A galactosyltransferase mutant and its application in preparing flavonoids
By performing site-directed mutagenesis on UDP-galactosyltransferase VcUFGT, a galactosyltransferase mutant with higher catalytic efficiency was generated, solving the problem of high extraction cost of hyperoside and realizing the efficient production of flavonoids.
Patent Information
- Application Number
- CN202411216107.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-30
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2044-08-30
AI Technical Summary
The high extraction cost of hyperoside in existing technologies limits its application.
The UDP-galactosyltransferase VcUFGT was mutated at a specific site using a galactosyltransferase mutant to generate a UDP-galactosyltransferase mutant with higher catalytic efficiency, which can be used to catalyze the synthesis of flavonoids.
The mutant exhibits a catalytic efficiency that is more than 1.5 times higher, reducing the production cost of flavonoids and providing a foundation for industrial production.
Smart Images

Figure CN118909996B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of enzymology, and particularly relates to a galactosyltransferase mutant and application thereof in preparation of flavonoid compounds. BACKGROUND
[0002] Hyperoside is also known as hyperoside-3-O-beta-D-galactopyranoside, the aglycone of which is hyperoside, and the sugar group is pyranogalactose, which is connected to the sugar group through a beta glycoside bond at the 3-position O atom of hyperoside, and has a molecular formula of C 21 H 20 O 12 and a molecular weight of 464.3763. Hyperoside is a flavonoid compound extracted from the fruits of Hypericum ascyron, and has the effects of antioxidation, blood pressure reduction, blood lipid reduction, coronary artery dilation, and treatment of chronic bronchitis, and is often used in the fields of medicine and health care products.
[0003] However, hyperoside is currently mainly obtained through extraction, such as using Hypericum ascyron as raw material and extracting through water distillation, solvent extraction, supercritical fluid extraction, direct steam distillation, microwave-assisted extraction process, or supercritical CO2 method. There is inevitably a problem of high extraction cost, which leads to high price of hyperoside and limits the application range of hyperoside to a certain extent. SUMMARY
[0004] The application provides a galactosyltransferase mutant and application thereof in preparation of flavonoid compounds, and the UDP-galactosyltransferase mutant has high efficiency in catalyzing synthesis of flavonoid compounds and is suitable for industrial production of flavonoid compounds.
[0005] The application provides a UDP-galactosyltransferase mutant, which comprises point mutation of galactosyltransferase VcUFGT, and the point mutation comprises mutating one amino acid in the amino acid sequence of the galactosyltransferase VcUFGT into alanine.
[0006] Preferably, the amino acid sequence of the galactosyltransferase VcUFGT is shown in SEQ ID No. 2.
[0007] Preferably, the point mutation comprises any of the following point mutations in the amino acid sequence shown in SEQ ID No. 2: H82A, V139A, G141A, P186A, N245A, V282A or S307A.
[0008] The application further provides a coding gene of the above-mentioned UDP-galactosyltransferase mutant.
[0009] Preferably, the coding gene is mutated on the basis of the coding gene of the galactosyltransferase VcUFGT.
[0010] The nucleotide sequence of the coding gene of the galactosyltransferase VcUFGT is shown as SEQ ID No. 1.
[0011] Preferably, the nucleotide sequence of the coding gene of the UDP-galactosyltransferase mutant is mutated as any one of the following compared with SEQ ID No. 1: 244-246 from CAC to GCG, 416-417 from TC to CG, 422-423 from GA to CG, 556-558 from CCA to GCG, 733-735 from AAC to GCG, 845-866 from TC to CG, and 919-921 from TCT to GCG.
[0012] The application also provides a recombinant expression vector comprising the above-mentioned coding gene.
[0013] The application also provides a recombinant host comprising the above-mentioned coding gene and expressing the above-mentioned UDP-galactosyltransferase mutant.
[0014] The application also provides the application of the above-mentioned UDP-galactosyltransferase mutant or the product prepared by the above-mentioned recombinant host in catalyzing the synthesis of flavonoids.
[0015] The application also provides a method for catalyzing the production of flavonoids in vitro, comprising using quercetin and UDP-galactoside as substrates, and using the above-mentioned UDP-galactosyltransferase mutant or the product prepared by the above-mentioned recombinant host as catalyzing enzyme to catalyze the synthesis of flavonoids.
[0016] Beneficial effects: the application provides a UDP-galactosyltransferase mutant, which is obtained by site-directed mutagenesis of one amino acid in the amino acid sequence of wild-type galactosyltransferase VcUFGT to alanine (A). A series of mutants H82A, V139A, G141A, P186A, N245A, V282A and S307A are verified in the examples, and the mutants can perform enzyme catalysis reaction with quercetin and UDP-galactoside as substrates to generate flavonoid hyperoside. The specific enzyme activity of the mutant is increased by more than 1.5 times compared with the wild type, which provides an effective application basis for the biosynthesis of flavonoids (hyperoside, Figure 1 ). BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 is the structural formula of hyperoside;
[0018] Figure 2 is a schematic diagram of the reaction of galactosyltransferase catalyzing quercetin to synthesize hyperoside;
[0019] Figure 3 Figure 1 is a plasmid map of recombinant plasmid pET-30a(+)-VcUFGT;
[0020] Figure 4 Figure 2 is a SDS-PAGE electrophoretogram of wild type and mutants of galactosyltransferase VcUFGT;
[0021] Figure 5 Figure 3 is a liquid phase contrast chart (detection wavelength: 280 nm) of reaction product of synthesis of hyperoside from quercetin catalyzed by galactosyltransferase and mutants thereof;
[0022] Figure 6 Figure 4 is a specific enzyme activity comparison result of synthesis of hyperoside from quercetin catalyzed by galactosyltransferase and mutants thereof. DETAILED DESCRIPTION
[0023] The present application provides a UDP-galactosyltransferase mutant, which comprises point mutation of galactosyltransferase VcUFGT, and the point mutation comprises point mutation of one amino acid in the amino acid sequence of galactosyltransferase VcUFGT to alanine.
[0024] The mutant of the present application is based on galactosyltransferase VcUFGT, and the galactosyltransferase VcUFGT is subjected to site-directed mutagenesis to obtain a large number of mutants. The amino acid sequence of the galactosyltransferase VcUFGT of the present application is preferably as shown in SEQ ID No. 2: Met Ser Asn Phe Ser Lys Asp Arg His Val Ala Val Leu Pro Phe Pro Phe Ser Thr His Ala Ala Pro Ile Leu Ser Ile Ile Arg Arg Phe Ala Ser Ala Ser Pro Asp Val Thr Phe Ser Phe Phe Ser Ile Pro Gin Ser Ile Gin Thr Leu Phe Pro Ser Glu Asn Pro Asp Ser Asn Ile Lys Pro Tyr Val Val Ser Asp Gly Val Pro Glu Gly Tyr Val Phe Ser Gly Lys His His Glu Asp Ile Asn Leu Phe Leu Ala Ala Gly Lys Glu Ser Leu Lys Ala Gly Met Lys Ala Ala Glu Ala Glu Ile Gly Arg Arg Ile Asp Cys Val Val Ala Asp Ala Phe Leu Trp Phe Thr Gin Glu Leu Ala Glu Glu Met Gly Val Pro Trp Ile Thr Leu Trp Val Ser Gly Ala Cys Ser Leu Ser Ala His Cys Tyr Thr Asp Leu Ile Arg Glu Thr Val Gly Met His Asp Ile Ala Gly Arg Glu Asn Glu Ile Val Lys Phe Val Pro Gly Phe Ser Glu Val Arg Leu Gly Asp Leu Pro Ser Gly Val Val Tyr Gly Asn Leu Glu Ser Pro Phe Ser Met Met Leu Tyr Asn Met Gly Gin Val Leu His Lys Ala Thr Ala Val Ala Ile Asn Ser Phe Glu Glu Leu Glu Pro Glu His Asn Lys Val Leu Glu Ser Lys Phe Lys Lys LeuLeu Asn Cys Gly Pro Phe Asn Ser lie Ser Pro Pro Pro Pro Pro Ser Ser Asn Leu Asp Lys Tyr Gly Cys lie Pro Trp Leu Asp Gin His Lys Thr Arg Ser Val Ala Tyr lie Gly Phe Gly Ser Val Ala Thr Pro Pro Pro Val Glu lie Ala Ala Leu Ala Glu Ala Leu Glu Ala Ser Gly Thr Pro Phe Leu Trp Ser Leu Arg Asp Asn Phe Lys Lys His Leu Pro Glu Gly Phe Leu Lys Arg Thr Ser Glu Leu Gly Lys lie Val Ala Trp Ala Pro Gin Val Gin Val Leu Ala His Ser Ser lie Gly Val Phe lie Asn His Cys Gly Trp Asn Ser Val Leu Glu Ser lie Val Ala Gly Val Pro lie lie Gly Arg Pro Phe Phe Gly Asp His Gin Val Asp Thr Trp Met Val Glu Asn Val Trp Lys lie Gly Val Arg Val Glu Gly Gly Val Phe Thr Lys Ser Gly Thr Met Ser Ala Leu Glu Leu Val Leu Ser Gin Glu Lys Gly Lys Glu Leu Arg Glu Gin Thr Gly Lys Tyr Lys Glu Phe Ala Leu Lys Ala Val Gly Pro Lys Gly Arg Ser Thr Gin Asn Leu Asn Thr Leu Leu Glu Leu Val Arg Gly Tyr Asn lie.
[0025] The point mutation of the present application preferably includes any one of the following point mutations in the amino acid sequence shown in SEQ ID No. 2: H82A, V139A, G141A, P186A, N245A, V282A or S307A, and each mutant is named by the point mutation site and the amino acid sequence before and after the mutation, such as the mutant H82A obtained by H82A point mutation, the mutant V139A obtained by V139A point mutation, the mutant G141A obtained by G141A point mutation, the mutant P186A obtained by P186A point mutation, the mutant N245A obtained by N245A point mutation, the mutant V282A obtained by V282A point mutation, and the mutant S307A obtained by S307A point mutation.
[0026] The present application also provides a gene encoding the above-mentioned UDP-galactose transferase mutant.
[0027]
[0028] The nucleotide sequence of the coding gene of the mutant is identical to the nucleotide at the rest of the sites except the site corresponding to the point mutation, such as the nucleotide sequence of the coding gene of the mutant H82A is mutated from CAC to GCG at the site of 244-246 of the sequence shown in SEQ ID No. 1; the nucleotide sequence of the coding gene of the mutant V139A is mutated from TC to CG at the site of 416-417 of the sequence shown in SEQ ID No. 1; the nucleotide sequence of the coding gene of the mutant G141A is mutated from GA to CG at the site of 422-423 of the sequence shown in SEQ ID No. 1; the nucleotide sequence of the coding gene of the mutant P186A is mutated from CCA to GCG at the site of 556-558 of the sequence shown in SEQ ID No. 1; the nucleotide sequence of the coding gene of the mutant N245A is mutated from AAC to GCG at the site of 733-735 of the sequence shown in SEQ ID No. 1; the nucleotide sequence of the coding gene of the mutant V282A is mutated from TC to CG at the site of 845-866 of the sequence shown in SEQ ID No. 1; the nucleotide sequence of the coding gene of the mutant S307A is mutated from TCT to GCG at the site of 919-921 of the sequence shown in SEQ ID No. 1.
[0029] The application further provides a recombinant expression vector comprising the coding gene.
[0030] The application does not have special limitation on the gene source of the galactosyltransferase VcUFGT, which can be isolated from the Emerald variety (Vaccinium corymbosum L.) of the southern highbush blueberry, can be isolated from the recombinant engineering bacteria containing the coding gene, or can be artificially synthesized. The recombinant expression vector is preferably based on a prokaryotic expression vector as a carrier skeleton, such as the pET series vector.
[0031] In constructing the recombinant expression vector of the mutant, the galactosyltransferase VcUFGT is used as a template, and the site-directed point mutation is performed by using the primer pair shown in Table 1 to obtain the mutant.
[0032] Table 1 primer sequence for constructing the mutant
[0033]
[0034]
[0035] The application further provides a recombinant host comprising the coding gene and expressing the UDP-galactose transferase mutant.
[0036] The recombinant host of the present application preferably includes a recombinant bacterium, a recombinant fungus or a recombinant plant, and the present application is exemplified by a recombinant bacterium, but cannot be identified as the whole protection scope of the present application.
[0037] In the embodiments of the present application, the recombinant expression vector is transformed into the competent cells of E. coli by the method of genetic transformation, so as to obtain the recombinant bacterium; then the recombinant bacterium is induced by IPTG for prokaryotic expression, and the recombinant protein is extracted and purified from the supernatant of the broken bacteria, so as to obtain each mutant protein.
[0038] In the embodiments of the present application, the genetically engineered bacteria of each mutant are the recombinant E. coli containing the recombinant vector of the mutant coding gene; the recombinant plasmid is chemically transformed into the competent cells of BL21 (DE3), and after recovering for 1 hour, it is coated on the LB plate containing 50 μg / mL kanamycin resistance, and is cultured at 37°C overnight; sequencing identification is performed, so as to obtain the recombinant E. coli genetically engineered bacteria. The induction and expression conditions of the genetically engineered bacteria preferably include: the E. coli is inoculated into the LB culture medium containing 50 μg / mL kanamycin resistance, and is cultured at 37°C, 200 rpm and oscillation until the OD 600 of the culture solution is about 0.6; then IPTG with a final concentration of 0.1 mM is added, and the culture is performed at 16°C, 180 rpm for 20 hours; and the bacteria are collected by centrifugation.
[0039] The present application also provides the application of the above-mentioned UDP-galactose transferase mutant or the product prepared by using the above-mentioned recombinant host in catalyzing the synthesis of flavonoids.
[0040] The mutant has the ability of catalyzing the synthesis of flavonoids from quercetin, and can catalyze the reaction as shown in the following formula (I): Figure 2 , so as to generate flavonoids including hyperoside.
[0041] The present application also provides a method for catalyzing the production of flavonoids in vitro, which includes using quercetin and UDP-galactose as substrates, and using the above-mentioned UDP-galactose transferase mutant or the product prepared by using the above-mentioned recombinant host as the enzyme for catalysis, so as to catalyze the synthesis of flavonoids.
[0042] The temperature of the catalytic reaction for catalyzing the synthesis of flavonoids such as hyperoside is preferably 20-40°C, and the pH value is preferably 7.0-9.0.
[0043] The system of the enzymatic reaction preferably includes 0.01-0.1 M Tris-HCl buffer (pH=7.0-9.0), 1-5 mM glycosyl donor (UDP-galactose), 0.5-2.5 mM glycosyl acceptor substrate (quercetin) and 50-100 μg purified enzyme in 200 μL.
[0044] In order to further illustrate the present application, a galactosyltransferase mutant and its application in preparing flavonoids provided by the present application are described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the present application.
[0045] Example 1 Construction of recombinant plasmid and expression strain of galactosyltransferase VcUFGT
[0046] The genomic DNA of Vaccinium corymbosum L. was extracted by using the genomic DNA extraction kit of QIAGEN Co., Ltd. The RNA of mature blueberry fruits (variety Green Gem, Vaccinium corymbosum L.) was extracted by using the Plant RNA Kit of Plant RNA Co., Ltd. Subsequently, the extracted RNA was reversely transcribed into blueberry fruit cDNA by using the PrimeScript RT reagent Kit of Takara Bio Inc., and was stored at -80°C for standby use. TM The extracted RNA was reversely transcribed into blueberry fruit cDNA by using the PrimeScript RT reagent Kit, and was stored at -80°C for standby use.
[0047] The primer VcUFGT-BamHI-F and the primer VcUFGT-XhoI-R were designed, and the VcUFGT gene was amplified from the blueberry fruit cDNA by using the PrimeStar DNA polymerase based on the PCR technology. The system of the PCR was as follows: 32.5 μL ddH2O, 10 μL 5×buffer, 4 μL 2.5 mM dNTPs, 1 μL 10 mM primer VcUFGT-BamHI-F, 1 μL 10 mM primer VcUFGT-XhoI-R, 1 μL blueberry genomic cDNA, and 0.5 μL PrimeStar DNA polymerase. The PCR program was as follows: 98°C pre-denaturation for 2 min, followed by 35 cycles of 98°C denaturation for 10 s, 55°C annealing for 15 s, and 72°C extension for 1.5 min, 72°C continuous extension for 5 min, and then storage at 4°C. The PCR product was purified by using the PCR product purification kit of Beijing Zison Biological Technology Co., Ltd., and was ligated with the vector pET-30a(+) treated by the restriction endonuclease BamHI and XhoI. The ligation product was transformed into the E. coli BL21(DE3), and was coated on the plate containing kanamycin resistance and was placed in the constant temperature incubator at 37°C for overnight culture (12-16 h). A single colony was picked up and was added into the test tube containing 5 mL LB liquid medium with kanamycin resistance, and was placed in the shaker for overnight culture at 37°C and 200 rpm. The bacterial liquid was sampled for sequencing by using the universal sequencing primers SeqN1 and SeqN2. According to the sequence results, the strain with correct sequencing was selected as the expression strain of the recombinant plasmid pET-30a(+)-VcUFGT. Figure 3 The ligation product was transformed into the E. coli BL21(DE3), and was coated on the plate containing kanamycin resistance and was placed in the constant temperature incubator at 37°C for overnight culture (12-16 h). A single colony was picked up and was added into the test tube containing 5 mL LB liquid medium with kanamycin resistance, and was placed in the shaker for overnight culture at 37°C and 200 rpm. The bacterial liquid was sampled for sequencing by using the universal sequencing primers SeqN1 and SeqN2. According to the sequence results, the strain with correct sequencing was selected as the expression strain of the recombinant plasmid pET-30a(+)-VcUFGT.
[0048] The amplification primers and sequencing primers used in this example are as follows:
[0049] VcUFGT-BamHI F (SEQ ID No. 17): CGGATCCATGCACCATCATCATCATCA;
[0050] VcUFGT-XhoI R (SEQ ID No. 18): CCTCGAGTTAGATATTGTAACCTCTGA;
[0051] SeqN1 (SEQ ID No. 19): CAGCCGGATCTCAGTGGTGG;
[0052] SeqN2 (SEQ ID No. 20): TCTGGTATGAAAGAAACCGC.
[0053] Example 2 Construction of recombinant plasmids and expression strains of galactosyltransferase VcUFGT mutants
[0054] According to the sequence of the galactosyltransferase VcUFGT gene (SEQ ID No. 1), the primers corresponding to the mutants H82A, V139A, G141A, P186A, N245A, V282A and S307A were designed (Table 1), and the recombinant plasmids pET-30a(+)-H82A, pET-30a(+)-V139A, pET-30a(+)-G141A, pET-30a(+)-P186A, pET-30a(+)-N245A, pET-30a(+)-V282A and pET-30a(+)-VcUFGT-S307A of the mutants H82A, V139A, G141A, P186A, N245A, V282A and S307A of the galactosyltransferase VcUFGT were constructed respectively using the FastMutagenesisSystem kit of TAKARA and using the recombinant plasmid pET-30a(+)-VcUFGT as the template and using the corresponding primers.
[0055] The recombinant plasmids pET-30a(+)-H82A, pET-30a(+)-V139A, pET-30a(+)-G141A, pET-30a(+)-P186A, pET-30a(+)-N245A, pET-30a(+)-V282 and pET-30a(+)-VcUFGT-S307A of the galactosyltransferase VcUFGT mutant were transformed into E. coli BL21 (DE3) respectively, spread on plates containing kanamycin, and incubated in an inverted thermostat at 37°C overnight (12-16 h). Single colonies were picked and added to 5 mL LB liquid medium containing kanamycin in test tubes, and incubated in a shaker at 37°C, 200 rpm overnight. The bacterial solution was sequenced using universal primers Seq 1 and Seq 2. According to the sequence results, the strains with correct sequencing were selected as the expression strains of the recombinant plasmids pET-30a(+)-H82A, pET-30a(+)-V139A, pET-30a(+)-G141A, pET-30a(+)-P186A, pET-30a(+)-N245A, pET-30a(+)-V282 and pET-30a(+)-VcUFGT-S307A.
[0056] Example 3 Expression and purification of galactosyltransferase VcUFGT and its mutants
[0057] The expression strains of the recombinant plasmids pET-30a(+)-H82A, pET-30a(+)-V139A, pET-30a(+)-G141A, pET-30a(+)-P186A, pET-30a(+)-N245A, pET-30a(+)-V282 and pET-30a(+)-VcUFGT-S307A constructed in Example 2 were added to 5 mL LB liquid medium containing kanamycin in test tubes at a ratio of 1:50, and incubated in a shaker at 37°C, 200 rpm overnight. Then, 5 mL of the overnight bacterial solution was added to 100 mL LB liquid medium containing kanamycin, and incubated in a shaker at 37°C, 200 rpm for 2-3 h until the OD 600 was about 0.6. IPTG solution was added to a final concentration of 0.1 mM, and incubated in a shaker at 16°C, 180 rpm for 20 h to induce protein expression. The bacterial solution was centrifuged at 8000 rpm, 4°C for 15 min, and the bacterial cells were resuspended with 1x PBS buffer pre-frozen at 4°C and stored in a -80°C refrigerator.
[0058] The bacteria body frozen in -80℃ refrigerator was placed in 37℃ water bath condition for melting, and the bacteria body was broken by ultrasonic. The ultrasonic breaking procedure was as follows: ultrasonic for 4s, interval for 2s, and ultrasonic for 10min. The protein was purified by Clontech HisTALON kit of Baorui Biotechnology Co., Ltd., and the related procedure was operated according to the instruction manual of the kit. Then, the protein was desalted by PD-10 column of GE Medical, and the related operation was performed according to the recommended procedure of the instruction manual. The protein was placed at -80℃ for standby. The amount of the purified protein was about 5mg. The wild type and mutant protein samples of VcUFGT after purification were detected by SDS-PAGE to determine whether the protein sample after purification was correct. Figure 4
[0059] Example 4 Enzyme activity test of galactosyltransferase VcUFGT and its mutants
[0060] The total volume of the reaction system was 200μL, which contained 0.1M Tris-HCl buffer (pH=7.0), 1mM glycosyl donor (UDP-galactose), 0.5mM glycosyl acceptor substrate (quercetin) and about 50μg of VcUFGT protein and each mutant obtained in Example 3.
[0061] The reaction condition of the enzyme activity test was incubation at 30℃ water bath condition for 16h, and then 200μL of methanol containing 1% formic acid was added to terminate the reaction. After centrifugation at 12000rpm for 3min, the supernatant was filtered by 0.22μM organic filter membrane, and then liquid chromatography was used for detection.
[0062] Instrument: ThermoFisher U3000 high performance liquid chromatograph; analysis column: Promosil C18 column (4.6x250mm, 5μm); detection wavelength: 280nm; sample injection: 20μL; detection temperature: 30℃; flow rate: 1mL / min, and the mobile phase was acetonitrile (A phase) and 1.5% formic acid solution (B phase). The elution gradient was set as follows: 0-9min, the proportion of A phase was increased from 10% to 50%; 9-10min, the proportion of A phase was kept at 50%; 10-15min, the proportion of A phase was increased from 50% to 100%; 15-16min, the proportion of A phase was decreased from 100% to 10%; 16-21min, the proportion of A phase was kept at 90%. The results of the enzyme activity test are shown in Figure 5 and Figure 6 .
[0063] The specific enzyme activity of the mutants H82A, V139A, G141A, P186A, N245A, V282A and S307A for catalyzing quercetin to synthesize hyperoside was increased by more than 1.5 times compared with the wild type.
[0064] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.
Claims
1. A UDP-galactosyltransferase mutant, characterized in that, The point mutation of the galactosyltransferase VcUFGT comprises mutating one amino acid in the amino acid sequence of the galactosyltransferase VcUFGT into alanine; The amino acid sequence of the galactosyltransferase VcUFGT is shown in SEQ ID No. 2; The point mutation is H82A mutation in the amino acid sequence shown in SEQ ID No.
2.
2. A gene encoding the UDP-galactosyltransferase mutant of claim 1.
3. The genetic code according to claim 2, wherein, The gene is mutated based on the gene encoding the galactosyltransferase VcUFGT; The nucleotide sequence of the gene encoding the galactosyltransferase VcUFGT is shown in SEQ ID No.
1.
4. The genetic code according to claim 3, wherein, The nucleotide sequence of the gene encoding the UDP-galactosyltransferase mutant is mutated at positions 244-246 from CAC to GCG compared with SEQ ID No.
1.
5. A recombinant expression vector comprising the gene of any one of claims 2-4.
6. A recombinant host comprising the gene of any one of claims 2-4 and expressing the UDP-galactosyltransferase mutant of claim 1.
7. Use of the UDP-galactosyltransferase mutant of claim 1 or a product prepared using the recombinant host of claim 6 in catalyzing synthesis of hyperoside.
8. A method for in vitro catalytic production of hyperoside, characterized by, The UDP-galactosyltransferase mutant of claim 1 or a product prepared using the recombinant host of claim 6 is used as a catalyzing enzyme to catalyze synthesis of hyperoside using quercetin and UDP-galactose as substrates.
Citation Information
Patent Citations
Application of directionally mutated glycosyl transferase in synthesis of galactoside anthocyanin
CN118813574A
Cited By
Application of directionally mutated glycosyl transferase in synthesis of galactoside anthocyanin
CN118813574A
Application of a Directedly Mutated Glycosyltransferase in the Synthesis of Galactoside Anthocyanins
CN118813574B