An SV molecular marker, primer set and application thereof for identifying elemenine-type Cinnamomum camphora

Abstract

The present invention provides an SV molecular marker, a primer set and an application thereof for identifying elemenine-type fine-hair camphor, and relates to the technical field of molecular markers. The SV molecular marker described in the present invention is located at 4639479bp to 4639522bp on chromosome 5 of the elemenine-type fine-hair camphor genome, and its nucleotide sequence is shown in SEQ ID NO.1. The nucleotide sequence of the primer set designed for the above molecular marker of the present invention is shown in SEQ ID NO.2 and SEQ ID NO.3. The present invention uses cuteSV technology to mine SV molecular marker sites, and through the results of PCR amplification and agarose gel electrophoresis, it can quickly and effectively identify whether the plant to be tested is elemenine-type fine-hair camphor, which provides an effective method for the identification and directional breeding of elemenine-type fine-hair camphor.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and specifically relates to an SV molecular marker, a primer set and application thereof for identifying elemenine-type Cinnamomum camphora. Background Art

[0002] Elemene is a colorless oily liquid, a natural aromatic phenylpropane, with the chemical name 3,4,5-trimethoxyallylbenzene, which is a common alkenylbenzene component in many herbs and spices. The boiling point is 146-147° / 10mm. At present, elemene is mainly used for medical anesthesia. Although many plants contain elemene, they are abandoned because of the low content and difficulty in extraction, and the large amount of impurities. Camphora tenuipilis belongs to the genus Cinnamomum of the Lauraceae family. The leaves are rich in essential oils, and the composition and content are complex. The oil yield of fresh leaves is 0.54-2.08%. According to the main components of the essential oil, it can be divided into 10 chemical types, which is the most common chemical type among the camphor plants found in my country so far. It is extremely rare and has the value of preserving germplasm.

[0003] Cinnamomum oleiferum has strong germination ability and can be used sustainably after planting once. However, due to genetic separation caused by cross-pollination, leaf essential oil extraction and determination can generally be carried out two years after planting to determine its chemical type, and artificial selection and elimination are time-consuming and laborious. Elemone-type Cinnamomum oleiferum is less distributed in the population, and how to screen elemone chemical types at the seedling stage has always been one of the important directions of Cinnamomum oleiferum breeding. With the continuous development of sequencing technology, molecular marker-assisted breeding technology is one of the effective ways to solve this problem.

[0004] As a modern biotechnology, molecular marker-assisted breeding technology uses molecular markers to identify and select individuals with specific genetic characteristics, thereby accelerating the breeding process. This method mainly uses the plant genome as a reference sequence, and compares the resequencing data of different offspring individuals with the reference gene to identify single nucleotide polymorphisms (SNPs), insertions or deletions (InDels) of fragments less than 50bp, structural variations (SVs), and the presence / absence of large genomic fragments (PAVs) on the genome sequence of sequenced individuals or populations. Therefore, it is of great significance to use variation data to screen DNA molecular markers associated with the elemenine chemical type of Cinnamomum camphora. Summary of the invention

[0005] In view of this, the object of the present invention is to provide an SV molecular marker, a primer set and its application for identifying elemenine-type Cinnamomum camphora. The SV molecular marker shows good repeatability among individuals of different chemical types of Cinnamomum camphora and can be used to identify elemenine-type Cinnamomum camphora.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides an SV molecular marker for identifying elemenine-type Cinnamomum camphora, and the nucleotide sequence of the SV molecular marker is shown as SEQ ID NO.1.

[0008] The present invention also provides a primer set for identifying elemenine-type Cinnamomum camphora, wherein the primer set is designed with an upstream primer and a downstream primer according to the molecular marker; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0009] The present invention also provides a kit for identifying elemenine-type Cinnamomum camphora, which comprises the primer set.

[0010] The present invention also provides an application of the molecular marker, the primer set or the kit in identifying elemenine-type Cinnamomum camphora.

[0011] The present invention also provides an application of the molecular marker, the primer set or the kit in the directional breeding of elemenine-type Cinnamomum camphora.

[0012] The present invention also provides a method for identifying elemenine-type Cinnamomum camphora, comprising the following steps:

[0013] Extracting genomic DNA from the sample to be tested;

[0014] Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set or the kit, and performing electrophoresis detection on the PCR amplification product;

[0015] Identify elemenine-type Cinnamomum camphora based on the electrophoresis band results.

[0016] Preferably, the identification criteria are as follows: if the amplification product amplifies a unique 600 bp fragment, the sample to be detected is elemenine-type Cinnamomum quinquefolium; if the amplification product does not amplify a 600 bp fragment, the sample to be detected is non-elemenine-type Cinnamomum quinquefolium.

[0017] Preferably, the reaction system of the PCR amplification is 20 μL as follows: 1 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 10 μL 2×TaqMasterMix, 10 μL ddH 2 O 7 μL.

[0018] Preferably, the reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, 35 amplification cycles; extension at 72°C for 10 min; and storage at 4°C.

[0019] More preferably, the elemenine-type Cinnamomum quinoa refers to Cinnamomum quinoa leaf essential oil extracted by steam distillation, in which the content of elemenine is higher than 75%.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] (1) The present invention uses cuteSV technology and population resequencing data to develop molecular markers for elegans-type Cinnamomum camphora, which has a short cycle, low cost and high efficiency. It can provide a successful case for the development of specific molecular markers for other species and also provide an important development path for the directional breeding of Cinnamomum camphora.

[0022] (2) The existing methods for determining the chemical type of Cinnamomum quinquefolium require that the seedlings with stable leaf essential oil traits be used as materials, and a large number of leaves be taken to extract the leaf essential oil. Using the primers provided by the present invention, only a few milligrams of leaf-extracted DNA is needed as a template for the PCR reaction, and all tissues and developmental stages of the plant body can be detected without being restricted by seasons and the environment. There is no need to wait for the seedlings to grow to more than two years old, which effectively realizes the directional breeding at the seedling stage and saves manpower and material resources.

[0023] (3) The SV molecular marker obtained by the present invention showed good repeatability among individuals of different chemical types of Cinnamomum quinquefolium, stable amplification, and was not affected by environmental conditions. It amplified and produced a band of about 500 bp in plants with an elemenine content of more than 75%, but did not produce a band in other plants, and can be used to identify Cinnamomum quinquefolium chemotypes. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The agarose gel electrophoresis results of the present invention, in which 1-6 are eleminin type Cinnamomum camphora (Elemicin Type), and 7-148 are non-eleminin type Cinnamomum camphora. DETAILED DESCRIPTION

[0025] The invention provides an SV molecular marker for identifying elemenine-type camphor trees. The SV molecular marker is located in the interval of 4639479 bp-4639522 bp on chromosome 5, and its nucleotide sequence is (SEQ ID NO.1).

[0026] In the present invention, the screening method of the SV molecular marker preferably includes the following steps: DNA extraction and resequencing analysis of 148 fine-haired camphor individuals planted in the Xishuangbanna Tropical Botanical Garden of the Chinese Academy of Sciences, and distillation extraction of the leaf essential oil of each individual plant, and further analysis of the composition and content of the leaf essential oil using GC-Mass. According to the analysis results of the composition and content of the leaf essential oil, the plant whose main compound of the leaf essential oil is elemenine and whose content accounts for more than 75% is defined as elemenine-type fine-haired camphor, and the remaining plants are defined as non-elemenine-type plants. The present invention performs ONT, Hic and NGS sequencing on the non-elemenine fine-haired camphor individuals obtained above. The reference genome of the elemenine-type fine-haired camphor is obtained by de novo assembly, and the cuteSV software is used to perform SV identification and analysis in combination with the ONT data of the non-elemenine fine-haired camphor, and the SV interval of the DEL deletion type is screened as a candidate interval for second-generation resequencing data coverage analysis, and a total of 57,743 intervals are screened. The present invention further uses BWA-MEM2 software to compare the population resequencing data with the reference genome of elemenine-type camphor tree to obtain a bam file. The coverage of the candidate interval is calculated using BEDtools software, and the numerical value of coverage greater than 0.85 is replaced by 1, and the coverage less than 0.85 is replaced by 0. The interval assigned to 1 in the elemenine-type camphor tree individual and 0 between other non-elemenine-type camphor tree individuals is selected as a candidate interval for homologous sequence comparison, and a total of 244 intervals are screened. The present invention extracts the sequence in the above 244 candidate intervals as a Query sequence. The above-obtained Query sequence is blastn-compared with the elemenine-type genome and the non-elemenine-type genome, and the interval in which the homologous sequence exists in the elemenine-type genome but not in the non-elemenine-type genome is screened as a candidate interval, and a total of 54 candidate intervals are screened. The present invention further screened the SV molecular marker from 54 candidate intervals and determined that it was located in the interval of 4639479bp-4639522bp on chromosome 5.

[0027] The present invention also provides a primer set for identifying elemenine-type fine-hair camphor, because the lengths of the 54 candidate intervals screened are not uniform, the present invention sets the starting position of the candidate interval as the interval starting site, and the interval length is 600bp to prepare a bed file, uses BEDtools to extract the sequence in the candidate interval, submits the sequence to NCBI, selects Database as: Genoemfor selected eukaryotic organisms (primary assembly only), selects Organism as Laurasiatheria (taxid: 314145), PCR amplification size is 500-600, and the remaining parameters are default parameters, and designs upstream primers and downstream primers according to the nucleotide sequence of the above molecular marker. The nucleotide sequence of the upstream primer is ACTTTAAAGCCTTTGGATGCTAAAT (SEQ ID NO.2); the nucleotide sequence of the downstream primer is ACAAAAGTCCGTGCTAAGCC (SEQ ID NO.3). The present invention designs primers based on the extension of IDE from the 5' end to 600 bp, selects upstream primers containing IDE fragments, ensures that other types of Cinnamomum camphora cannot amplify bands, and screens and obtains primer sets that can amplify specific fragments in elemenine but cannot amplify bands in non-elemenine based on 54 candidate intervals, and determines the amplified sequence to be

[0028] TTACTTTAAAGCCTTTGGATGCTAAATTTATTTTCTCATATACCCATGAGAAA

[0029] AATAGAAGGAAAACAAAAAGAAAACCACCTTTCACTTATCTATAATTCCCT

[0030] TGTTACATATAAAACAACTTCATAATTTTCCAGTAAGTAGCTGTAACTTTCA

[0031] TTTAACCTATTGCTTTTTGATGAGTTCTTACTCTTCTTTTCTCTGATGAGCTA

[0032] CGGTTGCATTAGTGCCATCTTTGAGGTATAGAAAACTCTGAACTCGAGTCA

[0033] AAAGTAGATGATAGTCAAATTTTGCATCAATCCAAAGCATATTCAAGCACTA

[0034] TATCAAGTATTTCAAGTGGATCCTAAGCTCATCCTACTTCATTTCACTAGCA

[0035] CACAACCAAGCAGTTTTGCAAAAGGATCTTCAAAAGATCAAGTTAGCTCC

[0036] TAATTTGACCAGAACTAGGCTCCAGTTGATTTAGGGAATTGAGTACATAAA

[0037] ATTTCATACATTGGTTTCATTCGGTTGTTAAATACAATTTCATACTTGGTGCA

[0038] ACTTCAGTTCAAGTTGTTTAATGGAACTCAAGGGGCAATTATTTGTTTGGCTCGGGCTTAGCACGGACTTTTGTTACTATTT (SEQ ID NO. 1).

[0039] The present invention also provides a kit for identifying elemenine-type Cinnamomum camphora, which comprises the primer set.

[0040] The present invention also provides an application of the molecular marker, the primer set or the kit in identifying elemenine-type Cinnamomum camphora.

[0041] The present invention also provides an application of the molecular marker, the primer set or the kit in the directional breeding of elemenine-type Cinnamomum camphora.

[0042] The present invention also provides a method for identifying elemenine-type Cinnamomum camphora, comprising the following steps:

[0043] Extracting genomic DNA from the sample to be tested;

[0044] Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set or the kit, and performing electrophoresis detection on the PCR amplification product;

[0045] Identify elemenine-type Cinnamomum camphora based on the electrophoresis band results.

[0046] In the present invention, the method for extracting genomic DNA from the sample to be tested can be conventionally selected according to needs. In the present invention, the CTAB method is preferably used to extract genomic DNA from the leaves of Cinnamomum quinquefolium plants.

[0047] In the present invention, the identification criteria are preferably as follows: if the amplification product amplifies a unique fragment of 600 bp, the sample to be detected is elemenine-type Cinnamomum quinquefolium; if the amplification product does not amplify a 600 bp fragment, the sample to be detected is non-elemenine-type Cinnamomum quinquefolium.

[0048] In the present invention, the reaction system of the PCR amplification is preferably calculated as follows: 1 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 10 μL 2×TaqMasterMix, 10 μL ddH 2 O 7 μL.

[0049] In the present invention, the reaction procedure of the PCR amplification is preferably as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, 35 amplification cycles; extension at 72°C for 10 min; and storage at 4°C.

[0050] In the present invention, the leaf essential oil of a single plant of Cinnamomum camphora was extracted by steam distillation, and the composition and content of the leaf essential oil were further analyzed by GC-Mass. According to the composition and content analysis results of the leaf essential oil, the plants whose main compound of the leaf essential oil is elemenine and whose content accounts for more than 75% are defined as elemenine-type Cinnamomum camphora, and the remaining plants are defined as non-elemenine-type plants. That is, the elemenine-type Cinnamomum camphora described in the present invention refers to the Cinnamomum camphora leaf essential oil extracted by steam distillation, in which the content of elemenine accounts for more than 75%.

[0051] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0052] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0053] Example 1 Identification of Elemidine-type Cinnamomum camphora

[0054] In this example, DNA extraction and resequencing analysis were performed on 148 Cinnamomum camphora individuals planted in the Xishuangbanna Tropical Botanical Garden of the Chinese Academy of Sciences, and the leaf essential oil of each individual plant was extracted by steam distillation, and the composition and content of the leaf essential oil were further analyzed using GC-Mass. According to the results of the composition and content analysis of the leaf essential oil, the plants whose main compound of the leaf essential oil is elemenine and whose content accounts for more than 75% are defined as elemenine-type Cinnamomum camphora, and the remaining plants are defined as non-elemenine-type plants. The information and identification results of the 148 Cinnamomum camphora germplasm resources are shown in Table 1:

[0055] Table 1148 Cinnamomum quinquefolium germplasm resource information and identification results

[0056]

[0057]

[0058]

[0059]

[0060] Example 2 Screening of SV molecular markers

[0061] ONT, Hic and NGS sequencing were performed on the non-elemenine Cinnamomum camphora individuals obtained in Example 1. The reference genome of the elemenine-type Cinnamomum camphora was obtained by de novo assembly, and the cuteSV software was used to perform SV identification analysis in combination with the non-elemenine Cinnamomum camphora ONT data, and the SV intervals of the DEL type were screened as candidate intervals for second-generation resequencing data coverage analysis, and a total of 57,743 intervals were screened.

[0062] The population resequencing data were aligned with the reference genome using BWA-MEM2 software to obtain a bam file. The coverage of the candidate intervals was calculated using bedtools software, and the values ​​with coverage greater than 0.85 were replaced by 1, and the values ​​with coverage less than 0.85 were replaced by 0. The intervals assigned a value of 1 in the elemenine-type Cinnamomum stylosus individuals and a value of 0 in other non-elemenine-type Cinnamomum stylosus individuals were selected as candidate intervals for homologous sequence alignment, and a total of 244 intervals were screened.

[0063] Sequences within 244 candidate intervals were extracted as query sequences. The query sequences were blasted with the elemenine genome and the non-elemenine genome, and the intervals with homologous sequences in the elemenine genome but not in the non-elemenine genome were selected as candidate intervals for primer design, and a total of 54 candidate intervals were screened.

[0064] Example 3 Primer design for identifying elemi-type Cinnamomum camphora

[0065] Since the lengths of the 54 candidate intervals screened in Example 2 were not uniform, the starting position of the candidate interval was set as the interval starting site, and the interval length was 600bp to make a bed file, and the sequence in the candidate interval was extracted using BEDtools, and the sequence was submitted to NCBI, and the Database was selected as: Genoem for selected eukaryotic organisms (primary assembly only), and the Organism was selected as Laurasiatheria (taxid: 314145), and the PCR amplification size was 500-600bp, and the nucleotide sequence was: (SEQ ID NO.1). The remaining parameters were the default parameters for PCR primer design, and the nucleotide sequence of the upstream primer was ACTTTAAAGCCTTTGGATGCTAAAT (SEQ ID NO.2); the nucleotide sequence of the downstream primer was ACAAAAGTCCGTGCTAAGCC (SEQ ID NO.3).

[0066] Example 4 Kit for Identifying Elemidine-type Cinnamomum camphora

[0067] A kit for identifying elemenine-type camphor, comprising the upstream primer, downstream primer, 2×Taq MasterMix (novoprotein) and ddH 2 O.

[0068] Example 5

[0069] This example identifies the chemical types of 148 Cinnamomum quinquefolium individuals planted in the Xishuangbanna Tropical Botanical Garden of the Chinese Academy of Sciences, and the steps are as follows:

[0070] The genomic DNA of 148 Cinnamomum quinquefolium individuals was obtained, and the genomic DNA was used as a template and the primers of Example 2 were used to perform a PCR reaction. A 20 μL PCR reaction system was configured as shown in Table 2:

[0071] Table 2 PCR reaction system

[0072] Reagents Dosage template 1μL 1μM upstream primer / Actin-F 1μL 1μM downstream primer / Actin-R 1μL 2×TaqMasterMix(novoprotein) 10μL <![CDATA[ddH 2 The]]> 7μL

[0073] Actin-F sequence is: TTCCTTTCCGGTGGTGCTAC (SEQ ID NO. 4);

[0074] The sequence of Actin-R is: TTCCTTTCCGGTGGTGCTAC (SEQ ID NO. 5).

[0075] PCR reaction conditions are shown in Table 3:

[0076] Table 3 PCR reaction conditions

[0077]

[0078] Agarose gel electrophoresis of PCR products:

[0079] The electrophoresis was performed using 1.5% agarose gel at 150 V for 20 minutes, and the bands were observed under UV light.

[0080] according to Figure 1 The results of electrophoresis showed that 1-6 were eleminin type Cinnamomum camphora, and the amplified product was a 600 bp fragment; 7-148 were non-eleminin type Cinnamomum camphora, and no 600 bp fragment was amplified.

[0081] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SV molecular marker for identifying elemi-type Cinnamomum camphora, characterized in that: The nucleotide sequence of the SV molecular marker is shown in SEQ ID NO.1; the elemenine-type Cinnamomum pubescens refers to Cinnamomum pubescens leaf essential oil extracted by steam distillation, in which the content of elemenine is higher than 75%.

2. A primer set for identifying elemenine-type Cinnamomum camphora, characterized in that: The primer set is designed with an upstream primer and a downstream primer according to the molecular marker according to claim 1; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. A kit for identifying elemi-type camphor trees, characterized in that: The kit comprises the primer set according to claim 2.

4. Use of the molecular marker according to claim 1, the primer set according to claim 2, or the kit according to claim 3 in identifying elemenine-type Cinnamomum camphora; the elemenine-type Cinnamomum camphora refers to Cinnamomum camphora leaf essential oil extracted by steam distillation, in which the content of elemenine accounts for more than 75%.

5. Use of the molecular marker according to claim 1, the primer set according to claim 2, or the kit according to claim 3 in the directional breeding of elemenine-type Cinnamomum camphora; the elemenine-type Cinnamomum camphora refers to Cinnamomum camphora leaf essential oil extracted by steam distillation, in which the content of elemenine accounts for more than 75%.

6. A method for identifying elemi-type Cinnamomum camphora, characterized in that: The steps include: Extracting genomic DNA from the sample to be tested; Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set of claim 2 or the kit of claim 3, and performing electrophoresis detection on the PCR amplification product; The elemenine-type Cinnamomum quinoa is identified according to the electrophoresis band results; the elemenine-type Cinnamomum quinoa refers to Cinnamomum quinoa leaf essential oil extracted by steam distillation, in which the content of elemenine is higher than 75%.

7. The identification method according to claim 6, characterized in that: The identification criteria are as follows: if the amplification product amplifies a unique fragment of 600 bp, the sample to be tested is elemenine-type Cinnamomum camphora; if the amplification product does not amplify a 600 bp fragment, the sample to be tested is non-elemenine-type Cinnamomum camphora.

8. The identification method according to claim 6, characterized in that: The reaction system of the PCR amplification is calculated as 20 μL: 1 μL of DNA template, 1 μL of upstream primer, 1 μL of downstream primer, 10 μL of 2×Taq MasterMix, and 7 μL of ddH2O.

9. The identification method according to claim 6, characterized in that: The reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, 35 amplification cycles; extension at 72°C for 10 min; and storage at 4°C.

Images