Rice cytokinin response regulator gene OsRR11 and its application

Through the recombinant vector and genetic transformation of the rice cytokinin response regulator gene OsRR11, the unclear regulatory mechanism of rice resistance to brown planthoppers was solved, the resistance of rice to brown planthoppers was significantly enhanced, and a theoretical basis for breeding was provided.

CN118910077BActive Publication Date: 2025-10-14HUBEI HONGSHAN LABORATORY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410872436.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-01
Publication Date
2025-10-14
Estimated Expiration
2044-07-01

AI Technical Summary

Technical Problem

In the existing technology, the regulatory mechanism of rice resistance to brown planthoppers is unclear, especially how type-B RRs in the cytokinin signaling pathway mediate the insect resistance response has not been clarified, which affects the breeding effect of brown planthopper-resistant rice varieties.

Method used

By studying and utilizing the rice cytokinin response regulator gene OsRR11, a recombinant vector was constructed and genetic transformation was performed to achieve overexpression or knockout of OsRR11 and verify its function in rice resistance to brown planthoppers.

Benefits of technology

Overexpression of OsRR11 significantly enhanced rice resistance to brown planthoppers, while knockout significantly reduced resistance, providing a theoretical basis for the design of insect-resistant molecules and improving the breeding effect of rice resistance to brown planthoppers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118910077B_ABST
    Figure CN118910077B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to a rice cytokinin response regulator gene OsRR11 and application. Research finds that OsRR11 encodes a conserved protein containing an aspartic acid signal receiving domain, and is a specific response regulator of cZ in rice; through research, it is found that OsRR11 has a positive regulation function in the resistance of rice to brown planthopper. Through agrobacterium-mediated genetic transformation, OsRR11 is overexpressed in japonica OsRR11 and is knocked out in Bph6-NIL, the resistance of the overexpression plant to brown planthopper is significantly enhanced, and the resistance of the knockout mutant plant to brown planthopper is significantly weakened. The gene of the application provides a good theoretical basis for studying how cytokinin participates in the insect resistance of rice through a response regulator, has a reference significance for studying the molecular function of a gene, and provides a gene resource for molecular design breeding of rice insect resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a rice cytokinin response regulator gene OsRR11 and an application thereof. Background Art

[0002] Rice is one of my country's most important grain crops, constantly threatened by pests and diseases throughout its lifecycle. Among them, the brown planthopper (NLP) is one of the most common pests affecting rice production and affecting the largest area of ​​rice production. NLPs use their needle-like mouthparts to suck sap from the rice phloem, causing loss of nutrients, yellowing leaves, and even withering and collapsing. When a NLP outbreak occurs, large areas of rice fields collapse and collapse, resulting in reduced or even complete crop failure, a phenomenon known as "planthopper fire." In addition to direct damage, NLPs can also spread or induce various rice diseases, such as sawtooth dwarf disease and grassy dwarf disease, causing indirect damage. NLPs are the number one pest in my country's rice production. According to statistics, NLPs infect 3.87 mu of land in my country each year, resulting in approximately 120 tons of rice losses, accounting for 29.5% of the total losses from all rice pests and diseases. NLPs are also the number one pest in rice production across Asia, often causing heavy losses to rice crops worldwide. Therefore, curbing the development and harm of brown planthoppers is a critical need to ensure the safety of rice production in my country and around the world. Crop breeding practices have shown that discovering and utilizing rice brown planthopper-resistant genes, elucidating the mechanisms of resistance, and cultivating and promoting brown planthopper-resistant rice varieties in production are the most economical, effective, environmentally friendly, and ecologically safe measures for controlling this major agricultural pest. Summary of the Invention

[0003] The present invention aims to provide a rice cytokinin response regulator gene OsRR11 and its application, so as to achieve the breeding application of rice varieties resistant to brown planthoppers through the rice cytokinin response regulator gene OsRR11.

[0004] Cytokinin (CK), an important and well-known hormone, is widely involved in plant growth, development, and responses to biotic and abiotic stresses. Studies have shown that spraying exogenous CK significantly enhances rice resistance to the brown planthopper (NLP), while spraying the CK biosynthesis inhibitor lovastatin (Lov) significantly reduces resistance. However, how CK regulates rice resistance to NLP through downstream signaling pathways remains understudied.

[0005] Studies have found that the cytokinin signal transduction process is conserved across different plants. The plant perception and transduction pathway for cytokinin signals is a two-component binary system similar to that of bacteria, primarily composed of receptor proteins: histidine kinases (HKs), histidine phosphotransfer proteins (HPs), and downstream response regulators (RRs). Histidine kinase receptor proteins receive cytokinins, and the conserved histidine (Hi) residue of the receptor undergoes autophosphorylation. Subsequently, the phosphotransfer proteins HPs enter the cell nucleus and transmit the phosphorylation signal to type-A or type-B RRs. Finally, the RRs regulate downstream gene expression, completing CK signaling.

[0006] In the cytokinin signaling system, RRs are the terminal components of cytokinin signal transduction, affecting not only plant growth and development but also responding to biotic and abiotic stresses. Based on their sequence and structural characteristics, RRs can be divided into three categories: type-A, type-B, and type-C. All of these RRs contain a conserved signal-receiving domain containing aspartate. However, unlike type-A and type-C RRs, type-B RRs, including type-A RRs, contain a DNA-binding domain that can directly regulate downstream gene expression.

[0007] Although the cytokinin signaling pathway is well understood, further research is needed to understand how RRs mediate CK involvement in various biological processes and which genes they directly regulate to enable hormone signaling. Rice type-A RRs are widely involved in processes such as root growth and development, meristem formation, hypocotyl elongation, delayed flowering, and leaf senescence. However, whether RRs participate in insect resistance and the molecular mechanisms underlying this involvement remain unknown.

[0008] The rice brown planthopper-resistance gene, Bph6, is a novel, broad-spectrum, insect-resistant gene encoding a previously uncharacterized protein that confers high resistance to brown planthoppers and white-backed planthoppers, making it of great value in rice breeding for brown planthopper resistance. Studies have shown that cis-zeatin (cZ) plays a crucial role in Bph6-mediated insect resistance. However, the specific RRs through which cZ regulates insect resistance remain unclear.

[0009] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0010] The first aspect of the present invention is to provide a rice cytokinin response regulator gene OsRR11, whose CDS sequence is shown in SEQ ID NO. 1 and whose ORF is 444 bp in full length.

[0011] Those skilled in the art will understand that, based on the nucleotide sequence shown in SEQ ID No. 1, replacing, deleting, and / or adding one or more nucleotides can obtain an amino acid sequence with the same function. For example, in sequences in different rice backgrounds, replacing or deleting one or more nucleotides will result in an amino acid sequence with no frameshift mutation, but only partial amino acid deletions or point mutations. Therefore, the gene described in the present invention also includes a nucleotide sequence with the nucleotide sequence shown in SEQ ID No. 1 having the same function as obtained by replacing, deleting, and / or adding one or more nucleotides.

[0012] The second aspect of the present invention is the use of the aforementioned rice cytokinin response regulator gene OsRR11 in breeding rice varieties resistant to brown planthoppers.

[0013] The third aspect of the present invention is to provide a protein encoded by the aforementioned gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0014] It should be understood that, under the premise of not affecting the activity of the protein encoded by the gene OsRR11 (i.e., not in the active center of the protein), those skilled in the art can make various substitutions, additions and / or deletions of one or more amino acids to the amino acid sequence shown in SEQ ID NO. 2 to obtain an amino acid sequence with equivalent function, which is all within the protection scope of the amino acid sequence.

[0015] The fourth aspect of the present invention is the use of the protein encoded by the aforementioned gene in breeding rice varieties resistant to brown planthoppers.

[0016] The fifth aspect of the present invention is the recombinant vector of the rice cytokinin response regulator gene OsRR11 as described above.

[0017] The sixth aspect of the present invention is the use of the aforementioned recombinant vector of the rice cytokinin response regulator gene OsRR11 in breeding rice varieties resistant to brown planthoppers.

[0018] The seventh aspect of the present invention is a transformant of the aforementioned rice cytokinin response regulator gene OsRR11.

[0019] The eighth aspect of the present invention is the use of the transformant of the rice cytokinin response regulator gene OsRR11 described above in breeding rice varieties resistant to brown planthoppers.

[0020] Specifically, the present application also includes a sense sequence or an antisense sequence based on the polynucleotide, a cloning vector or an expression vector containing the polynucleotide sequence or a fragment thereof, a host cell containing the vector, a transformed plant cell containing the nucleotide sequence or a fragment thereof, and a transgenic plant.

[0021] Advantages and effects of the present application:

[0022] The present application provides a rice cytokinin response regulator gene OsRR11. We found that OsRR11 encodes a conserved protein containing an aspartate signal receiving domain, and is a specific response regulator for cZ in rice. We found that OsRR11 has a positive regulatory function in the resistance of rice to brown planthopper. We used Agrobacterium-mediated genetic transformation to overexpress OsRR11 in Nipponbare and knock out OsRR11 in Bph6-NIL. The overexpression plants showed significantly enhanced resistance to brown planthopper, and the knock out mutant plants showed significantly reduced resistance to brown planthopper. The gene of the present application provides a good theoretical basis for studying how cytokinin is involved in the resistance of rice to insects through response regulators, and has a reference significance for studying the molecular function of genes, and provides a gene resource for molecular design breeding of rice resistance to insects. BRIEF DESCRIPTION OF DRAWINGS

[0023] The accompanying drawings are included to provide a further understanding of the present application, and constitute a part of the specification, illustrate the present application and explain the principles of the present application, and are used to explain the present application together with the embodiments of the present application, and do not constitute a limitation of the present application. In the drawings:

[0024] Figure 1 The figure is a quantitative analysis result chart of the specific response of the OsRR11 gene to cZ in an embodiment of the present application.

[0025] Figure 2 The figure is a plant growth state photo and analysis result chart in the process of seedling group method insect resistance identification of transgenic and knock out mutant plants.

[0026] Figure 3 The figure is an analysis result chart of the brown planthopper honeydew and insect weight gain method insect resistance identification of transgenic and knock out mutant plants. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means familiar to those skilled in the art; the experimental methods used are all conventional methods and can be completed according to the described recombinant technology (see Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can be obtained from commercial channels.

[0028] [Example 1] Obtaining the rice OsRR11 gene

[0029] By screening the rice 9311 library for interacting proteins with the brown planthopper-resistant gene Bph6, a cytokinin response regulator, OsRR11, was identified. The ORF sequence of this gene is shown in SEQ ID NO. 1, encoding 147 amino acids, and the amino acid sequence is shown in SEQ ID NO. 2. OsRR11 contains a conserved aspartate signal-receiving domain and is a specific RR for downstream cZ signaling.

[0030] This example provides a molecular detection method for the rice cytokinin response regulator gene OsRR11. Genomic DNA of the transgenic rice to be tested is amplified using a primer pair, and the amplified product is detected. These primers are vector primers; this sequence is not present in the wild-type rice genome. If a 728 bp amplification fragment is amplified using primers Hyg-L and Hyg-R, it indicates that the plant is transgenic-positive; if this fragment is not amplified, it indicates that the plant is transgenic-negative.

[0031] The screening primers are

[0032] Hyg-L:GCTCCATACAAGCCAACCAC(5'-3')

[0033] Hyg-R: GAAAAAGCCTGAACTCACCG(5'-3').

[0034] Specifically, primers were designed for the ORF, and PCR amplification was performed using Nipponbare rice cDNA as a template using the high-fidelity enzyme KOD-Plus-Neo (TOYOBO, Japan) in a 50 μl reaction system. PCR conditions were: 94°C pre-denaturation for 2 minutes, 95°C denaturation for 10 seconds, and 68°C annealing and extension for 30 seconds / kb for 32 cycles. The PCR system was as follows:

[0035]

[0036] The PCR product was recovered and ligated into the pMD18-T vector, and positive clones were screened and sequenced. The result is shown in SEQ ID No. 1.

[0037] [Example 2] Quantitative PCR detection of rice OsRR11 gene

[0038] To understand whether OsRR11 is a cZ-specific downstream RR, expression analysis was performed on samples of Bph6-NIL and 9311 treated with ck, 6-BA, and cZ. The results showed that this gene was specifically upregulated by cZ treatment ( Figure 1 To further verify this conclusion, we analyzed the expression of OsRR11 in deletion mutants of OsIPT9 and OsIPT10, the rate-limiting enzymes in cZ synthesis, and found that Figure 1 As shown in B, compared with Bph6-NIL (also referred to as WT), the expression level of OsRR11 gene in OsIPT9 and OsIPT10 deletion mutants was significantly reduced, further confirming that OsRR11 is a cZ-specific response regulator gene. Figure 1 As shown, in Figure 1 In the figure, “OsRR11 relative expression” refers to “OsRR11 relative expression level”; “Bph6-NIL” refers to “near-isogenic line plants carrying Bph6 for resistance to brown planthoppers”; “Bph6-Ri” refers to “Bph6 transgenic plants inhibited by RNAi”; “ipt9-1 and ipt9-18” refer to “OsIPT9 gene knockout plants”, which have lost the cZ synthesis function; “ipt10-4 and ipt10-5” refer to “OsIPT10 gene knockout plants”, which have lost the cZ synthesis function.

[0039] The primers used for quantitative PCR are:

[0040] RR11-F:ATAATCACGGACTACTGGATGCC(5'-3')

[0041] RR11-R:ACATTCTCCGAGGACATGATCAC(5'-3').

[0042] Based on the above results, OsRR11 is a specific response regulator of the cZ signaling pathway.

[0043] [Example 3] Construction of OsRR11 gene overexpression vector, CRISPR / Cas9 vector and Agrobacterium-mediated genetic transformation

[0044] 1. Construction of OsRR11 overexpression vector

[0045] The inventors designed primers by cutting a section from each end of the ORF of OsRR11. The sequences are as follows:

[0046] OERR11-F:ATTCCCGGGTATGTCGTCGATCGGCGCC(5'-3')

[0047] OERR11-R:ATTCCCGGGAATGGTAGCACGCGGCTG(5'-3')

[0048] The vector used was pRHV (provided by Researcher Ning Yuese of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences). The pRHV vector was digested with SamI, and the exogenous fragment was cleaved and directly ligated into the dephosphorylated vector. Based on the sequence of SEQ ID No. 1, the ORF was amplified using PCR and cleaved after ligation into the vector. After sequencing verification, the resulting vector, identified as the OsRR11 gene overexpression vector, was electroporated into Agrobacterium tumefaciens EHA105. A single clone was selected for expansion and PCR verification, then mixed with an equal volume of 50% glycerol and stored at -80°C until further use.

[0049] 2. Construction of OsRR11 CRISPR / Cas9 knockout vector

[0050] Find the specific target on the target gene (generally 20bp), design primers, and amplify the sgRNA fragment and U6a promoter fragment containing the specific target of the target gene respectively; overlap the two together using the overlapping PCR method; the PCR product is detected by agarose gel electrophoresis. If it is a single band, the product can be directly recovered. If there is a mixed band, the gel needs to be cut and then the gel is recovered. The recovered fragment and the pYLCRISPR / Cas9Pubi-H vector (pYLCRISPR / Cas9Pubi-H vector was provided by Academician Liu Yaoguang of South China Agricultural University) were connected using the Golden Gate cloning method (Ma et al., 2015, A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant 8: 1274-1284). The positive clones with correct sequencing were extracted with plasmids and electrotransformed into Agrobacterium EHA105 for subsequent genetic transformation experiments.

[0051] 3. Genetic transformation

[0052] The OsIPT9 gene overexpression vector was introduced into Nipponbare using Agrobacterium EHA105-mediated genetic transformation (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6: 271-282).

[0053] Transgenic offspring were tested using hygromycin primers Hyg-L and Hyg-R, resulting in 20 overexpressing transgenic (OsRR11-OE) plants. Gene knockout (Osrr11) plants were identified by sequencing, yielding two homozygous mutants with different knockout patterns.

[0054] [Example 4] Phenotypic analysis of OsRR11 gene overexpression and knockout mutant plants

[0055] 1. Seedling Group Method

[0056] Approximately 60 seeds were collected from the materials to be identified (OsRR11-overexpressing plants (OsRR11-OE), OsRR11-knockout plants (Osrr11), Nipponbare, and Bph6-NIL). After soaking and germination, the seeds were sown in 10 cm diameter plastic cups, with approximately 20 seeds per cup. Three cups were sown for each material. When the seedlings reached the three-leaf stage, seedlings with poor growth were removed. Each cup of material was covered with a mesh bag and 2-3 instar brown planthopper nymphs were inoculated into the bag at a rate of 8 per seedling. When the susceptible control showed mortality of more than 90%, the resistance level of each cup of material was recorded. Figure 2 ,Depend on Figure 2 It can be seen that Figure 2 Nipponbare is an OsRR11 overexpressing transgenic receptor and a highly susceptible brown planthopper control plant, OsRR11-OE-1 and Osrr11-OE-2 are OsRR11 overexpressing homozygous transgenic T3 plants, Osrr11-1 and Osrr11-2 are OsRR11 knockout mutant homozygous plants, and Bph6-NIL is an OsRR11 knockout transgenic receptor and a highly resistant brown planthopper control plant. It can be seen that, compared with Bph6-NIL, the degree of wilting of rice seedlings after OsRR11 knockout (Osrr11) increased significantly, indicating a significant decrease in insect resistance; compared with Nipponbare, the degree of wilting of rice seedlings after OsRR11 overexpression (OsRR11-OE) was significantly reduced, so combined with Figure 2 It can be seen that the resistance level of overexpression plants to brown planthoppers is significantly increased, while the resistance level of knockout mutant plants to brown planthoppers is significantly reduced.

[0057] 2. Determination of honeydew amount and weight gain of brown planthopper

[0058] The parafilm was formed into bags of appropriate sizes. Each wax bag was numbered and weighed on a scale, and then tied to the rice stem. Meanwhile, newly emerged female brown planthoppers were captured, numbered, weighed on a scale, and placed into the corresponding numbered wax bags. After the brown planthoppers had fed for 48 hours, the brown planthoppers and wax bags were weighed separately on a scale. The difference between the two weighings of the wax bag was recorded as the honeydew amount of the brown planthopper, and the difference between the two weighings of the brown planthopper nymphs was recorded as the brown planthopper weight gain. Thirty independent biological replicates were performed for each material.

[0059] The statistical results are as follows Figure 3 As shown, Figure 3 The statistical results of the experiments on Osrr11-1, Osrr11-2, OsRR11-OE-1, OsRR11-OE-2, Bph6-NIL, and Nipponbare showed that after OsRR11 overexpression, the body weight and honeydew excretion of brown planthoppers were significantly reduced compared with Nipponbare, indicating that the insect resistance was significantly increased; after OsRR11 knockout (Osrr11), the body weight and honeydew excretion of brown planthoppers were significantly increased compared with Bph6-NIL, indicating that the insect resistance was significantly reduced. Figure 3 It can be seen that the resistance of overexpression plants to brown planthoppers is significantly enhanced, while the resistance of knockout mutant plants to brown planthoppers is significantly weakened, indicating that OsRR11 positively regulates rice resistance to brown planthoppers.

[0060] The application of the OsRR11 gene is a prime example of the involvement of cytokinin response regulators in crop resistance to insects. This research provides valuable insights into the function of cytokinin response regulators and the regulation of CZ resistance. The study of the OsRR11 gene provides a sound theoretical foundation for the molecular mechanisms of rice resistance to brown planthoppers and is of great significance for molecular design breeding.

[0061] It should be noted that, in this document, terms such as "comprises", "includes" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article or apparatus.

[0062] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A method for producing a rice cytokinin response regulator gene OsRR11, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

1. The rice cytokinin response regulator gene OsRR11 is used in breeding rice varieties resistant to brown planthoppers, and the rice variety is Nipponbare.

2. Use of a protein encoded by the rice cytokinin response regulator gene OsRR11, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2. The protein is used in cultivating rice varieties resistant to brown planthoppers, and the rice variety is Nipponbare.

3. Use of a recombinant vector containing the rice cytokinin response regulator gene OsRR11 according to claim 1, characterized in that: The recombinant vector is used in cultivating a rice variety resistant to brown planthoppers, and the rice variety is Nipponbare.

4. Use of a transformant containing the rice cytokinin response regulator gene OsRR11 according to claim 1, characterized in that: The transformant is used in cultivating a rice variety resistant to brown planthoppers, and the rice variety is Nipponbare.

Citation Information

Patent Citations

  • Application of rice tRNA isopentenyl transferase gene OsIPT9 in brown planthopper resistance of rice

    CN110819602A

  • Transcriptional inhibition factor OsSMAX1 gene and application thereof in brown planthopper resistance of rice

    CN116286861A