A molecular marker related to low temperature tolerance of arrow leek pea and application thereof

Abstract

The application provides a molecular marker related to low-temperature tolerance of arrow leek pea and application thereof, and belongs to the technical field of biotechnology. The molecular marker is located on the 6th chromosome of the arrow leek pea, and the nucleotide sequence of the inserted or deleted fragment is shown in the sequence table SEQ ID NO. 3. The primer pair for amplifying the molecular marker has the nucleotide sequences shown in SEQ ID NO. 1-2. The molecular marker and the primer pair thereof can identify or assist in identifying the low-temperature tolerance of the arrow leek pea. Meanwhile, the application also provides a method for rapidly identifying the low-temperature tolerance of the arrow leek pea by using the molecular marker. The method is simple and fast, the identification result is accurate, and has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers and their applications related to the low-temperature tolerance of arrowhead peas. Technical Background

[0002] Food security is a crucial foundation of national security, making vigorous agricultural development essential, and seeds can be considered the "chips" of agriculture. Developing new varieties is a vital part of seed industry development. Currently, breeding is mainly divided into two categories: traditional breeding and molecular breeding. Traditional breeding methods primarily focus on phenotypic traits of crops, following Mendelian laws of inheritance. The results are reliable and predictable, but traditional breeding has a long cycle and is limited to the same species or closely related species within the same genus. Molecular breeding, compared to traditional methods, has advantages such as a shorter breeding cycle and is not limited by species relationships. Molecular markers are genetic markers based on nucleotide sequence variations within an individual's genetic material, directly reflecting genetic polymorphism at the DNA level. Due to nucleotide sequence polymorphism, different genotypes arise in plants, resulting in different phenotypes within the same species. Therefore, by analyzing the genotypes of molecular markers closely linked to the target gene, selection can be made using molecular markers to identify individuals with superior traits, achieving the purpose of assisted breeding.

[0003] *Vicia sativa* L. is a self-pollinating, annual herbaceous plant belonging to the genus *Vicia* in the family Fabaceae. Native to southern Europe and western Asia, it is widely distributed and cultivated throughout China. It grows in barren mountains, field edges, and forests at altitudes of 50-3000 meters. The stems and leaves of *Vicia sativa* are tender, nutritious, and palatable, readily consumed by livestock such as cattle, sheep, pigs, and rabbits. Its forage has a higher crude protein content and lower crude fiber content than *Vicia sativa*, and is rich in amino acids. Furthermore, *Vicia sativa* can be used as a green manure plant for soil improvement. Therefore, the development of molecular markers and assisted selection breeding are gradually underway for *Vicia sativa*, but a large number of reliable molecular markers are still severely lacking.

[0004] Extreme climate is a significant limiting factor affecting plant distribution. In northern my country, low-temperature stress is a major limiting factor affecting the life cycle length of crops. Therefore, breeding cold-resistant *Vicia sativa* germplasm is crucial for extending its growth cycle, increasing yield, and expanding its distribution range. Because *Vicia sativa* breeding started relatively late, reports on molecular marker development and mapping are very limited. Therefore, developing cold-resistance-related molecular markers in *Vicia sativa* through genome-wide association analysis combined with molecular markers to predict and screen germplasm with high low-temperature tolerance is of great significance for constructing a selection-assisted breeding system, improving germplasm resources, and breeding new varieties. Summary of the Invention

[0005] One of the objectives of this invention is to provide a method for identifying the low-temperature tolerance of arrowhead peas.

[0006] The second objective of this invention is to provide an InDel molecular marker associated with the low-temperature tolerance trait of arrowhead pea.

[0007] A third objective of this invention is to provide the application of the InDel molecular markers related to the low-temperature tolerance trait of arrowhead pea.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] The molecular marker disclosed in this invention, which is associated with the low-temperature tolerance trait of *Vaccinium bracteatum*, is located on chromosome 6 of *Vaccinium bracteatum* and is named Vs_Chr6_49209793.

[0010] Primer pairs were used to amplify molecular markers associated with low-temperature tolerance in *Vallis fulva*. The primer pair sequence corresponding to the molecular marker Vs_Chr6_49209793 is as follows:

[0011] Vs_Chr6_49209793-F: AACTCATGACATGAGTTGTAAACTAATAG (as shown in SEQ ID NO.1);

[0012] Vs_Chr6_49209793-R: CAACAATCTAGGAATGATGCACTG (as shown in SEQ ID NO.2).

[0013] This invention also discloses the application of the above-mentioned molecular marker primer pairs in marker-assisted breeding of *Vaccaria spp.* That is, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage, the presence of the molecular markers of this invention can be detected, thereby identifying the low-temperature tolerance of *Vaccaria spp.* materials. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0014] This invention also discloses the application of the above-mentioned molecular markers in screening and identifying the low-temperature tolerance of arrowhead peas. Specifically, the specific steps for identifying whether arrowhead peas have high and low temperature tolerance are as follows:

[0015] (1) Using the DNA of the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Vs_Chr6_49209793. The PCR amplification reaction system is shown in Table 1:

[0016] Table 1 PCR amplification reaction system

[0017]

[0018]

[0019] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 53.5℃ for 30 s, extension at 72℃ for 6 s, 35 cycles; extension at 72℃ for 10 min; store at 4℃.

[0020] (2) Detection of PCR products by agarose gel electrophoresis: Take 5 μL of PCR products and judge the low temperature tolerance of arrowhead pea based on the band results.

[0021] PCR amplification was performed using primers Vs_Chr6_49209793-F and Vs_Chr6_49209793-R. If the PCR amplification product contained only one characteristic band of 264 bp as shown in SEQ ID NO.4, then *Vaccaria spp.* was a type with low cold tolerance; if the PCR amplification product contained only one characteristic band of 223 bp as shown in SEQ ID NO.4, then *Vaccaria spp.* was a type with high cold tolerance.

[0022] In addition, this invention also protects a kit for identifying the low-temperature tolerance of *Vallisneria natans*, the kit containing primer pairs Vs_Chr6_49209793-F and Vs_Chr6_49209793-R. Other components of the kit are conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.

[0023] The kit of this invention can rapidly identify the low-temperature tolerance of *Vaccaria spp.* and its related genotypes. The specific method follows the steps for identifying whether *Vaccaria spp.* exhibits high or low temperature tolerance. Electrophoresis of the PCR amplification products is performed. If the PCR amplification product shows only one characteristic band of 264 bp (as shown in SEQ ID NO.4), the *Vaccaria spp.* has a low low-temperature tolerance genotype; if the PCR amplification product shows only one characteristic band of 223 bp (as shown in SEQ ID NO.4), the *Vaccaria spp.* has a high low-temperature tolerance genotype.

[0024] The present invention has the following advantages:

[0025] (1) The inventors of this invention screened out a molecular marker Vs_Chr6_49209793 that is related to the low temperature tolerance of arrow pea. This molecular marker is located on chromosome 6. Using the molecular marker Vs_Chr6_49209793 of this invention, the low temperature tolerance of arrow pea can be quickly and accurately identified.

[0026] (2) Using markers related to low temperature tolerance for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0027] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be easily, quickly and with high throughput applied to the selection and identification of arrow peas with high low temperature tolerance. Attached Figure Description

[0028] Figure 1 The genome-wide association analysis results related to low-temperature tolerance in arrowhead peas are obtained from a Manhattan plot based on EMMAX software. The green dots indicate the InDel positions associated with this invention.

[0029] Figure 2 This is a box plot showing the distribution of the low-temperature tolerance trait corresponding to the genotype at the Vs_Chr6_49209793 locus in the *Vallisneria natans* population in Example 1 of this invention. 0 / 0 indicates that the genotype at the Vs_Chr6_49209793 locus is homozygous with low low-temperature tolerance, and 1 / 1 indicates that the genotype at the Vs_Chr6_49209793 locus is homozygous with high low-temperature tolerance; the dots represent extreme values ​​of the data, and Wilcox tests were used to determine the differences.

[0030] Figure 3 This is a partial sequence alignment result of materials with high and low temperature tolerance in the region associated with low temperature tolerance.

[0031] Figure 4 Electrophoresis images of molecular markers amplified from 16 *Vaccinium bracteatum* germplasm resources, using agarose gels with a concentration of 2.5%. In the image, M represents the DNA marker. Detailed Implementation

[0032] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0033] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0035] Example 1: Development of molecular markers related to low-temperature tolerance in arrowhead peas

[0036] This invention determined the low-temperature tolerance traits of *Vicia sativa* at the initial flowering stage. After measuring the ion permeability of the *Vicia sativa* population under low-temperature stress (-20℃, 1 h; 4℃, 12 h), a genome-wide association study (GWAS) was performed to locate an InDel site in *Vicia sativa*. Figure 1 The green locus, named Vs_Chr6_49209793, is located at locus 32690092 on chromosome 6 of the *Vaccinium bracteatum* reference genome. The first allele is genotype 0 / 0, and the second allele is genotype 1 / 1. A box plot showing the distribution of cold tolerance traits corresponding to the genotypes at locus Vs_Chr6_49209793 in the population is shown. Figure 2 This indicates that the low-temperature tolerance of *Vicia sativa* genotype 0 / 0 is significantly lower than that of *Vicia sativa* genotype 1 / 1. An insertion / deletion fragment CCCACAAATATTAAAGGAACCAACTAACATTATACATCTCA (shown in SEQ ID NO. 3) is present at locus 49209793 on chromosome 6 of *Vicia sativa*. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the low-temperature tolerance of arrow-shaped peas. Arrow-shaped peas with the fragment shown in SEQ ID NO.3 have low low-temperature tolerance, while arrow-shaped peas without the fragment shown in SEQ ID NO.3 have high low-temperature tolerance.

[0037] Based on the InDe1 variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0038] Vs_Chr6_49209793-F: AACTCATGACATGAGTTGTAAACTAATAG (as shown in SEQ ID NO.1);

[0039] Vs_Chr6_49209793-R: CAACAATCTAGGAATGATGCACTG (as shown in SEQ ID NO.2).

[0040] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of homozygous arrowhead pea samples with low cold tolerance had only a characteristic band of 264 bp, while the PCR product of homozygous arrowhead pea samples with high cold tolerance had a characteristic band of 223 bp.

[0041] Example 2: Accuracy verification of the molecular markers described in this invention

[0042] 217 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2:

[0043] Table 2. Ion permeability of 217 germplasm materials and their corresponding genotypes at the Vs_Chr6_49209793 locus.

[0044]

[0045]

[0046]

[0047]

[0048] 1) Using the genomic DNA of the arrowhead pea to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0049] The PCR amplification reaction system is as follows: template DNA 10–264 ng, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, 2×Taq PCR Master Mix 5 μL, and deionized water to a final volume of 10 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 53.5℃ annealing for 30 s, 72℃ extension for 6 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃. Separation is performed by electrophoresis on a 2.5% agarose gel. After loading, the samples are electrophoresed at 125V, 400mA DC for 25 min, and the PCR banding patterns of each sample are then read.

[0050] 2) Determine the low-temperature tolerance of arrowhead peas based on the size of the PCR products:

[0051] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the *Vaccaria spp.* to be identified, the band length of the PCR product is 264 bp (SEQ ID NO.4), then the *Vaccaria spp.* to be identified is a *Vaccaria spp.* with low cold tolerance.

[0052] The sequence of SEQ ID NO.4 is as follows:

[0053]

[0054] When the PCR product of the arrowhead pea to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 223bp (SEQ ID NO.5), then the arrowhead pea to be identified is an arrowhead pea with high low temperature tolerance.

[0055] The sequence of SEQ ID NO.5 is as follows:

[0056]

[0057] Furthermore, Table 2 shows that among the 217 *Viburnum cuspidatum* germplasm accessions identified in this study, 198 accessions had a genotype of 0 / 0 at the Vs_Chr6_49209793 locus, and their average ion permeability was 0.682, classifying them as cold-hardy *Viburnum cuspidatum*. The remaining 19 accessions had a genotype of 1 / 1 at the Vs_Chr6_49209793 locus, and their average plant ion permeability was 0.471, classifying them as cold-hardy *Viburnum cuspidatum*. Analysis of variance showed a highly significant difference in ion permeability between the cold-hardy and cold-hardy *Viburnum cuspidatum* types (P<0.01).

[0058] Select 16 germplasm samples (according to...) Figure 4 The PI numbers, from left to right, are: PI 183723', PI 284081', PI 266190', PI 340157', PI 340158', PI 204643', PI 167267', PI 173160', PI 201946', PI 220890', PI 413769', PI 413771', PI 413772', PI 308126', PI 600818', PI 121275'. PCR testing was performed, and the results corresponded consistently with the genotype at the Vs_Chr6_49209793 locus and the actual ion permeability measurements. Figure 4 Therefore, the lnDel molecular marker of the present invention can effectively identify the low-temperature tolerance of arrowhead pea and can be used for the prediction and screening of arrowhead pea materials with strong low-temperature tolerance.

[0059] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Molecular markers associated with low-temperature tolerance in arrowhead peas, characterized in that, The nucleotide sequences of the molecular marker are shown in SEQ ID NO.4 and SEQ ID NO.

5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 6 of *Pistacia chinensis*. The primer pair sequences for amplifying the molecular marker are as follows: Vs_Chr6_49209793-F:AACTCATGACATGAGTTGTAAACTAATAG; Vs_Chr6_49209793-R:CAACAATCTAGGAATGATGCACTG.

2. The application of the primer pair containing the molecular marker described in claim 1 in assisting in the identification of the low-temperature tolerance of arrowhead pea.

3. An auxiliary method for identifying the low-temperature tolerance of arrowhead peas, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and detect the PCR amplification product by electrophoresis; (3) The determination is based on the electrophoresis band results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Vs_Chr6_49209793-F and Vs_Chr6_49209793-R. If the PCR amplification product contained only one characteristic band of 264 bp as shown in SEQ ID NO.4, then *Vaccaria spp.* was a type with low cold tolerance; if the PCR amplification product contained only one characteristic band of 223 bp as shown in SEQ ID NO.5, then *Vaccaria spp.* was a type with high cold tolerance.

4. The application of a reagent kit in assisting in the identification of cold tolerance genotypes in arrowhead pea, characterized in that, The kit contains the primer pair described in claim 1, and the method for auxiliary identification of the low-temperature tolerance genotype of *Vallis fulva* using the kit is as follows: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification products have only one characteristic band of 264 bp as shown in SEQ ID NO.4, then the arrowhead pea is a genotype with low cold tolerance; if the PCR amplification products have only one characteristic band of 223 bp as shown in SEQ ID NO.4, then the arrowhead pea is a genotype with high cold tolerance.

Images