Aptamer of protein phosphatase 1 regulatory subunit 26, screening method and application thereof

Abstract

The application discloses a nucleic acid aptamer of a protein of a binding protein phosphatase 1 regulatory subunit 26, a screening method and application thereof, the nucleic acid aptamer has a nucleotide sequence which is at least 60% homologous to any one of SEQ ID NO. 1 to SEQ ID NO. 2 and binds to the protein of the binding protein phosphatase 1 regulatory subunit 26, the nucleic acid aptamer sequence has at least 60% homology with at least one of SEQ ID NO. 1 to SEQ ID NO. 2, and it is verified that the nucleic acid aptamer can accurately recognize and tightly bind to the PPP1R26 protein. The nucleic acid aptamer has strong binding force with the PPP1R26 protein, can capture the target protein with very high efficiency, can improve the detection sensitivity and the drug targeting efficiency. Moreover, the chemical property of the aptamer is stable, and the aptamer is not easy to be degraded by environmental factors, so that the aptamer can be applied in a complex biological internal environment, and the long-term effectiveness of the aptamer in the in-vivo application is ensured.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a nucleic acid aptamer binding to protein phosphatase 1 regulatory subunit 26, a screening method and application thereof. BACKGROUND

[0002] The protein phosphatase 1 regulatory subunit 26 is a regulatory subunit of protein phosphatase 1, also known as myosin phosphatase targeting subunit 1 (MYPT1). This protein plays an important role in cell signal transduction and muscle contraction regulation.

[0003] The protein phosphatase 1 regulatory subunit 26 can bind to protein phosphatase 1 (PP1) to form a complex and regulate the enzymatic activity of PP1. This complex is mainly involved in the dephosphorylation process of myosin light chain, thereby affecting the regulation of muscle contraction. In addition, protein phosphatase 1 regulatory subunit 26 can also interact with other signaling molecules and participate in more extensive cell signal transduction processes.

[0004] The upregulation of protein phosphatase 1 regulatory subunit 26 is significantly associated with metastasis and poor survival rate of hepatocellular carcinoma patients. Mechanistically, protein phosphatase 1 regulatory subunit 26 binds to Ser37-phosphorylated PKM2 and TGIF2 in the nucleus, and blocks the binding of TGIF2 to the CDH1 promoter to inhibit the transcription of CDH1. Protein phosphatase 1 regulatory subunit 26 promotes glycolysis by enhancing the splicing of PKM2, and activates EMT by forming a protein phosphatase 1 regulatory subunit 26-PKM2-TGIF2 complex to drive the progression of HCC. Therefore, targeting protein phosphatase 1 regulatory subunit 26 attenuates the progression of HCC and provides a potential therapeutic strategy for the upregulation of protein phosphatase 1 regulatory subunit 26 in HCC patients.

[0005] The main drawbacks of the prior art in screening nucleic acid aptamers against protein phosphatase 1 regulatory subunit 26 (PPP1R26) include insufficient affinity and specificity of the nucleic acid aptamer, leading to an increased risk of non-specific binding, low stability of the nucleic acid molecule in the body, which is easily degraded, affecting the sustained effect of its therapeutic application, and complex and costly synthesis and labeling process, limiting large-scale production and widespread application. SUMMARY

[0006] In order to overcome at least one of the above-mentioned deficiencies of the prior art, the present application provides a nucleic acid aptamer binding to protein phosphatase 1 regulatory subunit 26 protein, a screening method and application thereof, which can solve the problems of insufficient affinity and specificity of the existing nucleic acid aptamer against PPP1R26, and low stability and high cost.

[0007] The technical solution adopted by the present application to solve the problems is:

[0008] A nucleic acid aptamer of a protein phosphatase 1 regulatory subunit 26 protein, the nucleic acid aptamer having a nucleotide sequence that is at least 60% homologous to any one of SEQ ID NO. 1-2 and binds to the protein phosphatase 1 regulatory subunit 26 protein.

[0009] By adopting the above scheme, the nucleic acid aptamer sequence has at least 60% homology with at least one of SEQ ID NO. 1 to SEQ ID NO. 2, and it has been verified that it can accurately identify and tightly bind to the PPP1R26 protein. The nucleic acid aptamer has strong binding force with the PPP1R26 protein, can capture the target protein with very high efficiency, and can improve the detection sensitivity and drug targeting efficiency. Moreover, the chemical properties of the aptamer are stable and not easily degraded by environmental factors, so as to ensure that it can be applied in complex biological in vivo environment, and ensure its long-term effectiveness in in vivo application. In addition, high homology design ensures that the aptamer has high selectivity to the PPP1R26 protein, avoiding non-specific binding of non-target proteins, which is extremely critical for the accuracy of precision medicine and scientific research.

[0010] Further, the nucleic acid aptamer has an RNA sequence transcribed from a nucleotide sequence as shown in any one of SEQ ID NO. 1-2.

[0011] By adopting the above scheme, the RNA sequence is used as the aptamer design to form a high-strength specific binding with the protein phosphatase 1 regulatory subunit 26 (PPP1R26) protein, and the high affinity helps to accurately capture the target protein in complex biological samples, improving the sensitivity and accuracy of detection. In addition, the RNA aptamer accurately matches the specific region of the PPP1R26 protein, effectively avoiding non-specific binding, ensuring that only the target protein reacts in clinical detection and treatment applications, reducing the risk of misdiagnosis and side effects. Moreover, the RNA aptamer can easily be labeled with fluorescent markers, radioactive substances, biotin, etc. by chemical modification, facilitating imaging, tracking and detection. In addition, the flexibility of its structure also allows further modification, making it a drug delivery carrier or coupled with other therapeutic molecules, realizing multifunctional applications.

[0012] Compared with traditional antibodies, the RNA aptamer is chemically synthesized based on known sequences, does not need to rely on cell expression system, greatly shortens the research and development cycle, reduces the production cost, and can quickly adapt to different needs for sequence optimization and customization. Moreover, the RNA aptamer does not trigger an immune response, reducing the potential side effects during use, and is more suitable for long-term treatment and in vivo application.

[0013] Further, the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO. 1-2.

[0014] By adopting the above scheme, the nucleic acid aptamer forms a stable and specific complex by precise complementarity with the PPP1R26 protein, showing stronger binding capacity than traditional molecules such as antibodies. Compared with proteins (such as antibodies), the nucleic acid aptamer has a smaller molecular weight, making it more uniform in distribution in the body and stronger in penetrating the cell membrane. At the same time, its chemical properties are stable and not easily metabolized and degraded, which helps to improve the half-life in the body and prolong the treatment window.

[0015] In addition, the nucleic acid aptamer has a simple structure, which facilitates the addition of fluorescent markers, biotin, radioisotopes or other functional groups during synthesis, without the need for complex protein engineering. Visualization tracking or functional enhancement of target molecules can be achieved, greatly facilitating research and clinical application. In addition, as a non-protein molecule, the nucleic acid aptamer does not trigger an immune response in the body, reducing potential side effects, making them safer for in vivo application. The nucleic acid aptamer based on SEQ ID NO. 1-2 can not only be used for high-sensitivity detection, purification and imaging of PPP1R26 protein, but also for the development of therapeutic drugs for diseases related to abnormal expression of PPP1R26, such as hepatocellular carcinoma (HCC), providing a new means for disease diagnosis and treatment.

[0016] The present application also provides a conjugate or derivative of the nucleic acid aptamer, which adopts the nucleic acid aptamer for binding to the protein phosphatase 1 regulatory subunit 26 (PPP1R26) protein. The conjugate of the nucleic acid aptamer comprises a fluorescent marker.

[0017] The derivative of the nucleic acid aptamer comprises a phosphorothioate backbone or a peptide nucleic acid for binding to the protein phosphatase 1 regulatory subunit 26 (PPP1R26) protein, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

[0018] By adopting the above scheme, the present application not only proposes a high-efficiency nucleic acid aptamer for the protein phosphatase 1 regulatory subunit 26 (PPP1R26) protein, but also further expands the application potential of these aptamers by creating their conjugates and derivatives, greatly enriching their application range in the fields of scientific research and medical treatment. Specifically, the conjugate of the nucleic acid aptamer provides the possibility for visual tracking and real-time monitoring by adding a fluorescent marker. This marker not only facilitates direct observation and quantification of the expression and distribution of the PPP1R26 protein at the cellular or tissue level, but also provides a powerful tool for live cell imaging, drug targeted delivery and biological process research.

[0019] In addition, the derivatives of nucleic acid aptamers are endowed with new physical and chemical properties through innovative modification of chemical structure, such as transforming the original nucleotide sequence skeleton into a phosphorothioate skeleton or a peptide nucleic acid. The introduction of the phosphorothioate skeleton enhances the stability and resistance of the aptamer to nucleases, generally improves the binding affinity to the target protein, prolongs the half-life in the body, and improves the therapeutic effect. The peptide nucleic acid (PNA) derivative can penetrate the cell membrane more effectively and bind more closely to the target protein due to its special non-charge characteristics, and has great potential in drug delivery and gene regulation.

[0020] The present application also provides a screening method of nucleic acid aptamers, which specifically comprises the following steps:

[0021] S1, designing a random single-stranded DNA library: based on the characteristics of protein phosphatase 1 regulatory subunit 26 protein (PPP1R26), a single-stranded DNA library containing a random nucleotide sequence region is designed, and the library design also includes a specific primer binding region;

[0022] S2, synthesizing forward and reverse primers matched with the library design, and primers possibly containing labels for subsequent screening and detection;

[0023] S3, positive screening: using a protein phosphatase 1 regulatory subunit 26 pretreated microplate for screening, so that only nucleic acid fragments specifically binding to PPP1R26 are retained;

[0024] Negative screening: using a microplate treated with bovine serum albumin (BSA) or other non-target proteins to remove non-specifically bound nucleic acid sequences.

[0025] S4, repeating the positive and negative screening process for multiple rounds, and after each round of screening, the nucleic acid sequences binding to PPP1R26 are enriched by PCR amplification, so as to gradually increase the proportion of specific nucleic acid aptamers in the library;

[0026] S5, using QPCR to monitor the Cq value of elution after each round of screening, and the molecular retention rate, to evaluate the screening efficiency;

[0027] S6, using SPR technology to directly determine the binding capacity of the enriched library to PPP1R26 protein after different screening rounds, and to obtain specific affinity data.

[0028] S7, selecting candidate nucleic acid sequences showing high binding capacity after several rounds of screening, and using SPR to further confirm the affinity and specificity of the candidate nucleic acid sequences to PPP1R26 protein;

[0029] S8, performing dot blotting experiment to verify the binding capacity of the candidate nucleic acid aptamers to PPP1R26 protein and control protein.

[0030] S9、analysis screening results, as needed to optimize screening conditions, such as adjusting the elution conditions, increase the screening rounds or change the screening buffer, to further enhance the performance of nucleic acid aptamer.

[0031] By adopting the above scheme, by combining the positive screening and the reverse screening strategy, the non-specific binding nucleic acid sequence can be quickly removed, only the part specifically combined with the PPP1R26 protein is reserved, and the screening efficiency is greatly improved. The cycle screening and PCR amplification of multiple rounds gradually enrich the target nucleic acid aptamer, and ensure that the screened sequence has high specificity and binding capacity.

[0032] The use of QPCR to monitor the molecular retention rate and Cq value of each round of screening can quantitatively analyze the screening efficiency and timely adjust the strategy. The application of SPR technology directly provides accurate quantitative data of the binding capacity of the enriched library and PPP1R26 protein, including affinity (KD value), which ensures that the screened nucleic acid aptamer has excellent binding performance.

[0033] Through the dot blotting experiment, the specific binding of the candidate nucleic acid aptamer and the PPP1R26 protein is further verified, and the comparison experiment with the control protein excludes the possibility of non-specific binding, and ensures the high specificity of the selected nucleic acid aptamer.

[0034] The screening method allows the conditions to be adjusted according to the actual screening results, such as elution conditions, screening rounds or buffer formula, which are all helpful for optimization according to different needs and challenges to achieve the best screening effect.

[0035] The screened high-affinity and high-specificity nucleic acid aptamer not only provides a key component for the development of a protein phosphatase 1 regulatory subunit 26 related disease diagnostic kit, but also lays a foundation for the innovation of targeted drug design and treatment strategy, which has important scientific significance and clinical application value.

[0036] The application also provides a use of the nucleic acid aptamer in the preparation of a protein phosphatase 1 regulatory subunit 26 protein detection, purification or imaging reagent, or a use of a conjugate or derivative of the nucleic acid aptamer in the preparation of a protein phosphatase 1 regulatory subunit 26 protein detection, purification or imaging reagent.

[0037] By adopting the above scheme, the nucleic acid aptamer has a high specificity and strong binding capacity with the PPP1R26 protein, and can be used for developing a high-sensitivity detection method. The nucleic acid aptamer conjugate combined with fluorescence, radioactivity or enzyme label can accurately and quickly detect the content of PPP1R26 protein in cells or body fluids through fluorescence imaging, radioactivity measurement or signal changes generated by enzymatic reaction, and provides a powerful tool for early disease diagnosis.

[0038] In terms of protein purification, aptamers and their conjugates can be used as ligands for affinity chromatography to specifically bind to the target protein PPP1R26, efficiently separating the protein from complex biological samples, improving purification efficiency, reducing sample damage, and facilitating subsequent structural analysis and functional research.

[0039] The high specific binding ability of aptamers enables them to be used as excellent probes for visualizing the distribution and dynamic changes of PPP1R26 protein at the cellular or tissue level. Whether using fluorescently labeled aptamers for direct imaging or integrating them into more complex imaging systems, they can provide clear spatial resolution and help researchers understand the mechanisms of PPP1R26 protein in physiological or pathological processes.

[0040] In addition to basic research, the above aptamers and their derivatives can also be used in drug screening platforms to evaluate the effects of potential drugs on PPP1R26 protein activity, accelerating the drug discovery process. In the clinical treatment field, by specifically regulating the activity of PPP1R26 protein, aptamers have the potential to become new therapeutic agents for treating related diseases such as hepatocellular carcinoma.

[0041] The present application also provides the use of the above-mentioned nucleic acid aptamer in the preparation of a drug targeting protein phosphatase 1 regulatory subunit 26 protein, or the use of the conjugate or derivative of the above-mentioned nucleic acid aptamer in the preparation of a drug targeting protein phosphatase 1 regulatory subunit 26 protein.

[0042] By using the above-mentioned scheme, aptamers can specifically recognize and bind to PPP1R26 protein with high specificity, avoiding side effects caused by non-specific binding and improving the accuracy and safety of drug treatment. By directly interfering with the function of PPP1R26 protein, these aptamers and their conjugates or derivatives can effectively regulate related signaling pathways, such as inhibiting the proliferation, migration, and invasion of tumor cells, thereby playing a therapeutic role in diseases such as hepatocellular carcinoma (HCC) and improving patient prognosis.

[0043] Compared with traditional drugs, aptamers have small molecular weight, no immunogenicity, and can be easily designed into conjugates or derivatives with specific functions, such as by connecting therapeutic substances, fluorescent markers, or specific ligands, which can reduce damage to normal cells while enhancing targeting of diseased sites, thereby reducing systemic toxicity.

[0044] The application also provides a use of the nucleic acid aptamer or the conjugate or derivative thereof in the preparation of a drug for treating abnormal expression of the protein phosphatase 1 regulatory subunit 26.

[0045] By using the above-mentioned scheme, the nucleic acid aptamer and its conjugate or derivative (such as a phosphorothioate skeleton, a peptide nucleic acid) with high specificity and affinity are used to develop innovative therapeutic drugs for abnormal expression of the protein phosphatase 1 regulatory subunit 26 (PPP1R26). These aptamers can effectively regulate the related disease signaling pathways by precisely targeting the PPP1R26 protein, such as inhibiting tumor progression in hepatocellular carcinoma treatment, while reducing the impact on normal tissues, improving the safety and efficacy of treatment. The design of conjugates or derivatives enhances the in vivo stability, cell penetration of aptamers, and promotes drug delivery efficiency, providing the possibility for personalized medicine and multi-modal treatment strategies. In addition, they also have unique advantages as diagnostic tools for monitoring treatment response, bringing revolutionary progress to the research and treatment of PPP1R26-related diseases, and showing great potential for clinical application and social value.

[0046] The application also provides a protein phosphatase 1 regulatory subunit 26 protein detection kit prepared from the nucleic acid aptamer or the conjugate or derivative thereof.

[0047] By using the above-mentioned scheme, the protein detection kit can significantly improve the specificity and sensitivity of detection. The kit takes advantage of the nucleic acid aptamer and its conjugate or derivative to achieve rapid and accurate recognition of the PPP1R26 protein, and even micro samples can be accurately captured, providing a simple, efficient and stable tool for disease diagnosis. It is not only suitable for various sample types, but also widens the application range. In addition, through non-invasive or minimally invasive detection methods, it improves the comfort of patients. In addition, the cost-effectiveness and easy scalability of the nucleic acid aptamer make the kit show extensive application potential and great social value in clinical practice, scientific research and even public health monitoring.

[0048] In summary, based on the SELEX technology, a random single-stranded DNA library and corresponding primers are designed and synthesized for screening nucleic acid aptamers capable of binding to protein phosphatase 1 regulatory subunit 26 protein with high affinity, small molecular weight, stable chemical properties, easy to preserve and label, so as to screen some nucleic acid aptamers capable of binding to protein phosphatase 1 regulatory subunit 26 protein with high affinity, which are XJ01 (SEQ ID NO. 1) and XJ02 (SEQ ID NO. 2), respectively. The nucleic acid aptamers have higher affinity to protein phosphatase 1 regulatory subunit 26 protein and higher specificity.

[0049] Due to the particularity of the nucleotide sequence, a certain position on the nucleotide sequence of the nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium or isotopic modification, provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, can have equal or higher affinity to protein phosphatase 1 regulatory subunit 26 protein than the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved but has higher stability. It can be understood that the nucleotide sequence having at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology to the nucleic acid aptamer provided by the present application and binding to protein phosphatase 1 regulatory subunit 26 protein, for example, can delete part of the sequence or add part of the sequence to the nucleotide sequence shown in any of the above nucleic acid aptamers, still has high affinity to protein phosphatase 1 regulatory subunit 26 protein.

[0050] In other words, the above nucleic acid aptamer after partial substitution or modification has substantially the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamer, and can be applied to binding to protein phosphatase 1 regulatory subunit 26 protein.

[0051] In a second aspect, the present application provides a conjugate or derivative of a nucleic acid aptamer, wherein the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO. 1 to SEQ ID NO. 2; the conjugate of the nucleic acid aptamer comprises a fluorescent label; and the derivative of the nucleic acid aptamer comprises a phosphorothioate backbone or a peptide nucleic acid for binding to protein phosphatase 1 regulatory subunit 26 protein, which is transformed from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

[0052] The conjugate of the nucleic acid aptamer of the present application refers to the connection of other groups on the nucleic acid aptamer, such as the connection of fluorescent markers with a labeling effect, for example FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA or enzyme markers, etc., so that the nucleic acid aptamer sequence obtained after modification has the desired properties, for example, it can have equal or higher affinity for the binding protein phosphatase 1 regulatory subunit 26 protein than the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0053] The nucleic acid aptamer derivative of the present application is obtained by modifying the backbone of the nucleotide sequence of the above-mentioned nucleic acid aptamer into a phosphorothioate backbone that binds to the binding protein phosphatase 1 regulatory subunit 26 protein, or is a peptide nucleic acid that binds to the binding protein phosphatase 1 regulatory subunit 26 protein, which is modified from the nucleic acid aptamer or the conjugate of the nucleic acid aptamer in any of the preceding technical solutions. The derivative has substantially the same or similar molecular structure, physicochemical properties and function as the original nucleic acid aptamer, and binds to the binding protein phosphatase 1 regulatory subunit 26 protein.

[0054] The term "phosphorothioate backbone" used in the present application has the general meaning understood by those of ordinary skill in the art, which refers to the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA nucleic acid aptamers can be replaced by one or two sulfur atoms, respectively, to produce a phosphorothioate backbone with phosphorothioate or dithiophosphoester bonds. It is known that such phosphorothioate backbones have increased binding affinity to their targets and enhanced resistance to nuclease degradation.

[0055] The term "peptide nucleic acid" used in the present application has the general meaning understood by those of ordinary skill in the art, which refers to an artificially synthesized DNA molecule analogue first reported by Nielsen et al. in 1991. The sugar-phosphate backbone is replaced by N-2-(aminoethyl)-glycine (N-(2-aminoethyl)-glycine) units as repeating structural units to synthesize oligonucleotide mimics connected by peptide bonds, called peptide nucleic acids. Since peptide nucleic acids (PNA) do not have phosphate groups on DNA or RNA, there is no electrostatic repulsion between PNA and DNA, so the binding strength between them is greater than that between DNA and DNA.

[0056] In a third aspect, the present application provides a use of the nucleic acid aptamer in the preparation of a protein phosphatase 1 regulatory subunit 26 protein detection, purification or imaging reagent.

[0057] In a fourth aspect, the present application provides a use of the nucleic acid aptamer in the preparation of a drug targeting the binding protein phosphatase 1 regulatory subunit 26 protein.

[0058] In a fifth aspect, the present application provides a use of the nucleic acid aptamer in the preparation of a drug for treating abnormal expression of the protein of protein phosphatase 1 regulatory subunit 26.

[0059] In a sixth aspect, the present application provides a protein phosphatase 1 regulatory subunit 26 protein detection product prepared by using the nucleic acid aptamer, wherein the product comprises the nucleic acid aptamer, or a conjugate or derivative of the nucleic acid aptamer.

[0060] In addition, the nucleic acid aptamer, the conjugate or the derivative thereof has the following use in any one of the following aspects:

[0061] 1) quantitatively or qualitatively detecting the protein of protein phosphatase 1 regulatory subunit 26;

[0062] 2) purifying the protein of protein phosphatase 1 regulatory subunit 26;

[0063] 3) imaging the protein of protein phosphatase 1 regulatory subunit 26;

[0064] 4) serving as an inhibitor of the protein of protein phosphatase 1 regulatory subunit 26;

[0065] 5) preparing a drug targeting the protein of protein phosphatase 1 regulatory subunit 26;

[0066] 6) preparing a reagent or a drug for diagnosing and treating abnormal expression of the protein of protein phosphatase 1 regulatory subunit 26.

[0067] Compared with the prior art, the nucleic acid aptamer provided by the present application, the screening method and the application thereof have the following technical effects:

[0068] 1. By improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy to store and label, and capable of binding to the protein of protein phosphatase 1 regulatory subunit 26 with high affinity and high specificity is screened;

[0069] 2. The nucleic acid aptamer has a relatively stable structure, is simple and easy to modify, can be artificially synthesized in a short period of time, has stable chemical properties, is easy to store and label;

[0070] 3. The nucleic acid aptamer obtained by the present application can be used for detecting, purifying or imaging the protein of protein phosphatase 1 regulatory subunit 26, and can also be used for preparing a drug for diagnosing or treating abnormal expression of the protein of protein phosphatase 1 regulatory subunit 26, etc., such as being used for purifying the protein of protein phosphatase 1 regulatory subunit 26 to obtain high-sensitivity and high-specificity detection, being used for preparing a drug targeting the protein of protein phosphatase 1 regulatory subunit 26, being used for preparing a reagent or a drug for diagnosing or treating abnormal expression of the protein of protein phosphatase 1 regulatory subunit 26, etc., and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0071] Figure 1 Cq(A) and molecular retention rate (B) of positive and negative screening elution of 6 rounds of screening by QPCR (real-time fluorescent quantitative PCR) detection in Example 1.

[0072] Figure 2 Figure showing the binding ability of enriched library to target protein in the 1st, 3rd, 6th round of screening by SPR (surface plasmon resonance) detection in Example 1.

[0073] Figure 3 Figure showing the affinity detection data of aptamer XJ01 to protein phosphatase 1 regulatory subunit 26 protein by SPR (surface plasmon resonance) detection in Example 2.

[0074] Figure 4 Figure showing the affinity detection data of aptamer XJ02 to protein phosphatase 1 regulatory subunit 26 protein by SPR (surface plasmon resonance) detection in Example 2.

[0075] Figure 5 Figure showing the affinity detection data of aptamer XJ01 to control proteins Fibrinogen protein and holo-Transferrin protein (two names written) in Example 3.

[0076] Figure 6 Figure showing the affinity detection data of aptamer XJ02 to control proteins Fibrinogen protein and holo-Transferrin protein (two names written) in Example 4.

[0077] Figure 7 Figure showing the results of dot blotting experiment based on aptamer XJ01 to detect protein phosphatase 1 regulatory subunit 26 protein and control proteins IgG2, Fibrinogen, and holo-Transferrin in Example 3.

[0078] Figure 8 Figure showing the results of dot blotting experiment based on aptamer XJ02 to detect protein phosphatase 1 regulatory subunit 26 protein and control proteins IgG2, Fibrinogen, and holo-Transferrin in Example 4. DETAILED DESCRIPTION

[0079] In order to better understand and implement, the technical solutions in the embodiments of the present application will be clearly and completely described and discussed below in combination with the drawings of the present application. Obviously, only some examples of the present application are described here, and all other examples obtained by those of ordinary skill in the art without creative efforts based on the embodiments of the present application shall fall within the protection scope of the present application.

[0080] In order to facilitate the understanding of the embodiments of the present application, the following will be further explained and described with specific examples as examples in combination with the drawings, and each embodiment does not constitute a limitation on the embodiments of the present application.

[0081] In the description of the present application, it should be noted that the terms "upper", "lower", "front", "back", "left", "right", "vertical", "horizontal", "top", "bottom", "inner", "outer" and the like indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, and are only for the purpose of facilitating the description of the present application and simplifying the description, and do not indicate or imply that the devices or elements referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore cannot be understood as a limitation on the present application.

[0082] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application herein are only for the purpose of describing specific embodiments and are not intended to limit the present application.

[0083] The reagents not specifically indicated in the present embodiment are known products, which are obtained by purchasing commercially available products.

[0084] Example 1: Screening of ssDNA aptamer of protein phosphatase 1 regulatory subunit 26

[0085] The method for screening the ssDNA aptamer of protein phosphatase 1 regulatory subunit 26 protein in the present embodiment comprises the following steps:

[0086] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences:

[0087] Based on the SELEX technology, a random single-stranded DNA library-Lib10 library is designed and synthesized:

[0088] 5'-ATTGGCACTCCACGCATAGG(36N)CCTATGCGTGCTACCGTG AA-3'; wherein "36N" represents a sequence of 36 arbitrary nucleotide bases connected. The library is synthesized by GenScript Biotech (Shanghai) Co., Ltd. (hereinafter referred to as "GenScript" for short).

[0089] The primer information is shown in Table 1, which is synthesized by Nanjing Kingsriver Biotechnology Co., Ltd.

[0090] Table 1. Primer and its sequence:

[0091] Primer name Sequence (5'-3') Lib10S1 ATTGGCACTCCACGCATAGG Lib10-FAM-S1 FAM-ATTGGCACTCCACGCATAGG Lib10-Biotin-A2 Biotin-TTCACGGTAGCACGCATAGG Lib10A2 TTCACGGTAGCACGCATAGG

[0092] Wherein, S in the primer name represents a forward primer, and A represents a reverse primer.

[0093] The primers are respectively prepared into 100 mM stock solution with ddH2O, and stored at -20℃ for standby.

[0094] 2, New microplate method screening

[0095] The protein phosphatase 1 regulatory subunit 26 protein aptamer is screened by the new microplate method, and a total of 6 rounds of screening are performed. The screening process of each round is shown in Table 2.

[0096] Table 2. Protein phosphatase 1 regulatory subunit 26 protein aptamer screening process

[0097]

[0098]

[0099] Phosphate buffer: final concentration of disodium hydrogen phosphate 100 mM, final concentration of sodium dihydrogen phosphate 100 mM, solvent is water, pH 8.5, stored at 25℃.

[0100] The specific screening process is as follows:

[0101] Protein phosphatase 1 regulatory subunit 26 protein plating (positive screening plating)

[0102] Take 2 μg of protein phosphatase 1 regulatory subunit 26 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., Uniport ID: P03280PA, concentration 1.2 mg / mL), add 100 μL of phosphate buffer and mix well, so that the protein can be combined with the plate, which is the diluted protein phosphatase 1 regulatory subunit 26 protein. Add to the new microplate, shake bed incubate for one hour, and after incubation, wash with DPBS buffer three times. Add 300 μL of 1 mg / mL BSA for whole plate room temperature blocking for 10 minutes. Wash with DPBS three times. Add 200 ul of 0.06M EDC and incubate for 10 minutes; after discarding the supernatant, add 200 ul of 1M ethanolamine for blocking for 10 minutes, and wash three times for standby.

[0103] 2) Plating of BSA protein (counter-screen plating) Step 1) method, replace 26 protein of protein phosphatase 1 regulatory subunit with 2 μg protein (concentration of 1 mg / ml), add 200 μL of phosphate buffer volume, so that the protein can bind to the plate, incubate for one hour, after incubation, wash with DPBS buffer three times for standby.

[0104] 3) Library dissolution and denaturation treatment

[0105] Take Lib10 random single-stranded nucleotide library (1 OD) synthesized by Shengong, centrifuge at 12000 rpm for 10 minutes, centrifuge the library to the bottom of the tube, dissolve to 5 μM with DPBS buffer, mix well and then aliquot into PCR tubes for denaturation treatment. The treatment process is as follows: set the PCR instrument program to 95°C for 10 minutes, this step is to unfold the folded chains, then 4°C for 5 minutes, and then balance to room temperature. Then add Mg2+ (final concentration of 5 mM), BSA (final concentration of 0.5 mg / mL), HSDNA (final concentration of 0.05 mg / mL) to the library, mix well to provide the ion environment required for single-stranded DNA and reduce non-specific binding and increase competition. This is the library after denaturation treatment.

[0106] 4) Counter-screening

[0107] Add 200 μL of treated library to the BSA protein plated well plate, incubate for one hour, collect the supernatant after incubation, mark it as Pool-, the supernatant is used as a single-stranded nucleic acid library. Wash the magnetic beads in the new microplate with 200 μL of DPBS buffer for 4 times. Finally, add 100 μL of ultrapure water to the washed new microplate, boil in boiling water for 10 minutes, collect the supernatant (i.e. counter-screening supernatant), mark it as elution-BSA.

[0108] 5) Positive screening

[0109] Add the collected counter-screening supernatant to the new microplate plated with protein phosphatase 1 regulatory subunit 26 protein, incubate for 60 minutes. Discard the supernatant after incubation, wash the new microplate with 200 μL of DPBS buffer for 4 times. Finally, add 100 μL of ultrapure water to the washed new microplate, boil in boiling water for 10 minutes, collect the supernatant, mark it as elution-protein phosphatase 1 regulatory subunit 26.

[0110] 6) Preparation of secondary library

[0111] 10 μL of elution-protein phosphatase 1 regulatory subunit 26 of step 5) and elution-BSA in the counter-screening process were quantified by QPCR, and the number of molecules retained in each round was calculated to monitor the screening process, the results are shown in Figure 1 .

[0112] The nucleic acid molecules in the elution-protein phosphatase 1 regulatory subunit 26 are used as templates for general PCR amplification. The method is as follows: 90 μL of template elution-protein phosphatase 1 regulatory subunit 26 is added to 900 μL of PCR mix and mixed well, 10 μL of ultrapure water is added, the template and PCR mix are mixed and divided into 100 μL / tube and added to the PCR tube, and the amplification conditions are as follows: 95°C pre-denaturation for 2 minutes, 95°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 30 seconds, a total of 25 cycles, and 4°C storage. The PCR raw materials in the PCR mix are prepared from dNTPs (P031-02) purchased from Novizen and rtaq enzyme (R500Z) purchased from Baisheng.

[0113] The amplification product is purified using purchased commercial Tianren and SA magnetic beads (SM017010) to prepare a secondary library for the next round of screening. Prepare 80 μL of SA magnetic beads, wash twice with 500 μL of DPBS buffer containing 5 mM Mg2+ and 0.02% Tween 20, magnetically remove the supernatant, add 1000 μL of PCR product of step 6), and then add 1 / 5 volume of 4M sodium chloride aqueous solution to the PCR product. Incubate at room temperature for 30 min on a shaker, then magnetically remove the supernatant. Wash the magnetic beads with DPBS buffer three times, remove the supernatant, and then add 100 μL of 40 mM sodium hydroxide aqueous solution. Incubate at room temperature for three minutes, then magnetically remove the magnetic beads. Then add 4 μL of 1M hydrochloric acid to the supernatant to neutralize the single-stranded, then add 104 μL of 2*DPBS buffer for salt concentration dilution and neutralization, and finally obtain 208 μL of secondary library dissolved in 1*DPBS buffer, which can be used as the library for the next round of screening.

[0114] The new microwell plate method is repeated for 5 rounds, and the secondary library obtained in each operation is used as the starting nucleic acid library for each operation, and steps 3), 4), 5) and 6) are performed.

[0115] Example 2: Surface plasmon resonance (SPR) detection of library affinity

[0116] The enrichment of the library is determined according to the QPCR Cq value of the elution in each round of positive and negative screening process. If the number of templates eluted in each round of positive screening increases (Cq is advanced) and the number of templates eluted in the last round is more than 100 times the number of templates eluted in the first round, the screening is stopped. Figure 1The retention rate of each round of molecules was calculated according to the elution Cq value of the forward and reverse screens, and the retention rate of the forward screen was gradually increased, indicating that the library was effectively enriched.

[0117] The same operation as the 2nd injection hole was performed, and the protein phosphatase 1 regulatory subunit 26 protein was replaced with His protein (the same as Example 1), and the other operations were the same. The His protein was coupled in the 3rd injection hole channel as a control channel.

[0118] The single-chain libraries obtained in the 1st round, the 3rd round and the 6th round of screening were selected for renaturation treatment: 40 μL of 200 nM single-chain library was taken and labeled as protein phosphatase 1 regulatory subunit 26 Pool1, protein phosphatase 1 regulatory subunit 26 Pool3 and protein phosphatase 1 regulatory subunit 26 Pool6, respectively.

[0119] Detection: The three rounds of library protein phosphatase 1 regulatory subunit 26 Pool1, protein phosphatase 1 regulatory subunit 26 Pool3 and protein phosphatase 1 regulatory subunit 26 Pool6 were sequentially flowed through the 2nd injection hole, and the procedure of each channel was as follows: library injection 30 μL / min, time 3 min; DPBS buffer (containing 5 mM Mg2+) injection 30 μL / min for dissociation, time 3 min; 2 M NaCl aqueous solution injection 30 μL / min for regeneration, time 45 s. The results are shown in Figure 2

[0120] Figure 2 ​The protein phosphatase 1 regulatory subunit 26 Pool1, protein phosphatase 1 regulatory subunit 26 Pool3, and protein phosphatase 1 regulatory subunit 26 Pool5 can be seen that Pool1 has high affinity, because in the first round, only positive screening was performed and overnight incubation was performed, and no reverse screening was performed. Protein phosphatase 1 regulatory subunit 26 Pool6 is much higher than protein phosphatase 1 regulatory subunit 26 Pool1 and protein phosphatase 1 regulatory subunit 26 Pool3, and meets the sequencing requirement. The obtained library is subjected to high-throughput sequencing analysis.

[0121] Example 3: Surface plasmon resonance (SPR) detection of the affinity of the protein nucleic acid aptamer of protein phosphatase 1 regulatory subunit 26 protein to the protein phosphatase 1 regulatory subunit 26 protein

[0122] Analysis and identification of the nucleic acid aptamer obtained after screening: After high-throughput sequencing analysis of the obtained enriched library product, several sequences are selected by Suzhou Jinweizhi Biological Technology Co., Ltd. for synthesis, and the affinity is detected.

[0123] In subsequent detection, from the sequences obtained in the final 6th round, 2 sequences with strong binding capacity are determined.

[0124] Table 3, SEQ ID No1 and SEQ ID No2 sequence list:

[0125]

[0126] Suzhou Jinweizhi Biological Technology Co., Ltd. is entrusted to synthesize the nucleic acid aptamers XJ01 and XJ02, which are respectively diluted into 500nM, 250nM, 125nM, 62.5nM, and 31.25nM with DPBS buffer solution (containing 5mM Mg2+).

[0127] 1. The protein phosphatase 1 regulatory subunit 26 protein was coupled to the surface of the 8th channel of the 2nd injection hole of the CM5 chip surface of the surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K) as the experimental channel, and the specific method was as follows: first, the chip was cleaned with 50 mM NaOH aqueous solution, 20 μL was injected, and the flow rate was 10 μL / min, then equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) were mixed, and 105 μL of activated chip was injected, and the flow rate was 10 μL / min. The protein phosphatase 1 regulatory subunit 26 protein (purchased from Suzhou Yannuo Zhen Biosciences Co., Ltd., Uniport ID: P03280PA, concentration 1.2 mg / mL) was diluted with 10 mM sodium acetate buffer at pH 5.5 to a final concentration of 50 μg / mL, and then injected, the injection volume was 190 μL, the flow rate was 10 μL / min, and the protein phosphatase 1 regulatory subunit 26 protein coupling amount was about 1195.3 Ru. After the injection was completed, ethanolamine was injected to block the chip, the flow rate was 10 μL / min, and the injection volume was 129 μL.

[0128] The same as the operation of the 2nd injection hole, the protein phosphatase 1 regulatory subunit 26 protein was replaced with His protein (the same as Example 1), and the other operations were the same. The His protein was coupled in the 1st injection hole channel as a control channel.

[0129] 2. Detection: The diluted nucleic acid aptamer XJ1 sample was sequentially flowed through the 2nd injection hole, and the procedure of each channel was as follows: nucleic acid aptamer injection 30 μL / min, time 3 min; DPBS buffer (containing 5 mM Mg2+) injection 30 μL / min for dissociation, time 3 min; 2 M NaCl aqueous solution injection 30 μL / min for regeneration, time 45 s. The results are shown in Figure 3

[0130] Under the same conditions, the nucleic acid aptamer XJ01 sample was replaced with nucleic acid aptamer XJ2, and the other operations were the same. The results are shown in Figure 4

[0131] The affinity KD value of the protein phosphatase 1 regulatory subunit 26 protein nucleic acid aptamer XJ01, XJ02 and the protein phosphatase 1 regulatory subunit 26 protein is shown in Table 4.

[0132] Table 4. Affinity of nucleic acid aptamer and protein phosphatase 1 regulatory subunit 26 protein

[0133] Aptamer Length Affinity KD (nM) XJ01 76 1.87 XJ02 76 22.7

[0134] ​​As shown in Table 4, the XJ01 and XJ02 provided by the present application have high affinity to the protein phosphatase 1 regulatory subunit 26 protein (the smaller the KD value, the greater the affinity).

[0135] Table 4, Figure 3 , Figure 4 These data show that these nucleic acid aptamers are detected by the SPR instrument to have strong binding to the protein phosphatase 1 regulatory subunit 26 protein.

[0136] Example 4: Specificity study of nucleic acid aptamer

[0137] Fibrinogen protein (item number: SLCQ2911, purchased from Merck), holo-Transferrin protein (item number: SLCQ3428, purchased from Merck), IgG protein (item number: SLCN8818, purchased from Merck).

[0138] In this example, Fibrinogen protein and holo-Transferrin protein are respectively used instead of protein phosphatase 1 regulatory subunit 26 protein, and the method for testing is the same as that in Example 2 in which the protein phosphatase 1 regulatory subunit 26 protein is fixed to the SPR chip. The Fibrinogen protein and holo-Transferrin protein are respectively coupled to the 5th and 6th channels of the CM5 chip surface, and the coupling amounts are 7758.9 RU and 10976.4 RU, respectively. The two nucleic acid aptamers XJ01 and XJ02 diluted to 500 nM are successively injected.

[0139] The affinity detection data of the nucleic acid aptamer XJ01 to the Fibrinogen protein and the holo-Transferrin protein are shown in Figure 7 ; the affinity detection data of the nucleic acid aptamer XJ02 to the above five proteins are shown in Figure 8 ; as can be seen from the figures, the nucleic acid aptamers XJ01 and XJ02 cannot bind to these two proteins, and it can be seen that the nucleic acid aptamer of the protein phosphatase 1 regulatory subunit 26 obtained after screening and optimization has very high specificity in binding to the target.

[0140] Example 5: Dot blotting experiment for detecting protein phosphatase 1 regulatory subunit 26 protein based on nucleic acid aptamer

[0141] The biotin-modified nucleic acid aptamers XJ01 and XJ02 are synthesized by Suzhou Jinyuizhi Biological Technology Co., Ltd.

[0142] Fibrinogen protein (item number: SLCQ2911, purchased from Merck), holo-Transferrin protein (item number: SLCQ3428, purchased from Merck), IgG protein (item number: SLCN8818, purchased from Merck).

[0143] Dot blotting experiments were performed on biotin-modified aptamers XJ01 and XJ02, respectively, as follows:

[0144] 1. Dot blotting experiments were performed on aptamers XJ01 and XJ02 to detect the specificity of protein phosphatase 1 regulatory subunit 26 protein.

[0145] (1) Protein phosphatase 1 regulatory subunit 26 protein was dissolved in DPBS buffer to 0.500 mg / mL as the test sample; control proteins IgG2, Fibrinogen, and holo-Transferrin were dissolved in DPBS buffer to 0.500 mg / mL as control samples. Take one 8 cm x 2 cm test strip (nitrocellulose membrane, 0.2 μm, GE Amersham, item number 10600001), and spot 4 μL of the test sample and control sample on the nitrocellulose membrane, and air dry for 40 minutes.

[0146] (2) Then put the test strip into a 50 mL centrifuge tube, add 6 mL of DPBS buffer containing 10% BSA to soak it, and seal it in a shaking incubator at room temperature for 1 hour. After blocking, wash with DPBS (containing 5 mM Mg2+, 0.02% Tween20) for 5 minutes, repeat for 3 times, and aspirate.

[0147] (3) Then transfer the test strip to a new 50 mL centrifuge tube, add 6 mL of 500 nM biotin-modified aptamer XJ01 dissolved in DPBS buffer (containing 5 mM Mg2+) to soak it, and incubate in a shaking incubator at room temperature for 30 minutes. After incubation, wash with DPBS (containing 5 mM Mg2+, 0.02% Tween20) for 2 minutes, repeat for 3 times, and aspirate.

[0148] (4) Then transfer the test strip to a new 50 mL centrifuge tube, add 6 mL of HRP-Streptavidin (purchased from Beyotime Biotech 1 mg / ml): DPBS buffer = 1:2000 dilution to soak it, and incubate in a shaking incubator at room temperature for 30 minutes. After incubation, wash with DPBS (containing 5 mM Mg2+, 0.02% Tween20) for 2 minutes, repeat for 3 times, and aspirate.

[0149] (5) Transfer the test strip to a clean PE glove, take an ECL developing reagent kit (purchased from Beyotime Biotech), mix 100 μL of A liquid and 100 μL of B liquid, soak the surface of the test strip, and incubate in the dark for 5 minutes.

[0150] (6) Imaging system observation and photographing: ImageQuant of GE Medical Life Science Department TM LAS 4000 digital imaging system photographing, and the results are shown in Figure 7 .

[0151] Under the same conditions, 500 nM biotin-modified aptamer XJ01 is replaced by 500 nM biotin-modified aptamer XJ02, and the results are shown in Figure 8 .

[0152] It can be seen from Figure 7 and Figure 8 that the protein phosphatase 1 regulatory subunit 26 protein is obviously different from the spots of the control proteins IgG2, Fibrinogen and holo-Transferrin. This indicates that the biotin-modified aptamers XJ01 and XJ02 can be used for the detection of the protein phosphatase 1 regulatory subunit 26 protein in membrane hybridization, and the control proteins IgG2, Fibrinogen and holo-Transferrin hardly develop color, which further proves that the XJ02 and XJ02 can specifically bind to the protein phosphatase 1 regulatory subunit 26 protein.

[0153] The technical means disclosed in the present application scheme are not limited to the technical means disclosed in the above embodiments, and also include technical solutions composed of any combination of the above technical features. It should be pointed out that for ordinary skilled persons in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements are also considered to be within the protection scope of the present application.

Claims

1. A nucleic acid aptamer that binds to protein phosphatase 1 regulatory subunit 26 protein, characterized in that: The nucleic acid aptamer is selected from any one of SEQ ID NO.1 to SEQ ID NO.2 and binds to the nucleotide sequence of protein phosphatase 1 regulatory subunit 26 protein; Among them, the nucleotide sequence of SEQ ID NO.1 is: ATTGGCACTCCACGCATAGGCAGACTAGGTCGATGGGGTTACGTTTGGTGGCTGTCCCTATGCGTGCTACCGTGAA; The nucleotide sequence of SEQ ID NO.2 is: ATTGGCACTCCACGCATAGGTTGGTTCTGAGGGTTCCCAGACTGGGATACGGCTTGCCTATGCGTGCTACCGTGAA.

2. A conjugate of a nucleic acid aptamer, characterized in that: The nucleic acid aptamer binding to protein phosphatase 1 regulatory subunit 26 protein according to claim 1 is used, and the conjugate of the nucleic acid aptamer includes a fluorescent marker.

3. Use of the nucleic acid aptamer according to claim 1 in preparing a reagent for detecting or imaging protein phosphatase 1 regulatory subunit 26 protein, or use of the nucleic acid aptamer conjugate according to claim 2 in preparing a reagent for detecting or imaging protein phosphatase 1 regulatory subunit 26 protein.

4. A protein phosphatase 1 regulatory subunit 26 protein detection kit prepared by the nucleic acid aptamer according to claim 1, or a protein phosphatase 1 regulatory subunit 26 protein detection kit prepared by the nucleic acid aptamer conjugate according to claim 2.

Images