Endoglucanase mutants with improved thermostability and methods for making same
By performing site-directed mutagenesis on Bacillus endoglucanase, a mutant with improved thermal stability was obtained, which solved the problem of low catalytic efficiency under high temperature conditions and achieved higher enzyme activity and a wider temperature range.
Patent Information
- Application Number
- CN202411305403.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-09-19
AI Technical Summary
Existing endoglucanases have low catalytic efficiency under high temperature conditions, which cannot meet the needs of industrial production.
By artificially performing site-directed mutagenesis on endoglucanase derived from Bacillus geosporus, mutants with amino acid sequences of V217L, N264Y, or R170P/N264Y were obtained, thereby improving their thermal stability.
The mutant showed a 217% increase in residual enzyme activity after treatment at 95℃, and its relative enzyme activity was higher than that of the original enzyme within the range of 65℃ to 95℃, maintaining good catalytic performance and making it suitable for a higher and wider temperature range.
Smart Images

Figure CN118910015B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to an endoglucanase mutant, in particular to an endoglucanase mutant with improved thermostability, and belongs to the field of genetic engineering. BACKGROUND
[0002] Cellulose is the most abundant polysaccharide in nature, and is an environmentally friendly and biodegradable natural organic polymer material. Cellulose and its derivatives are widely used in biological medicine, food, electronic components, new energy and many other fields. Its hydrolysis products are important raw materials for wine engineering, paper and textile production, biofuels and chemicals. As the main structural component of plant cell walls, cellulose is usually combined with hemicellulose, pectin and lignin, which greatly affects the texture of plant-derived products. For example, in the food processing industry, the presence of cellulose reduces the extraction rate and quality of fruit juice, and has a negative impact on production efficiency and product quality. Among various methods of degrading cellulose, biological degradation using cellulase has become the focus of industrial production related to cellulose due to its mild reaction conditions and environmental friendliness.
[0003] Endoglucanase is an important cellulase that can randomly cut the amorphous region inside the cellulose polysaccharide chain, hydrolyze glycosidic bonds, break cellulose chains, and produce oligosaccharides of different lengths and new chain ends, playing an important role in degrading cellulose molecules. The enzymatic properties of endoglucanases from different sources differ greatly. Currently known endoglucanases have low catalytic efficiency under high temperature conditions, which cannot meet the needs of industrial production. Chinese invention patent CN 108048430A discloses an endoglucanase NfEG12A mutant, its encoding gene and application. The optimal temperature of the mutant is 65℃, and the catalytic efficiency at this temperature is 0.5-0.8 times higher than that of the wild enzyme. Chinese invention patent CN 102443576A discloses a mutant of endoglucanase, its encoding gene and application. The mutant has a wide working temperature range, with an optimal temperature of 75℃ and a specific activity higher than that of the wild type at this temperature. Endoglucanases with higher thermostability can maintain higher catalytic performance in complex environments of practical application. SUMMARY
[0004] The purpose of the present application is to provide an endoglucanase mutant with improved thermostability, and to provide a nucleic acid molecule encoding the mutant, a vector or a recombinant cell or product containing the mutant, and a preparation method and application of the mutant.
[0005] Technical solution: The first aspect of the present application provides three endoglucanase mutants, the amino acid sequence of the endoglucanase mutants is obtained by mutating the sequence shown in SEQ ID No. 1, the mutation is V217L or N264Y or R170P / N264Y.
[0006] The endoglucanase from Geobacillus sp. 70PC53 is used as the original enzyme, the amino acid sequence is shown in SEQ ID No. 1, and the nucleotide sequence is shown in SEQ ID No. 2. The endoglucanase mutants are obtained by artificial site-directed mutation of the original enzyme.
[0007] The standard single letter and standard substitution notation of amino acids are used in the present application: V217L means that the valine (V) at the N-terminal 217th position is mutated to leucine (L); R170P / N264Y means that the arginine (R) at the N-terminal 170th position is mutated to proline (P), and the asparagine (N) at the N-terminal 264th position is mutated to tyrosine (Y).
[0008] The second aspect of the present application provides a nucleic acid molecule encoding the endoglucanase mutant of the first aspect. The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID No. 2.
[0009] The third aspect of the present application provides a vector comprising the nucleotide sequence of the second aspect. The vector can be a cloning vector or an expression vector.
[0010] The fourth aspect of the present application provides a recombinant cell comprising the vector of the third aspect.
[0011] The fifth aspect of the present application provides a preparation method of the endoglucanase mutant of the first aspect, comprising the following steps: (1) designing a point mutation primer, using a plasmid comprising the nucleotide sequence of SEQ ID No. 2 as a template to perform PCR reaction, digesting the template with an endonuclease, and then recombining the digestion product to obtain an expression vector with a mutant gene; (2) transforming the expression vector into a host cell for fermentation expression; (3) collecting the host cell, breaking the cells, centrifuging to obtain the supernatant, and then obtaining the endoglucanase mutant.
[0012] The sixth aspect of the present application provides a product comprising the endoglucanase mutant of the first aspect, the nucleic acid molecule of the second aspect, the vector of the third aspect, or the recombinant cell of the fourth aspect.
[0013] The seventh aspect of the present application provides an application of the product of the sixth aspect in catalyzing cellulose hydrolysis. The temperature of the catalysis is 65-95 DEG C.
[0014] Compared with the prior art, the endoglucanase mutant provided by the application has the following remarkable advantages: 1. The endoglucanase mutant provided by the application has higher thermal stability than the original enzyme, and the residual enzyme activity of the mutant can be increased by 217% compared with the original enzyme after being treated at 95 DEG C; 2. The relative enzyme activity of the endoglucanase mutant provided by the application is higher than that of the original enzyme at 65 DEG C to 95 DEG C, and the mutant can maintain good catalytic performance in a higher and wider temperature range, and has a good industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 is a schematic diagram of the protein structure of the original enzyme of the application (containing the 217th amino acid site);
[0016] Figure 2 is a schematic diagram of the protein structure of the original enzyme of the application (containing the 170th and 264th amino acid sites);
[0017] Figure 3 is a schematic diagram of the relative enzyme activity of the original enzyme and the mutant after being treated at different temperatures. DETAILED DESCRIPTION
[0018] The technical solutions of the application will be further described below with reference to the drawings.
[0019] The materials and reagents used in the examples, unless otherwise specified, can be obtained from commercial channels.
[0020] Example 1: Endoglucanase mutant V217L
[0021] In this example, the endoglucanase of Geobacillus sp. 70PC53 is used as the original enzyme, and the valine (V) at the N-terminal 217th amino acid in the amino acid sequence shown in SEQ ID No. 1 is mutated to leucine (L). The structure of the original enzyme is shown in Figure 1 , and the nucleic acid sequence is shown in SEQ ID No. 2.
[0022] The preparation method of the mutant V217L is as follows: 1. constructing a recombinant plasmid; 2. expressing the enzyme mutant and preparing a crude enzyme solution.
[0023] The specific steps are as follows:
[0024] 1. Constructing a recombinant plasmid
[0025] The plasmid pET-22b(+) and E. coli DH5α are both obtained from commercial channels and preserved by the applicant. The original enzyme is synthesized by Jinweizhi (Suzhou) Company and inserted between the NdeI and XhoI enzyme cutting sites of the plasmid pET-22b(+). PyMOL is used for 3D modeling to determine that the 217th amino acid is the mutation site, and the position of the amino acid in the protein is as shown inFigure 1 The plasmid with original enzyme was used as template for PCR method to carry out site-directed mutation, mutation primers were shown in Table 1, PCR system was prepared as shown in Table 2, and PCR procedure was set as shown in Table 3.
[0026] Table 1 V217L mutation primers
[0027] Mutant primer name Sequence (5'-3') V217L-F CGATCGCCTGGATGCGGCGCTGCAAGCGGGC V217L-R CGCATCCAGGCGATCGCGCAGCCACTGCGTATG
[0028] Note: the underlined part in the primer is mutation site, "F" represents upstream primer, and "R" represents downstream primer.
[0029] Table 2 PCR reaction system
[0030] Component Volume 10 x Buffer for KOD-Plus- 2.5 μL 2 mM dNTP 2.5 μL 25 mM MgSO4 1.5 μL DMSO 1 μL 10 pmol / μL Forward Primer 0.75 μL 10 pmol / μL Reverse Primer 0.75 μL DNA template <100 ng KOD-Plus- 1 μL ddH2O up to 25 μL
[0031] Table 3 PCR reaction procedure
[0032]
[0033] The PCR product was added with 1 μL Dpn I restriction endonuclease, and the digestion reaction was carried out at 37 °C for 1 h.
[0034] 2. Construction of strain expressing recombinant mutant enzyme and preparation of crude enzyme solution
[0035] The digestion product was transformed into E. coli DH5a competent cells by heat shock method, and was cultured at 37 °C for 1 h, and was inoculated on LB solid medium containing 100 μg / mL ampicillin and was cultured at 37 °C overnight. A single colony was selected and inoculated in LB liquid medium containing 100 μg / mL ampicillin and was cultured overnight. The plasmid was extracted using GenScript Plasmid Miniprep Kit, and was sent to Goldengene (Suzhou) for sequencing. The plasmid with correct mutant enzyme was transformed into E. coli BL21 competent cells by heat shock method, and was inoculated on LB solid medium containing 100 μg / mL ampicillin and was cultured at 37 °C overnight. A single colony was selected and inoculated in LB liquid medium containing 100 μg / mL ampicillin and was cultured overnight. The culture solution of recombinant strain was added with 50% glycerol, and was stored at -80 °C.
[0036] The bacteria liquid was streaked on LB solid medium containing 100 μg / mL ampicillin and incubated at 37°C overnight. Single colony was inoculated into 3 mL LB liquid medium containing 100 μg / mL ampicillin and incubated at 37°C for 8 h. The culture was inoculated into a 250 mL conical flask containing 50 mL TB medium (yeast powder 12 g / L, tryptone 12 g / L, glycerol 4 ml / L, potassium phosphate dibasic 12.5 g / L, potassium phosphate monobasic 2.3 g / L) at 5% inoculation amount and incubated at 37°C, 180 rpm. After 8 h incubation, 50 μL of 400 mM IPTG solution was added and the culture was further incubated at 22°C for 22 h. The fermentation broth was collected and centrifuged at 8000 g for 20 min. The cells were washed twice with 200 mM PBS buffer at pH 7.0 and finally resuspended in 10 mL of corresponding pH buffer. The cells were broken by ultrasonication for 5 min, 5 s on and 5 s off. The supernatant was collected by centrifugation at 8000 g for 20 min and used as the crude enzyme solution of endoglucanase mutant V217L.
[0037] Example 2 Endoglucanase mutant N264Y
[0038] In this example, the asparagine (N) at position 264 of the N-terminal of the original endoglucanase sequence shown as SEQ ID No. 1 was mutated to tyrosine (Y). The position of this amino acid in the protein is shown in Figure 2 The mutation primers are shown in Table 4. The preparation method is referred to Example 1.
[0039] Table 4 Mutation primers for N264Y
[0040] Mutant primer name Sequence (5'-3') N264Y-F GTTGGGTGTATTGGAGCCTGTGCGATAAAAAC N264Y-R GCTCCAATACACCCAACTAATGCCGCGTTC
[0041] Example 3 Endoglucanase mutant R170P / N264Y
[0042] In this example, the arginine (R) at position 170 of the N-terminal of the endoglucanase N264Y in Example 2 was mutated to proline (P). The position of this amino acid in the protein is shown in Figure 2 The primers are shown in Table 5. The preparation method is referred to Example 2.
[0043] Table 5 Mutation primers
[0044] Mutant primer name Sequence (5'-3') R170P-F CATTGATCCGGATAACCTGATTATTGTGGGC R170P-R GGTTATCCGGATCAATGCTGCGAATGGTGCG
[0045] Example 4 Enzyme activity determination of the original endoglucanase and its mutants after treatment at different temperatures
[0046] The cells in Examples 1-3 were resuspended in Tris buffer with pH 7.0, and the cells were broken by ultrasonic as described in Example 1 to collect the crude enzyme solution of the original enzyme and three mutants. The crude enzyme solution was sealed and divided into 15 mL centrifuge tubes, and then was placed in a water bath at 65°C, 75°C, 85°C, and 95°C for 1 hour, respectively. The supernatant was collected by centrifugation. The residual enzyme activity was determined by using 1% carboxymethyl cellulose sodium solution as the substrate and the dinitrosalicylic acid method. Specifically, 30 μL of the crude enzyme solution and 120 μL of 1% carboxymethyl cellulose sodium solution were added to a clean enzyme plate, and the reaction was carried out at 60°C for 30 min. Then, 150 μL of DNS solution was added to stop the reaction, and the plate was placed in a boiling water bath for 10 min. The plate was quickly cooled to room temperature, and the absorbance was measured at 540 nm. The same conditions were used to add the inactivated enzyme solution sample as a blank control. The endoglucanase enzyme activity (U) was defined as: under the above reaction and analysis conditions, the amount of enzyme that catalyzes the production of 1 μmol of glucose reducing power per minute was defined as one enzyme activity unit. The enzyme activity of the original enzyme at 65°C was defined as 100%, and the relative enzyme activity was calculated based on this value.
[0047] The detection results are shown in Table 1. Figure 3 The results show that the enzyme activity of the original endoglucanase and the mutant enzymes all decreased after being treated at a temperature above 65°C. After being placed in a water bath at 75°C for 1 hour, the residual enzyme activity of the enzyme mutants V217L, N264Y, and R170P / N264Y was higher than 50%. After being placed in a water bath at 85°C for 1 hour, the residual enzyme activity of the enzyme mutant N264Y was increased by 37.1% compared to the original enzyme. After being placed in a water bath at 95°C for 1 hour, the residual enzyme activity of the enzyme mutant N264Y was increased by 217.0% compared to the original enzyme.
Claims
1. An endoglucanase mutant, characterized in that, The amino acid sequence of the endoglucanase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, and the mutant is N264Y or R170P / N264Y; N264Y refers to the mutation of asparagine (N) at position 264 of the N-terminus of the sequence shown in SEQ ID No.1 to tyrosine (Y); R170P / N264Y refers to the mutation of asparagine (N) at position 264 of the N-terminus of the sequence shown in SEQ ID No.1 to tyrosine (Y), and the mutation of arginine (R) at position 170 of the N-terminus to proline (P).
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the endoglucanase mutant of claim 1.
3. A carrier, characterized in that, It includes the nucleic acid molecule as described in claim 2.
4. The carrier according to claim 3, characterized in that, The vector is a cloning vector or an expression vector.
5. A recombinant cell, characterized in that, The recombinant cells comprise the vector as described in claim 3.
6. A method for preparing the endoglucanase mutant according to claim 1, characterized in that, Includes the following steps: (1) Design point mutation primers, use a plasmid containing the nucleotide sequence encoding SEQ ID NO.1 as a template, perform PCR reaction, digest the template with an endonuclease, and then recombinate the digestion product to obtain an expression vector with the mutant gene; (2) Transform the expression vector into the host bacteria for fermentation expression; (3) Collect the host bacteria, break the cells, centrifuge and take the supernatant to obtain the endonuclease mutant.
7. The application of the endoglucanase mutant of claim 1 in the catalytic hydrolysis of cellulose.
8. The application according to claim 7, characterized in that, The catalytic temperature is 65℃~95℃.
Citation Information
Patent Citations
Mutant of endoglucanase, coding gene and application thereof
CN102443576A
Endoglucanase NfEG12A mutants as well as coding genes and application thereof
CN108048430A
Endoglucanase NfE12A mutant with improved catalysis efficiency, and coding gene and application thereof
CN106566821A
Endo-beta-1, 4-glucanase mutant as well as gene, carrier and preparation method thereof
CN118165960A