Application of ceramide synthase 6 gene as a target in prevention and treatment of pests

Abstract

The application belongs to the technical field of pest control, and discloses application of ceramide synthase 6 gene as a target point in pest control, and specifically discloses application of the CerS6 gene as a target point in control of insects in the order Lepidoptera. The application discloses, for the first time, application of the ceramide synthase CerS6 gene as a target point in control of insects in the order Lepidoptera, and proves importance of the ceramide synthase CerS6 to growth and development and reproductive capacity of pests by screening of a target gene and knocking out the ceramide synthase CerS6 of Spodoptera litura through the CRISPR / Cas9 technology, so as to make a great contribution to biological pest control.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of pest control, and particularly relates to application of ceramide synthase 6 gene as a target point in pest control. BACKGROUND

[0002] Ceramide is an important lipid in organisms, and is closely related to physiological processes such as obesity, inflammation and neurodegeneration. Ceramide synthase (CerS) plays a key role in the generation of ceramide. In mammals, there are six homologous genes encoding ceramide synthase, while there is only one in Drosophila. Although knocking out ceramide synthase in Drosophila can lead to reduced body size, the function of the enzyme on growth and development in Lepidoptera is still unclear. Therefore, it is of great significance to further study the biological function of CerS.

[0003] Spodoptera litura, belonging to Noctuidae and Spodoptera, is named as Spodoptera litura. Spodoptera litura is a kind of polyphagous agricultural pest, and larvae feed on leaves of nearly 300 plants such as sweet potato, soybean, beet and cruciferous and solanaceous vegetables. Spodoptera litura is an excellent experimental material for studying Lepidoptera pests. SUMMARY

[0004] The first aspect of the application aims to provide application of CerS6 gene as a target point in control of Lepidoptera insects.

[0005] The second aspect of the application aims to provide an sgRNA.

[0006] The third aspect of the application aims to provide a biological material related to the sgRNA of the second aspect of the application.

[0007] The fourth aspect of the application aims to provide application of the sgRNA of the second aspect of the application or the biological material of the third aspect of the application in control of Lepidoptera insects.

[0008] The fifth aspect of the application aims to provide a product.

[0009] The sixth aspect of the application aims to provide a method for controlling pests.

[0010] The seventh aspect of the application aims to provide a CRISPR / Cas system.

[0011] In order to achieve the above-mentioned purposes, the technical scheme adopted by the application is as follows:

[0012] The first aspect of the application provides application of CerS6 gene as a target point in a1) and / or a2);

[0013] a1) controlling lepidopteran insects;

[0014] a2) screening and / or preparing products for controlling lepidopteran insects.

[0015] In some embodiments of the present application, the nucleotide sequence of the CerS6 gene is shown in SEQ ID NO: 1.

[0016] In some embodiments of the present application, the purpose of controlling lepidopteran insects is achieved by targeted knockout / knockdown of the CerS6 gene.

[0017] In some embodiments of the present application, the CRISPR / Cas technology is used to target knockout / knockdown of the CerS6 gene. The nucleotide sequence of the sgRNA involved is GAACGCTGGTGGCTTCCTAACGG, wherein A, C, G and T are nucleotide components including modified nucleotide components.

[0018] In some embodiments of the present application, the lepidopteran insects include one or more of Spodoptera littoralis, Spodoptera exigua, Manduca sexta, Danaus plexippus, Helicoverpa armigera, Bombyx mori, Plutella xylostella, Spodoptera eridania and Spodoptera frugiperda.

[0019] In some embodiments of the present application, the sgRNA is capable of co-knocking out / knocking down the CerS6 gene together with the Cas protein.

[0020] In some embodiments of the present application, the nucleotide sequence of the sgRNA is GAACGCTGGTGGCTTCCTAACGG, wherein A, C, G and T are nucleotide components including modified nucleotide components.

[0021] In some embodiments of the present application, the modification is, for example, sugar modification, methylation modification, etc.

[0022] In some embodiments of the present application, the biological material related to the sgRNA of the second aspect of the present application comprises at least one of b1) to b12):

[0023] b1) a nucleic acid molecule encoding the sgRNA of the second aspect of the present application;

[0024] b2) an expression cassette containing the nucleic acid molecule of b1);

[0025] b3) a recombinant vector containing the nucleic acid molecule of b1);

[0026] b4) a recombinant vector containing the expression cassette of b2);

[0027] b5) a recombinant cell containing the nucleic acid molecule of b1);

[0028] b6) a recombinant cell comprising the expression cassette of b2);

[0029] b7) a recombinant cell comprising the recombinant vector of b3);

[0030] b8) a recombinant cell comprising the recombinant vector of b4);

[0031] b9) a recombinant microorganism comprising the nucleic acid molecule of b1);

[0032] b10) a recombinant microorganism comprising the expression cassette of b2);

[0033] b11) a recombinant microorganism comprising the recombinant vector of b3);

[0034] b12) a recombinant microorganism comprising the recombinant vector of b4).

[0035] In some embodiments of the application, the recombinant vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a phage, a cosmid, a fosmid, an artificial chromosome.

[0036] In some embodiments of the application, the plasmid vector can be an optional plasmid, the viral vector can be an optional virus, the cell vector does not include propagation material.

[0037] In a fourth aspect of the application, there is provided the use of the sgRNA of the second aspect of the application or the biological material of the third aspect of the application in any one of c1) to c8):

[0038] c1) controlling a lepidopteran insect;

[0039] c2) preparing a product for controlling a lepidopteran insect;

[0040] c3) arresting the hatching of eggs of a lepidopteran insect;

[0041] c4) preparing a product for arresting the hatching of eggs of a lepidopteran insect;

[0042] c5) inducing embryonic lethality in a lepidopteran insect;

[0043] c6) preparing a product for inducing embryonic lethality in a lepidopteran insect;

[0044] c7) reducing the body weight of a lepidopteran insect;

[0045] c8) preparing a product for reducing the body weight of a lepidopteran insect.

[0046] In some embodiments of the present application, the Lepidopteran insect comprises one or more of Spodoptera littoralis, Spodoptera exigua, Manduca sexta, Danaus plexippus, Helicoverpa armigera, Bombyx mori, Plutella xylostella, Spodoptera eridania, and Spodoptera frugiperda.

[0047] In some embodiments of the present application, the product comprises, but is not limited to, a reagent, a kit, and a medicament.

[0048] In a fifth aspect of the present application, a product is provided, comprising the sgRNA of the second aspect of the present application or the biological material of the third aspect of the present application.

[0049] In some embodiments of the present application, the product further comprises a Cas protein and / or a biological material associated with a Cas protein.

[0050] In some embodiments of the present application, the Cas protein is selected from the group consisting of Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, and Cas14, including any recombinant variant thereof, in particular from Cas9, including any recombinant variant thereof.

[0051] In some embodiments of the present application, the product comprises, but is not limited to, a reagent, a kit, a medicament, and an insecticide.

[0052] In some embodiments of the present application, the product has at least one of the following functions:

[0053] (1) controlling Lepidopteran insects;

[0054] (2) suppressing egg hatching of Lepidopteran insects;

[0055] (3) inducing embryonic lethality of Lepidopteran insects;

[0056] (4) reducing body weight of Lepidopteran insects;

[0057] (5) changing body size of Lepidopteran insects.

[0058] In some embodiments of the present application, the product further comprises a pharmaceutically acceptable carrier, which comprises, but is not limited to, a diluent, a buffer, a suspending agent, an emulsifying agent, a granulating agent, a encapsulating agent, an excipient, a filler, a binder, a spray, a transdermal absorption agent, a wetting agent, a disintegrating agent, an absorption promoting agent, a surfactant, a coloring agent, a flavoring agent, or an adsorbing carrier.

[0059] In a sixth aspect of the present application, a method for controlling pests is provided, comprising applying the product of the fifth aspect of the present application to the pests or the habitat of the pests.

[0060] In some embodiments of the application, the method comprises treating a pest, a food of a pest, a habitat of a pest (soil, area, material or environment in which the pest is growing or can grow, or a material, cultivated plant, plant propagation material (such as seeds), soil, surface or space to be protected from attack or infestation by a pest) with the product. For example, when a pest is treated with the product, the product can be injected into the pest.

[0061] In some embodiments of the application, an effective dose of the product (i.e. containing an effective dose of sgRNA and Cas protein) is applied to a pest or a habitat of a pest.

[0062] In general, an "effective amount" means the amount of active ingredient needed to achieve an observable effect on growth, including effects that kill, destroy, retard, prevent, and remove, or reduce the presence and activity of target organisms. The effective amount of sgRNA and Cas protein used in the present application can vary. The effective amount of sgRNA and Cas protein also varies depending on the primary conditions, such as the desired pesticidal effect and duration, climate, target species, location, mode of application, etc.

[0063] In a seventh aspect of the present application, there is provided a CRISPR / Cas system comprising the sgRNA of the second aspect of the present application or the biological material of the third aspect of the present application and a Cas protein.

[0064] In some embodiments of the present application, the Cas protein is selected from the group consisting of Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d and Cas14, including any recombinant variants thereof, in particular from the group consisting of Cas9, including any recombinant variants thereof.

[0065] The benefits of the present application are:

[0066] The present application discloses for the first time the application of ceramide synthase CerS6 gene as a target in the control of Lepidoptera insects. By target gene screening and combining CRISPR / Cas9 technology to knock out Spodoptera litura ceramide synthase CerS6, the importance of ceramide synthase CerS6 to pest growth and development and fecundity is proved.

[0067] Specifically, the application successfully obtains a CerS function loss mutant in Spodoptera litura by using a CRISPR / Cas9 technology, the CerS6 mutation seriously affects the egg-laying amount and hatching rate of the pests, and can be used for pest control. In the preparation of a pesticide for controlling pests, a product (such as a substance for reducing the activity of CerS6, a substance for degrading CerS6, a substance for reducing the expression level of CerS6, a substance for knocking out / knocking down CerS6) that acts on CerS6 of insects is used, so that the pests die in large quantities in the egg stage, the pests can be controlled in a persistent manner, and in the process of control, no drug resistance is generated, no harm is caused to humans and livestock, and no pollution is caused to the environment.

[0068] The application provides a new clue for understanding the biological significance of CerS6 for life phenomena and makes a great contribution to biological pest control. BRIEF DESCRIPTION OF DRAWINGS

[0069] Figure 1 For knocking out the CerS6 gene of Spodoptera litura based on designing a CRISPR / Cas9 target site and obtaining a genotype map; wherein A is selection of the target site, B is screening of the mutant genotype, and C is that the mutation type can cause early termination of protein translation.

[0070] Figure 2 For a direct view of the fact that the embryonic development of Spodoptera litura is hindered after the CerS6 gene is knocked out.

[0071] Figure 3 For comparison of the reproductive capacity of wild-type Spodoptera litura and the CerS6 mutant; wherein A is the egg-laying amount, B is the hatching rate, and C is comparison of the body weight of the six-instar larvae; in the figure, ns represents no significant difference, * represents p<0.05, ** represents p<0.01, and **** represents p<0.001.

[0072] Figure 4 For protein sequence analysis of the CerS6 homologous gene in insects. DETAILED DESCRIPTION

[0073] The content of the application will be further described in detail through specific examples.

[0074] It should be understood that the examples are only used to illustrate the application and not to limit the scope of the application.

[0075] In order to make the purpose, technical scheme and advantages of the embodiments of the application more clear, the technical scheme in the embodiments of the application will be clearly and completely described below. If specific conditions are not indicated in the embodiments, conventional conditions or manufacturer recommended conditions are used. If the used reagents or instruments are not indicated by the manufacturer, they are all conventional products that can be purchased on the market.

[0076] The features and performances of the present application are further described in detail below in combination with examples.

[0077] Example 1 Knocking out of Spodoptera ceramide synthase CerS6 by CRISPR / Cas9 system

[0078] According to the gene sequence of Spodoptera CerS6 (SEQ ID NO: 1), a suitable site was selected according to the selection principle of GG(19N)GG; since CerS in Spodoptera has 3 homologous genes, the target site was designed on the sequence specific to CerS6 gene, and the target sequence for the action of sgRNA in this example was GAACGCTGGTGGCTTCCTAA(CGG) (SEQ ID NO: 2).

[0079]

[0080] 2. Amplification of transcription template

[0081] (1) Primer design:

[0082] Forward primer F (CerS6-sgRNA-F):

[0083] 5'-TAATACGACTCACTATAGGGAACGCTGGTGGCTTCCTAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC-3' (SEQ ID NO: 3);

[0084] Reverse primer R (CerS6-sgRNA-R):

[0085] 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA-3' (SEQ ID NO: 4).

[0086] (2) Extension of template CerS sgRNA template short chain

[0087] The reaction system was prepared according to Table 1, and the reaction procedure was 95°C for 3 min; 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0088] Table 1 Reaction system

[0089]

[0090] (3) Positive plasmid construction

[0091] The target DNA fragment of the PCR product in step (2) was recovered and ligated into the PMD-18T vector, and the ligation system is shown in Table 2.

[0092] Table 2 Ligation system

[0093]

[0094] After the ligation solution was placed in a 16℃ refrigeration instrument for 3 hours, 10 μL of the ligation solution was added to a centrifuge tube containing competent E. coli, gently blown evenly, and placed on ice for 30 min, then 42℃ water bath for 90 s, immediately taken out, and placed on ice for 5-10 min, 1 mL of LB medium without antibiotics was added, and after 1 h of culture in a shaking incubator, centrifugation was performed at 3000 r / min for 5 min, and 100 μL of the resuspended bacterial solution was reserved. Positive colonies were screened using ampicillin-resistant plate medium, and single colony PCR detection and sequencing verification were performed. Colonies with no nucleotide mutations in the sequencing results were the desired positive colonies.

[0095] The primers used in the above colony PCR detection were PMD-18T-F and sgRNA-R, and the PCR product size was about 530 bp. The specific sequences of the colony PCR detection primers are as follows:

[0096] PMD-18T-F: 5'-CGGTGATGACGGTGAAAACCTC-3' (SEQ ID NO: 5);

[0097] sgRNA-R: 5'-AAAAAAAGCACCGACTCGGTGCC-3' (SEQ ID NO: 6).

[0098] (4) Amplification of transcription template

[0099] The plasmid of the positive colony with no nucleotide mutation in the above sequencing result was used as a template, and the transcription template was amplified using primers (operation was performed according to the instructions of the PrimeSTAR® Kit). The reaction system is shown in Table 3. The reaction procedure was as follows: 95℃, 3 min; 95℃, 30 s, 55℃, 30 s, 72℃, 30 s, 34 cycles; 72℃, 10 min.

[0100] Table 3 Reaction system

[0101]

[0102] The above system was repeated for 6 tubes, and after the reaction was completed, the reaction solution was combined, a total of 300 μL, and an equal volume of phenol chloroform isoamyl alcohol was added for purification. After purification, the final concentration was determined to be 1000 ng / μL, which was used as a template for sgRNA synthesis.

[0103] 3. sgRNA synthesis

[0104] The nucleotides were placed on ice, and the 10X Reaction Buffer was placed at room temperature. Kit) according to the instructions of the PrimeScript® Kit reagent kit. The reaction system is shown in Table 4. The reaction procedure was as follows: 37℃ water bath overnight (about 16 h).

[0105] Table 4 Reaction system

[0106]

[0107]

[0108] 10 μL of the reaction solution was made up to 300-400 μL with RNA free water, and the same volume of phenol chloroform isoamyl alcohol was added for purification of sgRNA. After purification, the final concentration was determined to be 500-1000 ng / μL, and the final injection concentration was determined according to the user's needs.

[0109] 4. Knockout of CerS6 by microinjection of eggs and screening of positive individuals

[0110] The Helicoverpa armigera was subjected to day-night reversal in advance to facilitate injection during oviposition at daytime. The eggs were laid on a paste-coated kraft paper, and the egg paper was cut and washed in running water after oviposition. The surface fluff was first washed off with water, and then the remaining fluff on the egg surface was gently swept off with a brush. The wet eggs were transferred to a glass slide, and the eggs were kept wet with water to dry on the glass slide. After drying, the eggs were adhered to the glass slide. The Cas9 protein and sgRNA mixture (sgRNA concentration of about 500 ng / μL, and Cas9 concentration of about 300 ng / μL) were mixed and injected into the Helicoverpa armigera egg embryos.

[0111] 5. Mutation detection and stability genetic analysis

[0112] The forward and reverse primers (CerS6-F, CerS6-R, sequences shown in Table 5) were designed and synthesized at positions 150 bp upstream and downstream of the gene target site. The mutant genomic DNA was used as a template for PCR amplification reaction, and base sequencing was performed. The sequencing results were analyzed by base sequence comparison using SnapGene software, and different sequence base mutations were confirmed.

[0113] After detection, a mutant genotype with a deletion of 14 bases was screened, as shown in Table 6. Figure 1 That is, the Helicoverpa armigera with knockout of CerS6 was successfully obtained.

[0114] Table 5 Primer sequences

[0115]

[0116]

[0117] Example 2 Phenotype of Helicoverpa armigera CerS6 gene knockout (using CRISPR / Cas9 system)

[0118] (1) Homozygous embryos are lethal

[0119] The development of egg masses laid by CerS homozygous and wild-type Spodoptera litura was observed separately. The results showed that the wild-type eggs developed normally within 3 days after oviposition, with the embryos darkening in color in the later stages of embryonic development, and eventually hatching normally as larvae. However, most embryos of the CerS homozygous eggs showed no signs of development and eventually atrophied, resulting in a very small number of hatched individuals. Figure 2 ).

[0120] (2) Decreased fertility and restricted growth and development

[0121] Due to the lethality of homozygous embryos ( Figure 3 In this embodiment (B), the egg-laying and hatching rates were further observed in a heterozygous mutant type (i.e., a hybrid of CerS homozygotes and wild-type). The results showed no significant difference in egg-laying between the heterozygotes and wild-type, but a significant decrease in hatching rate. Figure 3 (A-B, p<0.05, t-test) This result indicates that CerS6 knockout can effectively inhibit the hatching rate of *Spodoptera litura*. Furthermore, we observed the body weight of 6th instar larvae heterozygotes and found that both male and female larvae showed a significant decrease in body weight compared to the wild type. Figure 3 (C, p<0.05, t-test). The above results indicate that CerS knockout can effectively suppress the number of offspring individuals in the beet armyworm and affect its growth and development.

[0122] Example 3: Sequence analysis of CerS protein, an enzyme of ceramide synthase in insects.

[0123] Evolutionary conservation analysis was performed on the protein sequences of different isoforms of the ceramide synthase CerS from six Lepidoptera species. Figure 4 These species include Lepidoptera: *Spodoptera litura*, *Spodoptera frugiperda*, *Spodoptera littoralis*, *Spodopteraexigua*, *Danaus plexippus*, and *Bombyx mori*. Protein sequence analysis using MEGA software revealed that the ceramide synthase CerS protein sequence is highly conserved evolutionarily in insects. Figure 4 These data provide a theoretical basis for supporting the use of ceramide synthase CerS as a target for the control of lepidopteran pests.

[0124] The embodiments of the present application are described in detail above with reference to the drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present application. Furthermore, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. CerS6 Application of genes as targets in a1) and / or a2); a1) Control of Lepidoptera insects; a2) Screening and / or preparing products for the control of Lepidoptera insects; Through targeted knockout CerS6 Genes can be used to control lepidopteran insects. The lepidopteran insect in question is the beet armyworm.

2. Application of sgRNA or biological materials in any of c1) to c2): c1) Control of Lepidoptera insects; c2) Prepare products for controlling lepidopteran insects; The sgRNA targeting CerS6 Genes, and can be co-knocked out with Cas proteins. CerS6 Gene; The nucleotide sequence of the sgRNA is GAACGCTGGTGGCTTCCTAACGG; The biomaterial is at least one of b1) to b5): b1) The nucleic acid molecule encoding the sgRNA; b2) An expression cassette containing the nucleic acid molecule described in b1); b3) A recombinant vector containing the nucleic acid molecule described in b1); b4) Recombinant cells containing the nucleic acid molecules described in b1); b5) Recombinant microorganisms containing the nucleic acid molecules described in b1); The lepidopteran insect in question is the beet armyworm.

3. The application according to claim 2, characterized in that, The application includes any one of c3) to c8): c3) Inhibit the hatching of lepidopteran insect eggs; c4) Prepare products that inhibit the hatching of lepidopteran insect eggs; c5) Induces embryonic death in lepidopteran insects; c6) Prepare products that induce embryonic death in lepidopteran insects; c7) Reduce the body weight of lepidopteran insects; c8) Prepare products that reduce the weight of lepidopteran insects.

4. The application according to claim 2, characterized in that, The biomaterial is at least one of b6) to b8): b6) A recombinant vector containing the expression cassette described in b2); b7) Recombinant cells containing the expression cassette described in b2); b8) Recombinant microorganisms containing the expression cassette described in b2).

5. The application according to claim 2, characterized in that, The biomaterial is at least one of b9) to b10): b9) Recombinant cells containing the recombinant vector described in b3); b10) Recombinant microorganisms containing the recombinant vector described in b3).

6. The application according to claim 2, characterized in that, The biomaterial is at least one of b11) to b12): b11) Recombinant cells containing the recombinant vector described in b4); b12) Recombinant microorganisms containing the recombinant vector described in b4).

7. A method for controlling pests, comprising applying a product to pests or pest habitats; The product includes the sgRNA or biological material as described in any one of claims 2 to 6; The pest in question is the beet armyworm.

8. The method according to claim 7, characterized in that, The product also includes Cas protein.

Images