Primer sets and kits for simultaneous identification of PEDV classical strains and variants

Abstract

The present invention belongs to the field of biological detection technology, and specifically relates to a primer set and a kit for simultaneously identifying PEDV classical strains and variants, the primer set comprising primer set I and primer set II; the nucleotide sequences of primer set I are respectively shown as SEQ ID NO.1 to SEQ ID NO.4; the nucleotide sequences of primer set II are respectively shown as SEQ ID NO.5 to SEQ ID NO.8. The present invention takes the relatively conservative M gene of PEDV as the target fragment and constructs a standard plasmid, and establishes a PEDV universal RT-LAMP rapid detection method; takes the S gene of PEDV as the target fragment and constructs a standard plasmid, and establishes a PEDV identification RT-LAMP rapid detection method; it can not only avoid missed detection and false detection of PEDV variant infection, but also identify PEDV classical strains and variants, which is of great significance for understanding the prevalence of PEDV and the prevention and control of PEDV infection.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and specifically relates to a primer set and a kit for simultaneously identifying the classical strain and variant strain of PEDV, and more specifically relates to an RT-LAMP primer set, a kit and a detection method for rapidly and simultaneously identifying the classical strain and variant strain of porcine epidemic diarrhea virus. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) is a pathogen of a highly contagious enteric disease that occurs in pigs. Porcine epidemic diarrhea (PED) is characterized by diarrhea in pigs of all ages, with vomiting, diarrhea, loss of appetite and death in piglets within one week of age as the main features. Pigs are the only natural host of PEDV. PEDV can infect pigs of all ages, from newborn piglets to fattening pigs, sows and boars. The harm caused by PEDV is closely related to the age of the pigs. It is less harmful to fattening pigs and breeding pigs, and can cause diarrhea and agalactia in sows and affect their reproductive cycle. However, it is more harmful to suckling piglets, especially newborn piglets within 7 days of age. The main source of infection of PEDV is infected or infected pigs, followed by contaminated feed and its packaging bags, vehicles, shoes and clothing, which can spread the virus. Fecal-oral transmission is the main mode of transmission of PEDV. In recent years, the virus has also been found in sow milk. Therefore, breast milk may also be a mode of transmission of PEDV. In addition, there are also reports that the virus may be transmitted through the respiratory tract and can be excreted through respiratory secretions. This means that in pigs in the same or adjacent pens, the virus may be mainly transmitted through direct contact with healthy pigs, or it may be horizontally transmitted through indirect contact, feeding virus-contaminated feed and drinking water, etc.

[0003] A large number of genome sequencing and analysis have found that both variant PEDV and classical PEDV have been found in clinical infections. At present, the prevalent PEDV strains are mainly variant strains (G2 genotype), which have great differences in genotype and genetic evolution from the classical strains (G1 genotype represented by CV777 strain). In addition, due to the great differences in antigenicity, immunogenicity and protection between variant strains and classical strains, the vaccine based on classical PEDV has poor protection against variant PEDV, resulting in great difficulties in the prevention and control of PED in clinical practice. There are great differences in pathogenicity between variant PEDV and classical PEDV. There are variant strains and classical strains infected in the field, which are difficult to distinguish through symptoms and lesions. Laboratory diagnosis is required to distinguish the genotype of the strain. At present, the laboratory diagnosis methods of PEDV mainly include: RT-PCR, real-time fluorescence quantitative RT-PCR, ELISA, neutralization test, virus isolation and identification, immunoelectron microscopy, immunofluorescence, etc. However, current diagnostic methods cannot directly identify whether the PEDV strain is a classic strain or a variant strain. The traditional method of distinguishing between classic and variant strains of PEDV is through gene sequencing and comparison analysis, which is time-consuming and laborious. Therefore, there is an urgent need for a rapid detection method that can detect PDEV and distinguish between classic and variant strains for non-diagnostic purposes. Summary of the invention

[0004] In view of the deficiencies of the prior art, one of the objectives of the present invention is to provide a primer set for simultaneously identifying the classical strain and variant strain of PEDV.

[0005] The second object of the present invention is to provide an RT-LAMP kit for rapid and simultaneous detection of porcine epidemic diarrhea virus and identification of classical strains and variants of porcine epidemic diarrhea virus.

[0006] The third object of the present invention is to provide an RT-LAMP detection method for detecting porcine epidemic diarrhea virus for non-diagnostic purposes and distinguishing between classical strains and variant strains of porcine epidemic diarrhea virus.

[0007] A fourth object of the present invention is to provide an RT-LAMP kit for use in detecting porcine epidemic diarrhea virus for non-diagnostic purposes and in distinguishing between classical strains and variant strains of porcine epidemic diarrhea virus.

[0008] The technical solution adopted by the present invention is:

[0009] The present invention provides an RT-LAMP primer set for simultaneously identifying PEDV classical strains and variant strains, wherein the RT-LAMP primer set comprises a primer set I and a primer set II;

[0010] The primer set I includes outer primer pair I PEDV-LM-F3 and PEDV-LM-B3, and inner primer pair I PEDV-LM-FIP and PEDV-LM-BIP; the nucleotide sequences of the primer set I are shown in SEQ ID NO.1 to SEQ ID NO.4 respectively.

[0011] The primer set II includes an outer primer pair II PEDV-LS-F3 and PEDV-LS-B3, and an inner primer pair II PEDV-LS-FIP and PEDV-LS-BIP; the nucleotide sequences of the primer set II are shown in SEQ ID NO.5 to SEQ ID NO.8 respectively. Specifically, the nucleotide sequences of each sequence are shown as follows (5'-3'):

[0012] PEDV-LM-F3:TCTGTGATGGGCCGACAG (SEQ ID NO. 1);

[0013] PEDV-LM-B3: CCAGTGCCAGATGAAGCATT (SEQ ID NO. 2);

[0014] PEDV-LM-FIP:CCTGTACGCCAGTAGCAACCTTGAGCACCAACT

[0015] GGTGTAACG (SEQ ID NO. 3);

[0016] PEDV-LM-BIP:ATTTCGTCACAGTCGCCAAGGCGACTGAACGA

[0017] CCAACACGT (SEQ ID NO. 4);

[0018] PEDV-LS-F3: AAATTTAATGTTCAGGCACCT (SEQ ID NO.5);

[0019] PEDV-LS-B3: GTGGCCTTATGTAAATAAAGCT (SEQ ID NO. 6);

[0020] PEDV-LS-FIP:ACTAGCAGTTTCAATGCCTGTGGTTACCTACCTA

[0021] GTATGAACTCT(SEQ ID NO.7);

[0022] PEDV-LS-BIP:GGCGTTCATGGTATTTTTCTCAGCCTAGGATCAA

[0023] ACGGCTCTTG (SEQ ID NO. 8).

[0024] Furthermore, the universal RT-LAMP detection primer set for detecting the classical strains and variants of PEDV is two pairs of specific primers of primer set I, namely, outer primer pair I PEDV-LM-F3 and PEDV-LM-B3, and inner primer pair I PEDV-LM-FIP and PEDV-LM-BIP; the RT-LAMP detection primer set for identifying the classical strains and variants of PEDV is two pairs of specific primers of primer set II, namely, outer primer pair II PEDV-LS-F3 and PEDV-LS-B3, and inner primer pair II PEDV-LS-FIP and PEDV-LS-BIP.

[0025] The present invention also provides a kit for simultaneously identifying the classical strain and variant strain of PEDV, comprising the above-mentioned RT-LAMP primer set, reverse transcriptase, RT-LAMP reaction solution, positive control and negative control.

[0026] Furthermore, the molar ratio of the outer primer pair I to the inner primer pair I is 1:8.

[0027] Furthermore, the molar ratio of the outer primer pair II to the inner primer pair II is 1:8.

[0028] The present invention also provides a method for simultaneously detecting PEDV classical strains and variant strains for non-diagnostic purposes, comprising the following steps:

[0029] (1) RNA extraction and reverse transcription: Extract viral nucleic acid from the sample and reverse transcribe RNA into cDNA using a reverse transcription kit;

[0030] (2) RT-LAMP reaction: The above kit is mixed with sample cDNA to prepare an RT-LAMP amplification reaction system for RT-LAMP reaction;

[0031] (3) Result judgment: Add fluorescent saturated dye to the system after the amplification reaction for visual RT-LAMP detection, and use agarose gel to verify the visual RT-LAMP detection results.

[0032] Furthermore, the RT-LAMP reaction system includes a general LAMP reaction system and an identification LAMP reaction system; wherein,

[0033] The universal LAMP reaction system includes, in 25 μL:

[0034] 10× Isothermal Amplification Buffer (containing 20mM MgSO4) 2.5 µL,

[0035] 100mM MgSO4 1.0µL,

[0036] 10mM dNTP2.5µL,

[0037] 8000U / mL Bst2.0 DNA polymerase 1µL,

[0038] 5µM outer primer pair I 2.0µL,

[0039] 40µM inner primer pair I 2.0µL,

[0040] Sample cDNA 2.5 µL,

[0041] 11.5 µL of sterile distilled water; the reaction procedure is: 65℃ for 40 min, and 80℃ for 20 min to inactivate.

[0042] The identification LAMP reaction system includes, in 25 μL:

[0043] 10× isothermal amplification buffer (containing 20 mM MgSO4) 2.5 µL,

[0044] 100mM MgSO4 1.5µL,

[0045] 10mM dNTP3.5µL,

[0046] 8000U / mL Bst2.0 DNA polymerase1.0µL,

[0047] 5µM outer primer pair II 2.0µL,

[0048] 40µM inner primer pair II 2.0µL,

[0049] Sample cDNA 2.5 µL,

[0050] 10.0 µL of sterile distilled water; the reaction procedure is: 65°C for 30 min, and 80°C for 20 min to inactivate.

[0051] The present invention also provides a use of the above-mentioned kit in distinguishing PEDV classical strains and variant strains for non-disease diagnosis purposes.

[0052] Advantages compared to the prior art:

[0053] 1. The present invention uses the relatively conservative M gene of PEDV as the target fragment and constructs a standard plasmid to establish a PEDV universal RT-LAMP rapid detection method; uses the S gene of PEDV as the target fragment and constructs a standard plasmid to establish a PEDV identification RT-LAMP rapid detection method; it can not only avoid missed detection and false detection of PEDV variants, but also identify PEDV classic strains and variants, which is of great significance for understanding the prevalence of PEDV and the prevention and control of PEDV infection.

[0054] 2. The present invention detects the classical strain and variant of PEDV by RT-LAMP method, wherein a special set of primers, a kit containing the set of primers, and a detection method using the kit are used; the kit is easy to use, and the detection of pathogens can be completed in a short time; no large, complex and expensive instruments are required; the result identification is convenient and intuitive, and after the reaction is completed, there is no need to open the cover to add additional reagents, which can avoid the problem of false positives caused by subsequent aerosol contamination caused by opening the cover, and no subsequent cumbersome processes such as nucleic acid electrophoresis are required. The whole process of amplification and result determination can be completed in 40 minutes; the detection specificity is good and the sensitivity is high. After experimental comparison tests, the sensitivity of the present invention in detecting PEDV strains, classical strains and variants can be detected as low as 10 2 The sensitivity is 100-1000 times that of the traditional PCR method.

[0055] 3. The results of the present invention are reliable, the cost is relatively low, and it is simple, rapid, specific, and sensitive. It can meet the needs of rapid detection and provide a basis for the rapid detection of PEDV classic strains and variants. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 : The optimization results of the PEDV universal RT-LAMP conditions in the embodiment of the present invention; wherein A is the electrophoresis diagram for MgSO4 concentration optimization, B is the electrophoresis diagram for dNTP concentration optimization, C is the electrophoresis diagram for the optimization of the concentration ratio of inner and outer primers I, D is the electrophoresis diagram for the optimization of reaction temperature, and E is the electrophoresis diagram for the optimization of reaction time;

[0057] Figure 2 1 is the result of optimizing the RT-LAMP conditions for PEDV identification in the embodiment of the present invention; wherein A is the electrophoresis diagram optimized for MgSO4 concentration, B is the electrophoresis diagram optimized for dNTP concentration, C is the electrophoresis diagram optimized for the ratio of inner and outer primer II concentrations, D is the electrophoresis diagram optimized for reaction temperature, and E is the electrophoresis diagram optimized for reaction time;

[0058] Figure 3is the specific detection result of PEDV RT-LAMP in the embodiment of the present invention; wherein A and B are the gel electrophoresis result and the visual detection result of the universal RT-LAMP, respectively, C and D are the gel electrophoresis result and the visual detection result of the identification RT-LAMP, respectively, + is positive, - is negative;

[0059] Figure 4 RT-LAMP and PCR sensitivity test results in the embodiment of the present invention; wherein A and B are the gel electrophoresis test results of universal RT-LAMP and identification RT-LAMP, respectively, C and D are the visualization test results of universal RT-LAMP and identification RT-LAMP, respectively, E and F are the PCR sensitivity test results of PEDV G1 and PEDV G2 genotypes, respectively, + is positive, - is negative;

[0060] Figure 5 This is the RT-LAMP repeatability test result in the embodiment of the present invention. DETAILED DESCRIPTION

[0061] The above-mentioned technical features of the present invention and the technical features specifically described below (such as implementation cases) can be combined with each other to form new or preferred technical solutions, but the present invention is not limited to these embodiments, and these embodiments do not limit the present invention in any way.

[0062] The experimental methods in the following examples, unless otherwise specified, are all conventional techniques in molecular biology, microbiology, recombinant DNA, and immunology, etc. The materials and preparations involved in the following examples, unless otherwise specified, are all common commercial products and can be purchased from the market.

[0063] PEDV G1 genotype positive, PEDV G2 genotype positive and 33 unknown samples. As well as porcine reproductive and respiratory syndrome virus (PRRSV), porcine deltacoronavirus (PDCoV), porcine rotavirus (PoRV) and pseudorabies virus (PRV) virus samples were stored by the Preventive Veterinary Laboratory of the College of Animal Science and Technology of Jiangxi Agricultural University. All samples were packaged and processed for DNA or RNA extraction, and the extracted nucleic acids were stored at -20℃ and -80℃ respectively until use.

[0064] Bst 2.0 DNA polymerase (8000U / mL) was purchased from NEB, UK. dNTPs mixture and fluorescent saturation dye (4S Green Plus Nucleic Acid Stain) were purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd. DL2000DNA Marker, pMD19-T vector, RNA extraction reagent and reverse transcription reagent were purchased from TaKaRa, Japan. Plasmid extraction kit and DNA extraction kit were purchased from Beijing Tiangen Biochemical Technology Co., Ltd. Polymerase chain reaction master mixture (PCR MasterMix) was purchased from Shanghai Yisheng Biotechnology Co., Ltd.

[0065] The present invention is further described in detail below in conjunction with specific embodiments:

[0066] Example 1: RT-LAMP primer design

[0067] The M and S genes of different PEDV strains were compared and analyzed using MEGA11 software, targeting the most conserved region in the M gene and the highly mutated region in the S gene. Universal RT-LAMP primers (primer set I) were designed using the online website Primer Explorer V5, including outer primer pair I PEDV-LM-F3 and PEDV-LM-B3, and inner primer pair I PEDV-LM-FIP and PEDV-LM-BIP; the nucleotide sequences of primer set I are shown in SEQ ID NO.1 to SEQ ID NO.4 (5'-3').

[0068] The designed identification RT-LAMP primers (primer set II) include outer primer pair II PEDV-LS-F3 and PEDV-LS-B3, inner primer pair II PEDV-LS-FIP and PEDV-LS-BIP; wherein the nucleotide sequences of primer set II are shown in SEQ ID NO.5 to SEQ ID NO.8 (5'-3'):

[0069] PEDV-LM-F3:TCTGTGATGGGCCGACAG (SEQ ID NO. 1);

[0070] PEDV-LM-B3: CCAGTGCCAGATGAAGCATT (SEQ ID NO. 2);

[0071] PEDV-LM-FIP:CCTGTACGCCAGTAGCAACCTTGAGCACCAACT

[0072] GGTGTAACG (SEQ ID NO. 3);

[0073] PEDV-LM-BIP:ATTTCGTCACAGTCGCCAAGGCGACTGAACGA

[0074] CCAACACGT (SEQ ID NO. 4);

[0075] PEDV-LS-F3: AAATTTAATGTTCAGGCACCT (SEQ ID NO.5);

[0076] PEDV-LS-B3: GTGGCCTTATGTAAATAAAGCT (SEQ ID NO. 6);

[0077] PEDV-LS-FIP:ACTAGCAGTTTCAATGCCTGTGGTTACCTACCTA

[0078] GTATGAACTCT(SEQ ID NO.7);

[0079] PEDV-LS-BIP:GGCGTTCATGGTATTTTTCTCAGCCTAGGATCAA

[0080] ACGGCTCTTG (SEQ ID NO. 8).

[0081] Example 2: Extraction of viral RNA and construction of plasmid standards

[0082] According to the instructions of TaKaRa's RNA extraction reagent, RNA of PEDV G1 and PEDV G2 genotypes and RNA of PRRSV, PDCoV, and PoRV were extracted and stored at -80°C for future use. The extracted viral RNA was reverse transcribed into cDNA using TaKaRa's reverse transcription kit and stored at -20°C. Using Tiangen's DNA extraction kit, PRV DNA was extracted according to the reagent instructions and stored at -20°C for future use. Using the cDNA of PEDV G1 and PEDV G2 genotypes as templates, the following two sets of primers PEDV-MP and PEDV-SP were used to amplify the M and S genes of PEDV, respectively, and then cloned into the pMD19-T vector for LAMP sensitivity test. Two sets of primers PEDV-G1 and PEDV-G2 were used to amplify and clone into the pMD19-T vector for PCR sensitivity test. All plasmids were extracted using Tiangen's plasmid mini-extraction kit and the DNA concentration was measured using a NanoDrop 2000 micro-spectrophotometer and then stored at -20°C for future use. The nucleotide sequences of each primer are as follows:

[0083] PEDV-G1-F:TGTTTTGGGTGGTTATCTACCTA(SEQ ID NO.9))

[0084] PEDV-G1-R:AGCTGGTAACCACTAGGAT(SEQ ID NO.10))

[0085] PEDV-G2-F:CCAGTACTTTCAACACTTAGCCTA(SEQ ID NO.11)

[0086] PEDV-G2-R:GCCACTAGCAGTTGGATG(SEQ ID NO.12)

[0087] PEDV-MP-F:CTGTTGCGAACTGTTGAGCT(SEQ ID NO.13)

[0088] PEDV-MP-R:GCCACGATCCTGAAAACTGA(SEQ ID NO.14)

[0089] PEDV-SP-F:CTGGTTGTTCTTACCAGTAC(SEQ ID NO.15)

[0090] PEDV-SP-R:ACATCATTAACAGTAGGGCC(SEQ ID NO.16)

[0091] PEDV-F:GTATTGGTGGTGAGCGGAAT(SEQ ID NO.17)

[0092] PEDV-R:CCTGTTCCGCCATTCTATCA(SEQ ID NO.18).

[0093] Part 3: RT-LAMP has a thermostat

[0094] The universal RT-LAMP reaction was performed using the primer set I and fluorescent saturation dye of Example 1. The universal LAMP reaction system was 25 µL, including 2.5 µL 10× isothermal amplification buffer (containing 20 mM MgSO4), 1.0 µL MgSO4 (100 mM), 2.5 µL dNTP (10 mM), 1.0 µL Bst2.0 DNA polymerase (8000 U / mL), 1.0 µL each of PEDV-LM-F3 (5 µM) and PEDV-LM-B3 (5 µM), 1.0 µL each of PEDV-LM-FIP (40 µM) and PEDV-LM-BIP (40 µM), 2.5 µL template cDNA, and sterile distilled water to 25 µL. The optimization of the universal RT-LAMP reaction system was carried out from MgSO4 to MgSO4. 2+ The optimization was performed in five aspects: concentration, dNTP concentration, internal and external primer concentration ratio, reaction temperature, and reaction time. The method is as follows:

[0095] ①Mg 2+ Concentration optimization: The reaction system is 100mM MgSO4 (0µL, 0.5µL, 1.0µL, 1.5µL, 2.0µL), 2.5µL 10× isothermal amplification buffer (containing 20mM MgSO4), 2.5µL dNTP (10mM), 1.0µL Bst2.0 DNA polymerase (8000U / mL), 1.0µL each of PEDV-LM-F3 (5µM) and PEDV-LM-B3 (5µM), 1.0µL each of PEDV-LM-FIP (40µM) and PEDV-LM-BIP (40µM), 2.5µL template cDNA, and sterile distilled water to 25µL. The results showed that when the amount of 100mM MgSO4 added was 1.0µL, that is, Mg 2+ The amplification effect is best when the final concentration is 6mM (such as Figure 1 ).

[0096] ② Optimization of dNTP concentration: The reaction system is 10mM dNTP (2.0µL, 2.5µL, 3.0µL, 3.5µL, 4.0µL), 2.5µL 10× isothermal amplification buffer (containing 20mM MgSO4), 1.0µL MgSO4 (100mM), 1.0µL Bst2.0 DNA polymerase (8000U / mL), 1.0µL each of PEDV-LM-F3 (5µM) and PEDV-LM-B3 (5µM), 1.0µL each of PEDV-LM-FIP (40µM) and PEDV-LM-BIP (40µM), 2.5µL template cDNA, and sterile distilled water to 25µL. The results showed that the amplification effect was best when the amount of 10mM dNTP added was 2.5µL, that is, the final dNTP concentration was 1mM (such as Figure 1 (as shown in B in the figure).

[0097] ③ Primer concentration optimization: The reaction system was that the final concentration of the outer primers I PEDV-LM-F3 and PEDV-LM-B3 was 0.2µM, the final concentrations of the inner primers I PEDV-LM-FIP and PEDV-LM-BIP were 0.4µM, 0.8µM, 1.2µM, 1.6µM, 2.0µM, respectively, and then 2.5µL 10× isothermal amplification buffer (containing 20mM MgSO4), 1.0µL MgSO4 (100mM), 2.5µL dNTP (10mM), 1.0µL Bst2.0 DNA polymerase (8000U / mL), 2.5µL template cDNA, and sterile distilled water were added to 25µL. The results showed that the amplification effect was best when the final concentration of the inner primer I was 1.6 µM, that is, the concentration ratio of the inner primer I to the outer primer I was 8:1 (such as Figure 1 as shown in C in the figure).

[0098] ④ Optimization of amplification temperature: Using the above optimal amplification system, the amplification temperature was increased in sequence from 59°C, 61°C, 63°C, 65°C, and 67°C. After repeated multiple times, the optimal reaction temperature was determined; the reaction time was increased in sequence from 40min, 50min, 60min, 70min, and 80min. After repeated multiple times, the optimal reaction time was determined. The results showed that the optimal temperature for the universal LAMP reaction was 65°C (e.g. Figure 1 As shown in D), the optimal reaction time is 40 min (as shown in Figure 1 E in the figure).

[0099] The optimal reaction conditions for universal LAMP reaction were finally determined to be: 6mM MgSO4, 1mM dNTP, inner and outer primer I concentration ratio of 8:1, and reaction at 65℃ for 40min.

[0100] The identification RT-LAMP reaction was performed using the primer set II and fluorescent saturation dye of Example 1. The identification LAMP reaction system was 25 µL, including 2.5 µL 10× isothermal amplification buffer (containing 20 mM MgSO4), 1.5 µL MgSO4 (100 mM), 3.5 µL dNTP (10 mM), 1.0 µL Bst2.0 DNA polymerase (8000 U / mL), 1.0 µL each of PEDV-LS-F3 (5 µM) and PEDV-LS-B3 (5 µM), 1.0 µL each of PEDV-LS-FIP (40 µM) and PEDV-LS-BIP (40 µM), 2.5 µL template cDNA, and sterile distilled water to 25 µL. The optimization of the identification RT-LAMP reaction system was sequentially from MgSO4 to MgSO4. 2+The optimization was performed in five aspects: concentration, dNTP concentration, internal and external primer concentration ratio, reaction temperature, and reaction time. The method is as follows:

[0101] ①Mg 2+ Concentration optimization: The reaction system is 100mM MgSO4 (0µL, 0.5µL, 1.0µL, 1.5µL, 2.0µL), 2.5µL 10× isothermal amplification buffer (containing 20mM MgSO4), 3.5µL dNTP (10mM), 1.0µL Bst2.0 DNA polymerase (8000U / mL), 1.0µL each of PEDV-LS-F3 (5µM) and PEDV-LS-B3 (5µM), 1.0µL each of PEDV-LS-FIP (40µM) and PEDV-LS-BIP (40µM), 2.5µL template cDNA, and sterile distilled water to 25 µL. The results showed that when the amount of 100mM MgSO4 added was 1.5µL, i.e. Mg 2+ The amplification effect is best when the final concentration is 8mM (such as Figure 2 ).

[0102] ② Optimization of dNTP concentration: The reaction system is 10mM dNTP (2.0µL, 2.5µL, 3.0µL, 3.5µL, 4.0µL), 2.5µL 10× isothermal amplification buffer (containing 20mM MgSO4), 1µL MgSO4 (100mM), 1.0µL Bst2.0 DNA polymerase (8000U / mL), 1.0µL each of PEDV-LS-F3 (5µM) and PEDV-LS-B3 (5µM), 1.0µL each of PEDV-LS-FIP (40µM) and PEDV-LS-BIP (40µM), 2.5µL template cDNA, and sterile distilled water to 25µL. The results showed that the amplification effect was best when the amount of 10mM dNTP added was 3.5µL, that is, the final dNTP concentration was 1.4mM (such as Figure 2 (as shown in B in the figure).

[0103] ③ Primer concentration optimization: When the final concentration of the outer primers II PEDV-LS-F3 and PEDV-LS-B3 in the reaction system was 0.2µM, the final concentrations of the inner primers II PEDV-LS-FIP and PEDV-LS-BIP were 0.4µM, 0.8µM, 1.2µM, 1.6µM, and 2.0µM, respectively. Then 2.5µL 10× isothermal amplification buffer (containing 20mM MgSO4), 1.5µL MgSO4 (100mM), 3.5µL dNTP (10mM), 1.0µL Bst2.0 DNA polymerase (8000U / mL), 2.5µL template cDNA, and sterile distilled water were added to 25µL. The results showed that the amplification effect was best when the final concentration of the inner primer II was 1.6µM, that is, the concentration ratio of the inner and outer primers II was 8:1 (such as Figure 2 as shown in C in the figure).

[0104] ④ Optimization of amplification temperature: Using the above optimal amplification system, the amplification temperature was increased in sequence from 59°C, 61°C, 63°C, 65°C, and 67°C. After repeated multiple times, the optimal reaction temperature was determined; the reaction time was increased in sequence from 30min, 40min, 50min, 60min, and 70min. After repeated multiple times, the optimal reaction time was determined. The results showed that the optimal temperature for the identification LAMP reaction was 65°C (such as Figure 2 As shown in D), the optimal reaction time is 30 min (as shown in Figure 2 E in the figure).

[0105] The optimal reaction conditions for identification of LAMP reaction were finally determined to be: 8mM MgSO4, 1.4mM dNTP, inner and outer primer II concentration ratio of 8:1, and reaction at 65℃ for 30min.

[0106] Example 4: RT-LAMP specificity assay

[0107] The cDNA or DNA of PDCoV, PRRSV, PRV and PoRV obtained in Example 2 was used as a template, and the cDNA of PEDV G1 and PEDV G2 genotypes was used as a positive control, and distilled water was used as a negative control. The optimized LAMP reaction was used for amplification, and after the amplification, 5 μL of the reaction product was loaded on a 2% agarose gel for electrophoresis detection, and 1 μL of fluorescent dye was added for visual observation.

[0108] The amplification reaction system is as follows:

[0109] The universal LAMP reaction system contains 25 µL of:

[0110] 10× isothermal amplification buffer (containing 20mM MgSO4) 2.5 µL,

[0111] 100mM MgSO4 1.0µL,

[0112] 10mM dNTP2.5µL,

[0113] 8000U / mL Bst2.0 DNA polymerase 1.0µL,

[0114] 5µM outer primer pair I 2.0µL,

[0115] 40µM inner primer pair I 2.0µL,

[0116] Sample cDNA 2.5 µL,

[0117] 11.5 µL of sterile distilled water; the reaction procedure is: 65℃ for 40 min, and 80℃ for 20 min to inactivate.

[0118] The identification LAMP reaction system contains 25 µL:

[0119] 10× isothermal amplification buffer (containing 20mM MgSO4) 2.5 µL,

[0120] 100mM MgSO4 1.5µL,

[0121] 10mM dNTP3.5µL,

[0122] 8000U / mL Bst2.0 DNA polymerase 1.0µL,

[0123] 5µM outer primer pair II 2.0µL,

[0124] 40µM inner primer pair II 2.0µL,

[0125] Sample cDNA 2.5 µL,

[0126] 10 µL of sterile distilled water; the reaction procedure is: 65°C for 30 min, and 80°C for 20 min to inactivate.

[0127] The results are as follows Figure 3 As shown in the figure, the outer primer pair I PEDV-LM-F3, PEDV-LM-B3 and the inner primer pair I PEDV-LM-FIP, PEDV-LM-BIP can only detect PEDV G1 and PEDV G2 genotype viruses ( Figure 3 A and Figure 3The outer primer pair Ⅱ PEDV-LS-F3, PEDV-LS-B3 and the inner primer pair Ⅱ PEDV-LS-FIP, PEDV-LS-BIP can only detect the PEDV G1 genotype virus, but cannot detect the PEDV G2 genotype virus and PDCoV, PoRV, PRRSV, PRV ( Figure 3 C and Figure 3 D in.

[0128] Example 5: RT-LAMP sensitivity test

[0129] The recombinant plasmid obtained in Example 2 was diluted 10 times (1×10 8 to 1×10 0 The 1000 copies were used as templates for LAMP and PCR sensitivity tests, respectively.

[0130] The LAMP reaction system is as shown in Example 4, and the PCR reaction system includes 25 μL of:

[0131] 2× PCR Master Mix 12.5 µL,

[0132] Upstream primer (SEQ ID NO.13, SEQ ID NO.15) 1µL,

[0133] Downstream primers (SEQ ID NO.14, SEQ ID NO.16) 1µL,

[0134] 9.5 µL of sterile distilled water,

[0135] 1µL of recombinant plasmid,

[0136] The reaction program was 94°C for 5 min, 35 cycles of 94°C for 10 s, 50°C for 20 s, and 72°C for 15 s, and a final extension at 72°C for 5 min.

[0137] From the results of visual detection and gel electrophoresis analysis ( Figure 4 The minimum detection limit of LAMP for PEDV G1 and PEDV G2 genotypes was 1×10 2 Copy / Reaction (eg Figure 4 The minimum detection limits of PCR for PEDV G1 and PEDV G2 genotypes were 1×10 5 copies / reaction and 1×10 4 Copy / Reaction (eg Figure 4 As shown in Figures E and F), the sensitivity of the LAMP method is 100-1000 times that of the PCR method.

[0138] Example 6: RT-LAMP repeatability detection

[0139] Using the method established in Example 3, PEDV G1 genotype and PEDV G2 genotype (including PEDV G2a and PEDV G2b 2 genotypes) cDNA as templates, three LAMP reactions were performed using universal primers outer primer pair Ⅰ PREDV-LM-F3 (SEQ ID NO.1), PEDV-LM-B3 (SEQ ID NO.2) and inner primer pair Ⅰ PEDV-LM-FIP (SEQ ID NO.3), PEDV-LM-BIP (SEQ ID NO.4) and identification primers outer primer pair Ⅱ PEDV-LS-F3 (SEQ ID NO.5), PEDV-LS-B3 (SEQ ID NO.6) and inner primer pair Ⅱ PEDV-LS-FIP (SEQ ID NO.7), PEDV-LS-BIP (SEQ ID NO.8). Figure 5 It can be seen that the PEDV G1 genotype can be detected by two sets of primer pairs, but the PEDV G2 genotype (including PEDVG2a and PEDV G2b genotypes) can only be detected by the outer primer pair Ⅰ PREDV-LM-F3, PEDV-LM-B3 and the inner primer pair Ⅰ PEDV-LM-FIP, PEDV-LM-BIP, but not by the outer primer pair Ⅱ PEDV-LS-F3, PEDV-LS-B3 and the inner primer pair Ⅱ PEDV-LS-FIP, PEDV-LS-BIP. The results show that the optimized RT-LAMP method for distinguishing PEDV G1 and PEDV G2 subtype strains has good specificity and repeatability.

[0140] Example 7: Sample testing

[0141] 1. One known PEDV G1 genotype-positive sample and one known PEDV G2 genotype-positive sample were tested 10 times by LAMP and PCR methods respectively.

[0142] The LAMP reaction system is as in Example 4, and the PCR reaction system includes 25 μL of:

[0143] 2× PCR Master Mix 12.5 µL

[0144] Upstream primer (SEQ ID NO.17) 1µL,

[0145] Downstream primer (SEQ ID NO.18) 1µL,

[0146] 9.5 µL of sterile distilled water,

[0147] Sample cDNA 1µL,

[0148] The reaction program was 94°C for 5 min, 35 cycles of 94°C for 10 s, 54°C for 20 s, and 72°C for 30 s, and a final extension at 72°C for 5 min.

[0149] The results are shown in Table 1. RT-PCR can detect PEDV G1 and PEDV G2 genotype samples in 10 repeated tests; universal RT-LAMP can also detect PEDV G1 and PEDV G2 genotype samples in 10 repeated tests, but identification RT-LAMP can only detect PEDV G1 genotype samples but not PEDV G2 genotype samples.

[0150] Table 1 Results of RT-PCR and LAMP detection of known PEDV G1 and PEDV G2 genotype strains

[0151]

[0152] 2. 33 unknown suspected porcine epidemic diarrhea samples were tested for different genotypes of PEDV using LAMP and PCR methods respectively.

[0153] The results are shown in Table 2. Among the 33 clinical samples, LAMP detected 8 positive samples with a positive detection rate of 24.24%, of which 1 sample was positive for LAMP identification, indicating that 7 samples were PEDV variants and 1 sample was a PEDV classic strain; while the RT-PCR method only detected 6 positive samples with a positive detection rate of 18.18%. This result further shows that the sensitivity and specificity of the LAMP detection of PEDV established by the present invention are higher.

[0154] Table 2 Results of RT-PCR and LAMP testing of clinical samples

[0155]

[0156] In summary, the LAMP detection method established in the present invention has high sensitivity, strong specificity, good repeatability, and fast detection speed. The whole process of amplification and result determination can be completed in 40 minutes, without the need for large, complex and expensive instruments, and the result identification is convenient and intuitive. The kit obtained in the present invention can not only avoid missed detection and false detection of PEDV variant infection, but also identify PEDV classic strains and variant strains, which is of great significance for understanding the prevalence of PEDV and the prevention and control of PEDV infection.

[0157] Finally, it should be emphasized that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A RT-LAMP primer set for simultaneously identifying PEDV classical strains and variant strains, characterized in that: The RT-LAMP primer set includes primer set I and primer set II; The primer set I includes outer primer pair I PEDV-LM-F3 and PEDV-LM-B3, inner primer pair I PEDV-LM-FIP and PEDV-LM-BIP; the nucleotide sequences of the primer set I are shown in SEQ ID NO.1 to SEQ ID NO.4 respectively; The primer set II includes an outer primer pair II PEDV-LS-F3 and PEDV-LS-B3, and an inner primer pair II PEDV-LS-FIP and PEDV-LS-BIP; the nucleotide sequences of the primer set II are shown in SEQ ID NO.5 to SEQ ID NO.8 respectively.

2. The RT-LAMP primer set for simultaneously identifying PEDV classical strains and variant strains according to claim 1, characterized in that: The universal RT-LAMP detection primer set for detecting classical and variant strains of PEDV is 2 pairs of specific primers of primer set I; The RT-LAMP detection primer set used to identify the classical strain and variant strain of PEDV is 2 pairs of specific primers in primer set II.

3. A kit for simultaneously identifying classical strains and variant strains of PEDV, characterized in that: Comprising the RT-LAMP primer set according to claim 1 or 2.

4. A kit for simultaneously identifying PEDV classical strains and variant strains according to claim 3, characterized in that: Also includes reverse transcriptase, RT-LAMP reaction solution, positive control and negative control.

5. A kit for simultaneously identifying PEDV classical strains and variant strains according to claim 3, characterized in that: The molar ratio of the outer primer pair I to the inner primer pair I is 1:

8.

6. A kit for simultaneously identifying PEDV classical strains and variant strains according to claim 3, characterized in that: The molar ratio of the outer primer pair II to the inner primer pair II is 1:

8.

7. A method for simultaneously detecting PEDV classical strains and variant strains for non-diagnostic purposes, characterized in that: The following steps are involved: (1) RNA extraction and reverse transcription: Extract viral nucleic acid from the sample and reverse transcribe RNA into cDNA using a reverse transcription kit; (2) RT-LAMP reaction: using the kit according to any one of claims 3 to 6 and mixing it with the sample cDNA to prepare an RT-LAMP amplification reaction system for RT-LAMP reaction; (3) Result judgment: Add fluorescent saturated dye to the system after the amplification reaction for visual RT-LAMP detection, and use agarose gel to verify the visual RT-LAMP detection results.

8. The method according to claim 7, characterized in that The RT-LAMP reaction system includes a general LAMP reaction system and an identification LAMP reaction system; wherein, The universal LAMP reaction system includes, in 25 μL: 10× Isothermal Amplification Buffer 2.5 µL, 100mM MgSO4 1.0µL, 10mM dNTP2.5µL, 8000U / mL Bst2.0 DNA polymerase 1.0µL, 5µM outer primer pair I 2.0µL, 40µM inner primer pair I 2.0µL, Sample cDNA 2.5 µL Sterile distilled water 11.5 µL; The identification LAMP reaction system includes, in 25 μL: 10× Isothermal Amplification Buffer 2.5 µL, 100mM MgSO4 1.5µL, 10mM dNTP3.5µL, 8000U / mL Bst2.0 DNA polymerase 1.0µL, 5µM outer primer pair II 2.0µL, 40µM inner primer pair II 2.0µL, Sample cDNA 2.5 µL 10 µL of sterile distilled water.

9. The method according to claim 8, characterized in that The procedure of the general RT-LAMP reaction is: 65°C for 40 min, 80°C for 20 min for inactivation; the procedure of the identification RT-LAMP reaction is: 65°C for 30 min, 80°C for 20 min for inactivation.

10. Use of the kit according to any one of claims 3 to 6 for distinguishing PEDV classical strains and variant strains for non-disease diagnosis purposes.

Images