and its application. The nucleotide sequence of the soybean low-phosphorus tolerance gene GmAK1 is shown in SEQ ID No.1, and the amino acid sequence of the protein expressed by the gene is shown in SEQ ID No.2. The present invention provides the cloning, functional verification and application of the key enzyme gene GmAK1 in the plant aspartate metabolic pathway in breeding under low-phosphorus conditions. The present invention uses genetic engineering methods to explore the function of the key enzyme gene GmAK1 in the soybean aspartate metabolic pathway, and provides a molecular research basis and germplasm resources for clarifying the mechanism of soybean response to low-phosphorus conditions and soybean high-yield breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a soybean low-phosphorus tolerance gene GmAK1 and its application. Background Art

[0002] Phosphorus is one of the important nutrient elements required for crop growth and development, and plays an important role in the growth, development and reproduction of plants. Phosphorus not only participates in the structural and functional components of nucleic acids, membrane lipids, energy metabolites and reactive intermediates in the photosynthetic carbon cycle, but also plays a key role in signal transduction cascades.

[0003] Soil phosphorus deficiency is a common limiting factor in agricultural production. The formation of soybean root nodules is a high-energy-consuming process that requires a large amount of phosphorus to participate. Phosphorus deficiency will directly affect root nodule development and nitrogen fixation, indicating that phosphorus is a limiting factor for maintaining relatively stable soybean yields. Studies have found that the root exudates of leguminous plants such as kidney beans, broad beans and white lupins can improve the availability of soil phosphorus, thereby enhancing the activation of insoluble phosphates by crops. This is mainly because phosphorus deficiency stress can increase the secretion of organic acids in the root exudates of leguminous plants, significantly improving the activation effect of insoluble phosphorus. Thus, it can be seen that phosphorus is an essential nutrient element during the growth and development of soybean roots, and is of great significance for promoting root growth and nutrient absorption.

[0004] The aspartic acid metabolic pathway is an important pathway for plant amino acid synthesis. Aspartic acid can be catalyzed and synthesized by aspartate aminotransferase AST, or can be generated by the hydrolysis of asparagine. Part of the nutritional value of soybeans is also reflected in the content of essential amino acids with aspartic acid as a precursor. Studies have found that during the reproductive growth stage, low-phosphorus stress will increase the content of aspartic acid in soybean roots, and the content of root aspartic acid increases with the decrease of phosphorus concentration in the nutrient solution. Under phosphorus starvation levels, the contents of amino acids such as L-aspartic acid, L-glutamic acid, and L-alanine in soybean seedling roots will be significantly reduced. Thus, it can be seen that low-phosphorus stress may affect the synthesis of plant aspartic acid by influencing the phosphorus-dependent amino acid synthesis process.

[0005] The aspartic acid catabolic pathway is an important pathway for plant amino acid synthesis, and its main function is to synthesize essential amino acids such as lysine, methionine, threonine and isoleucine. Studies have shown that the key enzyme genes in the aspartic acid pathway can control the content of synthesized amino acids. In genetically improved cereal and leguminous crops, regulating the activity level of enzymes in the aspartic acid metabolic pathway will affect the content of their corresponding essential amino acids. Aspartate kinase (AK), as the first key enzyme in this pathway, has been studied to some extent in the mechanism of action in some microorganisms and medicinal plants, but its function in soybean response to low-phosphorus stress and the application of this gene at the molecular level are not yet clear. Summary of the Invention

[0006] In order to solve the problem that the function and molecular mechanism of aspartate kinase in soybean response to low phosphorus stress in the prior art are still unclear, the present invention provides a soybean low phosphorus tolerance gene GmAK1 and its application. The inventors of the present invention found in previous studies that the expression of AK gene in phosphorus efficient soybean and phosphorus inefficient soybean under low phosphorus treatment conditions is significantly different from that of other enzyme genes. In proteomics research, it was found that the protein also differed significantly when responding to low phosphorus stress. Therefore, we speculate that the gene plays a role in low phosphorus stress, but it is still unclear whether aspartate kinase directly responds to low phosphorus stress or indirectly responds to low phosphorus stress, and the function of soybean GmAK1 gene under low phosphorus stress remains to be verified. Based on this, the present invention studies the response of GmAK1 overexpressed transgenic soybeans to low phosphorus stress, analyzes the phenotypes and physiological indicators of transgenic soybeans and control plants under normal phosphorus treatment and low phosphorus treatment, preliminarily verifies the function of GmAK1 gene, and at the same time, screens, verifies and identifies the interacting proteins, providing molecular research basis and germplasm resources for soybean high-yield breeding.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] The present invention provides a soybean low-phosphorus tolerance gene GmAK1, the nucleotide sequence of the soybean low-phosphorus tolerance gene GmAK1 is shown as SEQ ID No.1, and the amino acid sequence of the protein expressed by the soybean low-phosphorus tolerance gene GmAK1 is shown as SEQ ID No.2.

[0009] GmAK1 is a low-phosphorus tolerance-related gene cloned from soybean. It is the major gene regulating aspartate kinase catalyzing aspartate in soybean plants. It is 6234 bp in length and the protein it encodes is located in the chloroplast.

[0010] The present invention also provides a recombinant expression vector comprising the soybean low-phosphorus tolerance gene GmAK1 or a host cell of the recombinant expression vector.

[0011] Wherein, the recombinant expression vector includes the soybean low-phosphorus tolerance gene GmAK1 and also includes the plasmid of the soybean low-phosphorus tolerance gene GmAK1.

[0012] Preferably, the plasmid includes vectors such as pGBKT7, pGADT7, pBWA(V)BS and pBWA(V)HS.

[0013] The yeast two-hybrid AD and BD vector plasmids used in the present invention are pGADT7 and pGBKT7 respectively. The positive control plasmid is pGBKT7-53 + pGADT7-T, and the negative control plasmid is pGBKT7-LaminC + pGADT7-T. The recombinant expression vector pGBKT7 containing the soybean low-phosphorus tolerance gene GmAK1 is a yeast two-hybrid bait expression vector, which aims to express a fusion protein of the GAL4 DNA-binding domain and the bait protein; pGADT7 is a yeast two-hybrid expression vector, which aims to express a fusion protein of the GAL4 activation domain and the target protein.

[0014] The host cell can be understood as the host cell used by those skilled in the art in the process of gene transfer, such as Agrobacterium tumefaciens EHA105, Escherichia coli DH5α, and yeast strain Y2HGold. However, with the development of technology, the selection of the host cell may change, or in the application fields other than the purpose of gene transfer, the utilization of vectors and engineered bacteria is also involved. However, as long as it contains the gene or the vector described in the present invention, it is within the protection scope of the present invention.

[0015] The host cell includes the soybean low-phosphorus tolerance gene GmAK1.

[0016] Preferably, for the host cell of the recombinant expression vector of the soybean low-phosphorus tolerance gene GmAK1, the host cell is any one of Escherichia coli cells, Agrobacterium cells, or plant cells.

[0017] The present invention also provides the application of the soybean low-phosphorus tolerance gene GmAK1, or the recombinant expression vector, or the host cell in plant breeding.

[0018] Among them, the plant is soybean.

[0019] Preferably, by increasing the expression level of the soybean low-phosphorus tolerance gene GmAK1 in the plant, or increasing the activity of the protein encoded by the soybean low-phosphorus tolerance gene GmAK1 in the plant, the response of the soybean aspartic acid metabolic pathway to low-phosphorus conditions is regulated, and further the low-phosphorus tolerance of soybean is regulated.

[0020] Increasing the expression level of the soybean low-phosphorus tolerance gene GmAK1 in the plant is achieved by transforming the soybean low-phosphorus tolerance gene GmAK1 into the plant.

[0021] Increasing the activity of the protein encoded by the soybean low-phosphorus tolerance gene GmAK1 in the plant is achieved by transforming the protein expressed by the soybean low-phosphorus tolerance gene GmAK1 into the plant.

[0022] Meanwhile, the soybean low-phosphorus tolerance gene GmAK1 and the recombinant expression vector provided by the present invention can be used for yeast two-hybrid screening of the possible interacting proteins of the soybean low-phosphorus tolerance gene GmAK1.

[0023] The preparation of overexpressing plants is a conventional technical means in the art, and the present invention does not make further limitations. All technical solutions for soybean transgenic using the genes of the present invention are within the protection scope of the present invention.

[0024] The present invention also provides a method for detecting the expression level of the soybean low-phosphorus tolerance gene GmAK1 by fluorescence quantitative PCR, which specifically includes the following steps:

[0025] When the soybean seedlings grow to the V1 stage, that is, when the first trifoliate leaf is fully expanded, take the compound leaf to extract total RNA, reverse transcribe to obtain cDNA. Using the synthesized cDNA as a template, use the GmAK1-RE-F primer (the sequence is shown in SEQ ID No.3) and the GmAK1-RE-R primer (the sequence is shown in SEQ ID No.4) to detect the expression level of the GmAK1 gene.

[0026] Among them, the sequence of the specific primer as shown in SEQ ID No.3 is GmAK1-RE-F: 5’-CCATCCTCTCACTCGAAACT-3’.

[0027] Among them, the sequence of the specific primer as shown in SEQ ID No.4 is GmAK1-RE-R: 5’-AACTATGGTCAAGGGCACGA-3’.

[0028] The present invention also constructs a localization vector and provides a method for subcellular localization of the soybean low-phosphorus tolerance gene GmAK1. Specifically, it includes the following steps:

[0029] Sow several tobacco seeds, culture them under 12h light for one month, which can be used for experiments. Electrotransform the constructed localization vector plasmid into Agrobacterium tumefaciens EHA105, culture at 30°C for 2 days, scrape the Agrobacterium tumefaciens from the solid culture dish with an inoculation loop, inoculate it into 10 mL of YEB liquid medium, culture at 170 rpm / min for 1 h, then collect the bacterial cells, centrifuge at 4000 rpm / min for 4 min, and remove the supernatant. Resuspend the bacterial cells with a suspension of 10 mM MgCl 2 containing 120 μM AS, adjust the OD 600 to about 0.6. Select tobacco plants with good growth conditions, inject from the lower epidermis of the tobacco leaves with a 1 mL syringe without a syringe tip, and make marks. Culture the injected tobacco plants under weak light for 2 days. Take the tobacco leaves injected with the marked Agrobacterium tumefaciens, make them into slides, observe under a laser confocal microscope, and take pictures.

[0030] Before screening for proteins that interact with AK1 through a yeast library using the yeast two-hybrid system in the present invention, toxicity detection and self-activation verification were performed on the soybean low-phosphorus tolerance gene GmAK1. Generally, BD can bind to the upstream activation sequence UAS of GAL4 alone, but cannot induce transcription. If a transcription factor with transcriptional activation activity is constructed onto the BD vector, and the fusion BD produced by its expression can induce the transcription of the downstream reporter gene when binding to UAS alone, it indicates that the bait protein has a self-activation phenomenon.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] In the present invention, the GmAK1 gene was isolated from the soybean genome database by the homologous cloning method. Its coding nucleotide sequence is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.2. A GmAK1 gene localization vector was constructed to clarify the subcellular localization of GmAK1 in soybean; a GmAK1 overexpression vector was constructed, and soybean was transformed by the Agrobacterium-mediated method. The phenotypes and physiological indexes of transgenic soybeans and control plants under normal phosphorus treatment and low phosphorus treatment were analyzed to preliminarily verify the function of the AK gene. At the same time, the interacting proteins of GmAK1 were screened and verified, and they were identified. The present invention uses genetic engineering means to explore the function of the key enzyme gene GmAK1 in the aspartic acid metabolic pathway of soybean, providing a molecular research basis and germplasm resources for clarifying the mechanism of soybean's response to low phosphorus conditions and soybean high-yield breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the process of obtaining GmAK1 overexpressing plants by genetic transformation in the present invention; among them, Figure 1 (a) in it is soybean induction; Figure 1 (b) in it is soybean screening; Figure 1 (c) in it is soybean elongation; Figure 1 (d) in it is soybean rooting.

[0034] Figure 2 This is the positive seedlings detected by the Bar test paper in the present invention; among them, Figure 2 One positive seedling was obtained in A, s1 is positive, and s2 is negative; Figure 2 One positive seedling was obtained in B, s4 is positive, and s3 and s5 are negative; Figure 2 One positive seedling was obtained in C, s6 is positive; Figure 2 Three positive seedlings were obtained in D, s9, s10 and s11 are positive, and s7 and s8 are negative.

[0035] Figure 3 This is the comparison between wild type and GmAK1 overexpressing plants at the R5 stage under normal phosphorus conditions in the present invention.

[0036] Figure 4 Under low phosphorus conditions in the present invention, comparison between wild type and GmAK1 overexpressing plants at R5 stage.

[0037] Figure 5 Subcellular localization result map of GmAK1 in tobacco leaves in the present invention; among them, from left to right are fluorescence channel, chloroplast fluorescence channel, bright field, and overlay map.

[0038] Figure 6 Toxicity detection results of pGBKT7-GmAK1 on YPDA and SD-Trp media in the present invention; among them, Figure 6 In A, the growth of Y2HGold yeast competent cells transformed with pGBKT7 and pGBKT7-GmAK1 respectively after dilution by 10 times, 100 times, and 1000 times on YPDA solid medium. Figure 6 In B, the growth of Y2HGold yeast competent cells transformed with pGBKT7 and pGBKT7-GmAK1 respectively after dilution by 10 times, 100 times, and 1000 times on SD / -Trp solid medium.

[0039] Figure 7 Autoactivation detection of pGBKT7-GmAK1 recombinant vector in the present invention; among them, Figure 7 In A, the growth of Y2HGold yeast competent cells transformed with positive control plasmid pGBKT7-53 + pGADT7-T, negative control plasmid pGBKT7-LaminC + pGADT7-T, and pGBKT7-GmAK1 respectively after dilution by 10 times, 100 times, and 1000 times on SD / -T / -L / X solid medium. Figure 7 In B, the growth of Y2HGold yeast competent cells transformed with positive control plasmid pGBKT7-53 + pGADT7-T, negative control plasmid pGBKT7-LaminC + pGADT7-T, and pGBKT7-GmAK1 respectively after dilution by 10 times, 100 times, and 1000 times on SD / -T / -L / -H / -A solid medium. Detailed implementation manners

[0040] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0041] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they cannot be construed as a limitation of the protection scope of the present invention.

[0042] Example 1; Genetic Transformation of GmAK1 Overexpressing Plants

[0043] 1. Obtaining the Soybean Low Phosphorus Tolerance Gene GmAK1

[0044] Leaves of soybean variety Williams 82 planted until the V3 stage were ground into powder in a mortar with liquid nitrogen, and about 100 mg of the powder was taken into a 2 mL centrifuge tube. Soybean leaf RNA was extracted using the plant RNA extraction kit from Aikery Co., Ltd., and after reverse transcription into cDNA using the reverse transcription kit from Aikery Co., Ltd., it was used as a template. The specific operation can be referred to the instruction manual. Specific primers containing restriction enzyme sites were designed in Oligo7, and the sequences of the specific primers are shown in SEQ ID No.5 and SEQ ID No.6. Using cDNA as a template, PCR amplification was carried out with GmAK1-F and GmAK1-R as primers. The target gene GmAK1 fragment was amplified by PCR. The PCR system is shown in Table 1, and the reaction program is shown in Table 2.

[0045] Table 1 PCR System

[0046] Component Volume Nuclease-free Water 20 μL PCR Mix 25 μL GmAK1-F 2 μL GmAK1-R 2 μL Template 1 μL Total volum 50 μL

[0047] Table 2 PCR Program

[0048] Step Number of cycles 94 °C for 5 min 1 94 °C for 30 sec 30 50 °C for 45 sec 30 72 °C for 101 sec 30 72 °C for 10 min 1 16 °C for 30 min 1

[0049] Among them, the sequence of the specific primer shown in SEQ ID No.5 is: GmAK1-F: ATTTG GAGAGAACACGGGGGACTTTGCAACATGACAAGCACCATGCAACTAACTA.

[0050] The sequence of the specific primer shown in SEQ ID No.6 is: GmAK1-R: GGCCCAGTA CTGAAGACAGAGCTAGTTACACTAAGATAATGCAGGAACAGAACCA.

[0051] The nucleotide sequence of the soybean low phosphorus tolerance gene GmAK1 is as shown in SEQ ID No.1:

[0052]

[0053] The amino acid sequence of the protein expressed by the soybean low-phosphorus tolerance gene GmAK1 is shown in SEQ ID No. 2;

[0054] MTSTMQLTMVKGTIPVALSRRVCCQCQASLWPPWRIGFFAPVPLVRRVSSERVATLRVSCIKATESDVVEGESGGFADIETSYTCVMKFGGSSVANAERMREVANLILSFPEERPIIVLSAMGKTTNMLLLAGEKAVSCGVTMADSIDELSIIKDLHLRTVEELGVDRNAIEKHLEELEQLLKGIAMMKELTPRTQDYLVSFGECMSTRIFAAYLNTLGIRARQYDAFEMGIITSDDFTNADILEATYPAVAKRLHSDWVCDPAIPIVTGFLGKARKSCAVTTLGRGGSDLTATTIGKALGLPEIQVWKDVDGVLTCDPNICPQAKPVPYLTFDEAAELAYFGAQVLHPQSMRPARESDIPVRVKNSYNPKAPGTLIAKTRDMSKALLTSIVLKRNVTMLDIVSTRMLGQFGFLAKVFSIFEELGISVDVVATSEVSISLTLDPSKLWSRELIQQELDYVVEELEKIAVVNLLKTRSIISLIGNVQRSSLILEKAFHVLRTLGVTVQMISQGASKVNISLVVNDSEAEQCVRALHKAFFESELFELENECIPGNGSVPALS*。

[0055] 2. Vector construction

[0056] The pBWA(V)BS vector containing the strong promoter 35S was digested with Eco31I (BsaI). The digestion system and reaction conditions are shown in Table 3. Then, the target fragment was recombined with the vector. The recombination reaction system and conditions are shown in Table 4. The recombinant vector was transformed into Escherichia coli DH5α competent cells: 10 μL of the recombinant vector plasmid pBWA(V)BS-AK1 was added to 50 μL of DH5α competent cells and incubated on ice for 2 minutes; heat-shocked at 42 °C for 90 s and then incubated on ice for 5 min; 890 μL of antibiotic-free LB culture medium was added, and the mixture was placed in a constant temperature shaker at 37 °C at 150 rpm and shaken gently for 1 h; the bacterial liquid after gentle shaking was centrifuged at 7000 rpm for 3 min, and the supernatant was discarded; 80 μL of antibiotic-free LB culture medium was added to the centrifuge tube containing the bacterial cells, and after pipetting evenly, it was spread on a solid LB medium containing kanamycin and cultured upside down at 37 °C for 12 h. When the bacterial colonies grew out, 5 large and round single colonies were selected and mixed into 10 μL of ddH 2 O respectively, and amplified by PCR. The primer sequences are: F(+): ttcatttggagagaacacgggggac, and its sequence is as shown in SEQ ID No.7; R(-): caagaccggcaacaggattcaatc, and its sequence is as shown in SEQ ID No.8. The colony PCR system is shown in Table 5, and the reaction program is shown in Table 6. The PCR products were identified by 1% agarose gel electrophoresis. The corresponding bacterial liquid with successful identification was placed in an LB liquid medium containing kanamycin for amplification and preservation, and then sent to Sangon Biotech for sequencing. The plasmid of the bacterial liquid with correct sequencing results was extracted.

[0057] Table 3 Digestion System and Reaction Conditions

[0058] Component Volume Nuclease-free Water 13 μL 10× Buffer 2 μL BsaI / Eco31I 1 μL pBWA(V)BS 4 μL Total 20 μL 37℃ 1h

[0059] Table 4 Recombination Reaction System and Conditions

[0060] Component Volume Digested product 5 μL Target fragment 5 μL 2× EasyClone Mix 10 μL Total 20 μL 37℃ 30h

[0061] Table 5 Colony PCR Reaction System

[0062] Component Volume Nuclease-free Water 9.5 μL Biorun Magic PCR Mix 12.5 μL F(+)(100 μM) 1 μL R(-)(100 μM) 1 μL Template 1 μL Total 25 μL

[0063] Table 6 Colony PCR Reaction Program

[0064]

[0065]

[0066] Escherichia coli DH5α was sourced from the Soybean Research Institute of Shenyang Agricultural University.

[0067] Agrobacterium tumefaciens EHA105 competent cells were sourced from Wuhan Boyuan Biotechnology Co., Ltd.

[0068] 3. Genetic transformation of soybean cotyledon nodes mediated by Agrobacterium tumefaciens

[0069] (1) Induction: Select healthy, mature soybean seeds and sterilize them using chlorine gas for 18 hours. This experiment was conducted in a fume hood. After sterilization, blow the soybean seeds for 24 hours in a clean bench to disperse the residual chlorine. Seal the culture dish containing the sterilized soybean seeds and store them at 4°C for later use. Inoculate the sterilized soybean seeds with the hilum facing down on the germination medium and place them in a 25°C incubator for 1 day in the dark.

[0070] Among them, the soybean material was Williams 82 from the Soybean Research Institute of Shenyang Agricultural University.

[0071] The formula composition of the germination medium is B5+3.0% sucrose by mass+0.58% agar by mass, pH 5.8.

[0072] (2) Plasmid transformation: Take 1 μL of plasmid and add it to 40 μL EHA105 Agrobacterium competent cells. Mix thoroughly and then pipette it into an electroporation cup. This step should be performed on ice. Electroporate once on the electroporation instrument, take it out and immediately add 1 mL of LB medium and mix thoroughly. Pipet it out and transfer it to a 1.5 mL centrifuge tube. Mix thoroughly and then pipette it into a 1.5 mL centrifuge tube. Incubate it on a shaker at 30°C and 180 rpm for 30 min. Take out the centrifuge tube from the incubator, centrifuge it in a desktop centrifuge for 30 s to precipitate the bacteria. Pipet 800 μL of LB medium from the tube, mix the rest with a gun, and apply it to YEB solid medium containing 100 μg / μL Rif and 50 μg / μL Kan. Incubate it in the dark at 30°C for 48 h.

[0073] The formula of the LB medium is as follows: 1L LB liquid medium: 10g tryptone, 5g yeast extract, 10g NaCl, pH value is 7.0. LB solid medium is added with 1.5% agar powder by mass.

[0074] The formula of YEB solid medium is as follows: 1 YEB liquid medium: 5 g tryptone, 1 g yeast extract, 5 g beef extract, 0.493 g MgSO 4 7H 2 O, pH 5.5. YEB solid medium was added with 1.5% agar powder.

[0075] (3) Preparation of Agrobacterium suspension: Pick a single colony from the plate after culturing for 48 h above and inoculate it into 3 mL of YEB liquid medium, culture overnight, then transfer 1 mL to 50 mL of YEB liquid medium for re-activation. When the OD reaches about 0.6, centrifuge at 4000 rpm for 10 min, collect the bacteria, resuspend twice with 15 mL of co-culture liquid medium to prepare the infection solution for use.

[0076] Among them, the formula composition of the co-culture liquid medium is 1 / 10 B5 + 3.9 g / L MES + 0.25 mg / L GA3 + 1.67 mg / L 6-BAP + 3% sucrose by mass fraction + 400 mg / L Lysteine + 154.2 mg / L DTT + 40 mg / L acetosyringone, pH 5.4.

[0077] (4) Infection: After wounding the germinated soybeans, pour them into the prepared Agrobacterium suspension and infect for 30 min. After the infection, discard the Agrobacterium suspension, and then place the explants on the solid co-culture medium lined with filter paper and co-culture in the dark at 25 °C for 5 days.

[0078] (5) Inoculate the cotyledon node explants after co-culture into the differentiation medium. After culturing for 14 days, transfer the explants to the recovery solid medium to induce bud differentiation, and subculture once every two weeks. The culture conditions are 25 °C, 16 h / 8 h light / dark culture. As shown in (a) of Figure 1 and Figure 1 (b) of

[0079] Among them, the formula composition of the differentiation medium is B5 + 10 mg / L 6-BAP + 0.2 mg / L IBA + 0.59 g / L MES + 3% sucrose by mass fraction + 0.58% agar, pH 5.7.

[0080] The formula composition of the recovery solid medium is MS salts + B5 organic + 0.5 mg / L GA3 + 1.0 mg / L ZT + 0.1 mg / L IAA + 0.59 g / L MES + 50 mg / L Asn + 50 mg / L Gln + 3.0% sucrose by mass fraction + Cef 300 mg + Kanmycin 50 mg / L, pH 5.7.

[0081] (6) Rooting culture: When the young buds grow to about 5 cm, transfer them to the rooting medium for continuous screening. Culture with 16 h / 8 h light / dark for 21 days of screening culture. As shown in (c) of Figure 1 and Figure 1 (d) of

[0082] Among them, the formula composition of the rooting medium: 1 / 2MS salts + 1 / 2B5 organic + 0.5 mg / L NAA + 20 mg / L sucrose + 0.58% agar by mass fraction, pH 5.8.

[0083] 4. Detection of transgenic plants

[0084] The Bar test strip method was used to directly identify the presence or absence of bar / pat protein in transgenic plants. The plant leaf tissue was placed between the lid and the tube body of a disposable tissue extraction tube, and the lid was quickly covered. This was repeated twice to obtain 2 circular leaf tissues. The leaves were placed at the bottom of the extraction tube. A mark was made on the tube wall with a marker pen; the pestle was inserted into the tube, and the pestle was rotated to crush the leaves, and pressure was continuously applied for 20 - 30 seconds; 0.2 mL of extraction buffer was added, and the crushing step was repeated to allow the sample to come into full contact and mix with the buffer.

[0085] Among them, the Bar test strips were sourced from Shanghai Youlong Biotechnology Co., Ltd.

[0086] From Figure 2 it can be seen that Figure 2 in Figure A of Figure 2 1 was detected in Figure B of Figure 2 1 was detected in C of Figure 2 3 were detected in D of

[0087] 5. Treatment of transgenic plants

[0088] The positive seedlings detected by the Bar test strip were removed from the medium, the medium attached to the roots of the seedlings was washed clean, and the seedlings were transplanted into a seedling tray filled with nutrient soil. They were cultured at 27°C with a 16h / 8h light / dark cycle for 3 weeks of acclimatization.

[0089] Among them, the formula composition of the nutrient soil was a 3:1 mixture of soil and gravel.

[0090] (1) Multiplication: Some of the harvested T 0 generation soybean seeds were sown in the nutrient soil, and the T 1 generation seeds were harvested after the end of their growth period.

[0091] (2) Planting under different phosphorus treatments: The sand culture planting method was adopted, and black PVC barrels were used as containers. The PVC barrels were 25 cm high and had an inner diameter of 16 cm. The PVC barrels were filled with clean quartz sand with a particle size of 1.5 mm, about 5 kg.

[0092] Two phosphorus treatments were set in the experiment: normal phosphorus treatment P+ and low phosphorus treatment P-. In each treatment, potassium dihydrogen phosphate was used as the phosphorus source, and KCl was used to supplement the potassium element lacking in the low phosphorus treatment to keep the potassium element content in the nutrient solution consistent. The experiment was set with 3 replicates and arranged in a randomized block design.

[0093] Among them, the concentration of P in the normal phosphorus treatment P+ is: 0.5 mmol / L -1 ; the concentration of P in the low phosphorus treatment P- is: 0.005 mmol / L -1 .

[0094] Take plump wild type Williams 82 and the T 1 soybean seeds overexpressing GmAK1 harvested in step (1) respectively, and sow them in quartz sand in PVC buckets. Sow 5 seeds in each PVC bucket. In the first week after sowing, at 8:00 am every day, irrigate 500 mL of 1 / 2 concentration nutrient solution, namely normal phosphorus treatment P+ and low phosphorus treatment P-. Rinse with 500 mL of distilled water at 4:00 pm every day to ensure that there is no residual nutrient solution in the sand culture bucket. After one week, thin out the seedlings so that there are 3 soybeans evenly distributed in each bucket, cut off the cotyledons, and irrigate with complete nutrient solution. Among them, the nutrient solution formula refers to the research of Villagarcia, M.R. et al. with slight modifications, and adjust the pH to between 5.8 and 6.0 before use. Figure 3 Figure showing the comparison between wild type Williams 82 soybeans and soybeans overexpressing GmAK1 under normal phosphorus conditions at the R4 stage Figure 4 Figure showing the comparison between wild type Williams 82 soybeans and soybeans overexpressing GmAK1 under low phosphorus conditions at the R4 stage

[0095] Among them, the concentration of P in the normal phosphorus treatment P+ is: 0.25 mmol / L -1 ; the concentration of P in the low phosphorus treatment P- is: 0.0025 mmol / L -1 .

[0096] The sand culture bucket is a PVC bucket.

[0097] Example 2: Subcellular localization of GmAK1

[0098] 1. Construction of localization vector

[0099] The steps and reagent sources for constructing the localization vector are the same as those for constructing the vector in Example 1 above, but the primers for amplification are: GmAK1-G-F: 5'-cagtCGTCTCacaacatgacaagcaccatgcaactaactatggtc-3', and its sequence is as shown in SEQ ID No. 9; GmAK1-G-R: 5'-cagtCGTCTCatacaagataatgcaggaacagaa ccatttccagg-3', and its sequence is as shown in SEQ ID No. 10.

[0100] 2. Tobacco transformation

[0101] (1) Plasmid transformation: Take 1 μL of plasmid and add it to 40 μL of Agrobacterium tumefaciens EHA105 competent cells. After thorough mixing, transfer the mixture to an electroporation cuvette (this step is carried out on ice). Give a single electric shock on the electroporator. Immediately after taking it out, add 1 mL of LB liquid medium and mix well. Aspirate and transfer it to a 1.5 mL centrifuge tube. After thorough mixing, transfer it to a 1.5 mL centrifuge tube again. Incubate it on a shaker at 30 °C and 180 rpm for 30 min. Take out the centrifuge tube from the incubator and centrifuge it for 30 s on a tabletop centrifuge to precipitate the bacteria. Aspirate 800 μL of LB medium from the tube, mix the remaining with a pipette, and spread it on a YEB solid medium containing 100 μg / μL Rif and 50 μg / μL Kan. Incubate it in the dark at 30 °C for 48 h.

[0102] (2) Preparation of Agrobacterium suspension: Pick a single colony from the plate after culturing for 48 h above and inoculate it into 3 mL of YEB liquid medium. Incubate it overnight. Then take 1 mL and transfer it to 50 mL of YEB liquid medium for re-activation. When it grows to an OD of about 0.6, centrifuge it at 4000 rpm for 10 min to collect the bacteria. Suspend the precipitated bacteria once with a suspension containing 10 mmol·L -1 MES and 10 mmol·L - 1 MgCl 2 ·6H 2 O. After suspension, centrifuge it at 5000 rpm for 10 min, discard the supernatant. Suspend the precipitate again with a suspension containing 10 mmol·L -1 MES, 10 mmol·L -1 MgCl 2 ·6H 2 O and 200 mmol·L -1 AS until the OD 600 reaches 0.4. Let it stand at room temperature in the dark for 3 h. Pick tobacco leaves with a one-month-old seedling age and consistent growth. Use a 1 mL needleless syringe to inject the suspension after standing for 3 h into the tobacco leaves.

[0103] Among them, 1 L of LB liquid medium: 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, pH value is 7.0. Add 1.5% agar powder to the LB solid medium. 1 L of YEB liquid medium: 5 g of tryptone, 1 g of yeast extract, 5 g of beef extract, 0.493 g of MgSO 4 ·7H 2 O, pH 5.5. Add 1.5% agar powder to the YEB solid medium.

[0104] The tobacco is Nicotiana benthamiana sourced from this laboratory.

[0105] 3. Microscopic observation

[0106] Take the labeled Agrobacterium-injected tobacco leaves, cut the leaves with a blade, place them in the center of a glass slide, drop a drop of distilled water to moisten the leaves, cover with a coverslip, observe under a laser confocal microscope, and take pictures. The results are shown in Figure 5 .

[0107] Figure 5 From left to right are the fluorescence channel, chloroplast fluorescence channel, bright field, and overlay image. A is the target protein and B is the blank control. The overlapping part of the red and green fluorescence in the overlay image is where the protein appears on the chloroplasts in the cell.

[0108] The above results indicate that: The GmAK1-GFP fusion protein has green fluorescence in the chloroplast region, indicating that GmAK1 is a chloroplast-localized protein.

[0109] Example 3 Yeast two-hybrid screening of GmAK1 interacting proteins

[0110] Many eukaryotes usually have two separable domains, the DNA specific binding domain and the transcriptional activation domain. These two domains do not affect each other and each has its own function. However, only when both of these domains are present can the transcriptional reaction be activated. The yeast two-hybrid system can not only study the interaction between two known proteins, but also screen for multiple proteins that interact with a known bait protein using a cDNA library.

[0111] Among them, the English name of the DNA specific binding domain is DNA-binding domain. The English name of the transcriptional activation domain is Transcriptional activation domain.

[0112] In the present invention, pGBKT7-GmAK1 is used as the bait protein to screen for interacting proteins using the yeast two-hybrid technique.

[0113] The specific research is as follows:

[0114] 1. Vector construction

[0115] According to the restriction enzyme sites EcoRI and BamHI selected based on the sequence of the target gene, the soybean low-phosphorus tolerance gene GmAK1, and the multiple cloning site of the bait protein vector pGBKT7, the PCR amplification system is shown in Table 7. The PCR instrument is set with the following program: 94°C for 5 min; GOTO, 30 (94°C for 30 s; 50°C for 45 s; 72°C for 71 s); 72°C for 10 min; 16°C for 30 min. The primer sequences for amplifying the target gene are: AK1-F: 5'-ATGGCCAT GGAGGCCGAATTatgacaagcaccatgcaactaactatggtc-3', and its sequence is shown in SEQ ID No.11; AK1-R: 5'-CCGCTGCAGGTCGACGGATCctaagataatgcaggaacagaaccatttcca g-3', and its sequence is shown in SEQ ID No.12. After PCR amplification, the products are recovered using a kit from Axygen and double digested together with pGBKT7. The digestion system and reaction conditions are shown in Table 8. Then, the target fragment is recombined with the vector to construct the recombinant vector pGBKT7-GmAK1, and Escherichia coli DH5α competent cells are transformed: 10 μL of the recombinant vector pGBKT7-GmAK1 plasmid is added to 50 μL of DH5α competent cells and incubated on ice for 2 min; heat shocked at 42°C for 90 s and then incubated on ice for 5 min; 890 μL of antibiotic-free LB culture medium is added, and the mixture is placed in a constant temperature shaker at 37°C at 150 rpm and shaken gently for 1 h; the bacterial solution after gentle shaking is centrifuged at 7000 rpm for 3 min, and the supernatant is discarded; 80 μL of antibiotic-free LB culture medium is added to the centrifuge tube containing the bacterial cells, and after pipetting evenly, it is spread on a solid LB medium containing kanamycin and cultured upside down at 37°C for 12 h. The grown monoclonal colonies are subjected to colony PCR using the identification primers pGBKT7-F: gacagttgactgtatcgcc, whose sequence is shown in SEQ ID No.13, and pGBKT7-R: gatcctagtggacatgcactc, whose sequence is shown in SEQ ID No.14. The reaction systems are shown in Tables 10 and 11, and then sent for sequencing. The monoclonal colonies with correct sequencing are preserved and the plasmids are extracted to obtain the plasmid of the bait recombinant vector pGBKT7-GmAK1 for standby.

[0116] Among them, Escherichia coli DH5α is preserved in the laboratory.

[0117] Table 7 PCR reaction system for amplifying the target gene

[0118] Component Volume buffer 5 μL <![CDATA[Mg 2+ > 4 μL dNTP 2 μL F Primer 2 μL R Primer 2 μL Pfu Taq enzyme 2U cDNA 1 μL <![CDATA[ddH 2 O]]> 34 μL

[0119] Table 8 Digestion ligation system and reaction conditions

[0120] Component Volume Nuclease-free Water 12 μL 10× Buffer 2 μL EcoRI 1 μL BamHI 1 μL pGBKT7 4 μL Total 20 μL 37℃ 1 hour

[0121] Table 9 Recombinant reaction system and conditions

[0122] Component Volume Nuclease-free Water 0 μL 2× EasyClone Mix 10 μL Purified product 5 μL pGBKT7 5 μL Total 20 μL 37℃ 30 hours

[0123] Table 10 Bacterial plaque PCR reaction system

[0124] Component Volume Nuclease-free Water 9.5 μL Biorun Magic PCR Mix 12.5 μL pGBKT7-F 1 μL pGBKT7-R 1 μL Template 1 μL Total 20 μL 37℃ 30 hours

[0125] Table 11 Bacterial plaque PCR reaction program

[0126] Step Number of cycles 94 °C for 5 min 1 94 °C for 30 sec 30 50 °C for 45 sec 30 72 °C for 101 sec 30 72 °C for 10 min 1 16 °C for 30 min 1

[0127] 2. Preparation and transformation of Y2HGold yeast competent cells

[0128] (1) Use an inoculation needle to pick a single colony on the YPDA plate and inoculate it into the liquid YPDA medium. Incubate overnight (≥12 h) in a shaker at 28°C and 180 rpm / min.

[0129] (2) Dilute the bacterial liquid and spread it on the YPDA solid plate again. Incubate in an incubator at 28°C for 3 days.

[0130] (3) Pipette 1 mL of sterile water into a 2 mL centrifuge tube. Pick Y2HGold yeast cells, gently shake and mix well, centrifuge at 10000 rpm / min for 1 minute, and discard the supernatant.

[0131] (4) Add 1 mL of 1.1×TE / LiAc to the 2 mL centrifuge tube, gently shake and mix well, centrifuge at 10000 rpm / min for 1 minute, and discard the supernatant.

[0132] (5) Repeat the operation in (2).

[0133] (6) Add 600 μL of 1.1×TE / LiAc to the 2 mL centrifuge tube and shake and mix well.

[0134] The above-obtained are Y2HGold yeast competent cells.

[0135] (7) Place salmon sperm DNA on ice. After it has completely melted, boil it in boiling water for 10 minutes. Add it to the yeast competent cells.

[0136] (8) Add 2 μL of the plasmid of the bait recombinant vector pGBKT7-GmAK1 to the centrifuge tube containing the yeast competent cells and mix well.

[0137] (9) Place the centrifuge tube in a water bath at 30°C for 36 minutes, shaking once every 12 minutes.

[0138] (10) Then place the centrifuge tube in a water bath at 42°C for 15 minutes, shaking once every 5 minutes.

[0139] (11) Then place the centrifuge tube in an ice bath for 5 minutes.

[0140] (12) Centrifuge the cooled yeast cells at 10,000 rpm / min for 1 minute, and discard the supernatant.

[0141] (13) Add 200 μL of 0.9% (mass fraction) NaCl solution to the centrifuge tube to resuspend the cells.

[0142] (14) Take 70 μL and spread it on the SD - Trp - deficient medium, and incubate it upside - down at 28 °C for 4 days.

[0143] Among them, the formula of the YPDA solid medium is as shown in Table 12 below:

[0144] Table 12 Formula of YPDA Solid Medium

[0145] Composition Usage amount Peptone 20g Yeast Extract 10g Ade Adenine sulfate 0.02g <![CDATA[C 6 H 12 O 6 Glucose]]> 20g Agar agar powder 20g

[0146] Among them, the Y2HGold yeast cells are the strains preserved in the laboratory of the Soybean Research Institute of Shenyang Agricultural University.

[0147] The salmon sperm DNA is obtained from Coolaber Company.

[0148] The SD - Trp - deficient medium is from Coolaber Company.

[0149] 3. Toxicity detection of pGBKT7 - GmAK1

[0150] Transform the bait recombinant expression vector pGBKT7 - GmAK1 and the pGBKT7 vector empty plasmid into Y2HGold yeast cells (yeast) respectively. Pick single colonies and dilute them 10 - fold and 100 - fold respectively, and culture them on the SD - Trp medium for three days. The results are shown in Figure 6 : Figure 6 A in Figure 6 and B in

[0151] As Figure 6 shown, at the same dilution factor, there is no difference in the growth of yeast cells transformed with the pGBKT7 empty vector plasmid and the bait recombinant expression vector pGBKT7 - GmAK1. This indicates that the bait recombinant expression vector pGBKT7 - GmAK1 has no effect on the growth of yeast cells and has no toxicity itself.

[0152] Among them, the composition or source of the SD - Trp medium is from Coolaber Company.

[0153] 4. Self - activation detection of pGBKT7 - GmAK1

[0154] To detect the autoactivation of the bait recombinant expression vector, the bait recombinant expression vector pGBKT7-GmAK1 plasmid was transformed into yeast. The single colonies of the positive control and the negative control were respectively diluted 10-fold, 100-fold, and 1000-fold, and were inversely cultured in an incubator at 30 °C for three days on SD / -T / -L / X and SD / -T / -L / -H / -A media. The results are shown in Figure 7 : Figure 7 A in Figure 7 and B in

[0155] As Figure 7 shown, there was a small amount of growth of the bait recombinant expression vector pGBKT7-GmAK1 when undiluted. No blue colonies grew on the SD / -T / -L / X medium, and its growth trend on the SD / -T / -L / X and SD / -T / -L / -H / -A media was the same as that of the negative control, while the positive control grew normally.

[0156] The above results indicate that the bait recombinant expression vector has no autoactivation activity.

[0157] Among them, the SD / -T / -L medium and the X-α-gal reagent were sourced from Coolaber Company.

[0158] The SD / -T / -L / -H / -A medium was sourced from Coolaber Company.

[0159] Example 4 Application of the soybean low-phosphorus tolerance gene GmAK1 in soybean breeding

[0160] In production practice, the above gene can be cloned and its overexpression vector can be constructed. Through genetic transformation, the positive seedlings with successful transformation can be cultivated into plants, and then the plants can be treated with different phosphorus concentrations to identify and cultivate the low-phosphorus tolerance ability of the plants; by screening the soybean gene library, the soybean proteins interacting with GmAK1 can be found, which lays a foundation for clarifying the low-phosphorus tolerance mechanism of this gene.

[0161] In production practice, the above gene can also be applied to the identification of parental genetic relationships, the transfer of quantitative traits and recessive traits in backcross breeding, the selection of hybrid offspring, the prediction of heterosis, and the identification of variety purity, etc. through molecular marker-assisted selection breeding methods, so as to improve the advantages of soybean stress resistance, high yield, and quality improvement.

[0162] In the present invention, the function and specific application of the major soybean aspartate kinase gene GmAK1 under low-phosphorus conditions were discovered, which provides a new gene resource for soybean germplasm low-phosphorus tolerance breeding and also lays a foundation for further analyzing the response of the soybean aspartate metabolic pathway to low-phosphorus conditions.

[0163] The preferred specific embodiments of the present invention have been described in detail above. It should be understood that those of ordinary skill in the art can make many modifications and variations based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by those skilled in the art in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should fall within the protection scope determined by the claims. It should be noted that when the present invention involves a numerical range, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected. To avoid redundancy, the preferred embodiments of the present invention are described.

[0164] Although the preferred embodiments of the present invention have been described, once those skilled in the art learn the basic creative concept, additional changes and modifications can be made to these embodiments, and all such changes and modifications fall within the scope of the present invention.

Claims

1. An application of soybean low-phosphorus tolerance gene GmAK1 in plant breeding, characterized in that: The nucleotide sequence of the soybean low-phosphorus tolerance gene GmAK1 is shown in SEQ ID No.1, and the amino acid sequence of the protein expressed by the soybean low-phosphorus tolerance gene GmAK1 is shown in SEQ ID No.2; The plant is soybean; The low-phosphorus tolerance ability of the plant is regulated by increasing the expression amount of the soybean low-phosphorus tolerance gene GmAK1 in the plant.

2. The use according to claim 1, characterized in that: The expression level of the soybean low-phosphorus tolerance gene GmAK1 in plants is increased by transforming the soybean low-phosphorus tolerance gene GmAK1 into plants.

3. The use according to claim 1, characterized in that: The recombinant expression vector containing the soybean low-phosphorus tolerance gene GmAK1 includes the soybean low-phosphorus tolerance gene GmAK1 and also includes a plasmid connected to the soybean low-phosphorus tolerance gene GmAK1.

4. The use according to claim 3, characterized in that: The plasmids include pGBKT7, pGADT7, pBWA(V)BS and pBWA(V)HS vectors.

5. The use according to claim 1, characterized in that: A host cell comprising the soybean low-phosphorus tolerance gene GmAK1 is provided.

6. The use according to claim 5, characterized in that: The host cell is any one of an Escherichia coli cell, an Agrobacterium cell or a plant cell.

Images