A mao-jabbar albumin nanoparticle targeting esophageal cancer and a preparation method and application thereof

Abstract

The present application relates to a kind of targeting esophageal cancer's Mao Lan Su albumin nanoparticle and preparation method, application, belong to biopharmaceuticals.The Mao Lan Su albumin nanoparticle includes delivery carrier and the drug composition loaded in the delivery carrier, the drug is Mao Lan Su, the delivery carrier includes nucleic acid aptamer and albumin is made by coupling reaction.The particle size of the Mao Lan Su albumin nanoparticle is 100-200nm.The drug loading rate of the Mao Lan Su albumin nanoparticle is 11-19%, and the encapsulation efficiency is 69-81%.The present application utilizes thiol-modified nucleic acid aptamer to occur coupling reaction with albumin by linker molecule, generates delivery carrier, and utilizes the delivery carrier to load Mao Lan Su, to further improve the solubility and bioavailability of Mao Lan Su, so that Mao Lan Su reaches targeted drug delivery, the effect of slow-release drug, for the treatment of esophageal cancer, improve the efficacy of drug.

Description

TECHNICAL FIELD

[0001] The present application belongs to biopharmaceuticals, and particularly relates to a maomycin albumin nanoparticle targeting esophageal cancer, a preparation method and application thereof. BACKGROUND

[0002] Esophageal cancer (EC) is one of the most common malignant tumors in the digestive system. At present, surgical resection, radiotherapy, chemotherapy and molecular targeted therapy are the main clinical treatment methods for esophageal cancer. However, due to the existence of treatment resistance, many EC patients cannot benefit from drug or radiotherapy, ultimately leading to poor prognosis. Although there are many treatment methods for esophageal cancer, the treatment of esophageal cancer still faces great challenges. Therefore, it is urgent to develop new potential candidate drugs for treating esophageal cancer.

[0003] Aptamer is a single-stranded oligonucleotide screened from a random sequence DNA or RNA library, which has the characteristics of low molecular weight, low immunogenicity, low toxicity, high affinity and specificity. Aptamer is widely used in biosensing and biomedical fields due to these characteristics, and has great potential in cancer diagnosis and treatment.

[0004] In human plasma, albumin is the most abundant protein, which has good histocompatibility and no immunogenicity. Albumin can interact with receptors overexpressed in many diseased tissues and cells, and has a long half-life. Protein nanoparticles have good biocompatibility and biodegradability, and multiple functional groups can be connected to target groups. Abraxane, an anti-tumor drug based on albumin, has been widely used in clinical practice. At present, albumin has become a promising carrier for delivering anti-cancer drugs.

[0005] The orobanchin isolated from Dendrobium chrysostoxum has various pharmacological activities, such as anti-inflammatory, antibacterial, antiviral, antitumor, anti-retinopathy and the like. In recent years, more and more evidences prove that orobanchin has a therapeutic effect on various cancers, and the anti-tumor mechanism thereof includes induction of cell apoptosis, blockage of cell cycle, influence on cell invasion, migration and vascular autophagy and the like. However, orobanchin has poor water solubility, low bioavailability and poor targeting, which hinders the clinical transformation. Orobanchin has certain anti-tumor activity in vitro, but cannot efficiently reach the tumor site in vivo, or after reaching the tumor site, has certain killing effect on the surrounding normal cells while inhibiting the tumor cells. In other words, orobanchin has no selectivity to tumor cells and cannot specifically inhibit tumor cells. The tumor-targeted drug delivery technology provides a method for improving the targeting of orobanchin and reducing the toxic side effects. The specific targeting molecules targeting tumor cells are modified on the drug, so that the drug can be specifically delivered to the tumor site, the drug efficacy is improved, and the adverse reactions are reduced. In addition, the nano-targeted drug delivery system provides a potential strategy for improving the solubility and bioavailability of the drug. Therefore, it has great research significance to develop an orobanchin nano-targeted drug for targeting esophageal cancer by using albumin with good biocompatibility and cell internalization efficiency and aptamer with specificity and high affinity to tumor cells as a targeting molecule. SUMMARY

[0006] In view of the above problems, the present application provides an orobanchin albumin nanoparticle for targeting esophageal cancer and a preparation method and application thereof. The orobanchin albumin nanoparticle for targeting esophageal cancer is prepared by effectively loading orobanchin into AS1411-albumin, and AS1411 specifically targets nucleolin on esophageal cancer cells, so that the drug-loaded nanoparticles specifically target esophageal cancer cells and reduce the toxic side effects on normal tissues, thereby providing a safe and effective treatment for esophageal cancer.

[0007] A first object of the present application is to provide an orobanchin albumin nanoparticle for targeting esophageal cancer, which comprises a delivery carrier and a drug loaded on the delivery carrier, the drug is orobanchin, and the delivery carrier comprises a nucleic acid aptamer and albumin prepared by coupling reaction.

[0008] Further, the nucleic acid aptamer is one of AS1411, EGFR and HER2, and the albumin is bovine serum albumin or human serum albumin.

[0009] Further, the particle size of the orobanchin albumin nanoparticle is 100-200 nm.

[0010] Further, the drug loading rate of the orobanchin albumin nanoparticle is 11-19%, and the encapsulation rate is 69-81%.

[0011] The second object of the present application is to provide a preparation method of the maitansine albumin nanoparticle targeting esophageal cancer, which is the maitansine albumin nanoparticle as described above, comprising:

[0012] The thiol-modified nucleic acid aptamer is coupled with the albumin through the linker molecule to prepare a delivery carrier, and the delivery carrier is resuspended with a PBS buffer solution to obtain a solution containing the delivery carrier;

[0013] The solution containing the delivery carrier and an ethanol solution of maitansine are mixed to prepare a first mixed solution, and then a glutaraldehyde solution is added under stirring to prepare the maitansine albumin nanoparticle.

[0014] Further, the specific operation of the coupling reaction is as follows:

[0015] After the linker molecule, the albumin and the PBS buffer solution are mixed, the reaction is carried out under ice water bath and stirring for 3-6 h, and the second reaction solution is obtained by centrifugation and resuspension with the PBS buffer solution;

[0016] The aqueous solution of the nucleic acid aptamer and the solution of the thiol reducing agent are mixed, and the third reaction solution containing the thiol-modified nucleic acid aptamer is obtained by reacting under ice bath and stirring for 20-80 min;

[0017] The second reaction solution and the third reaction solution are mixed, and the delivery carrier is obtained by centrifugation after reacting under ice bath and stirring for 10-24 h, and the delivery carrier is resuspended with the PBS buffer solution to obtain the solution containing the delivery carrier.

[0018] Further, the mass ratio of the linker molecule to the albumin is 2.5-3.5:40, and the stirring speed during the preparation of the second reaction solution is 50-100 rpm;

[0019] The linker molecule is 4-(N-maleimide methyl) cyclohexane-1-carboxylic acid sulfonic succinimidyl ester sodium salt;

[0020] The molar ratio of the nucleic acid aptamer to the thiol reducing agent is 1:70000-85000;

[0021] The stirring speed during the preparation of the third reaction solution is 50-100 rpm, and the molar ratio of the linker molecule to the nucleic acid aptamer is 6000-7200:1.

[0022] Further, before the glutaraldehyde solution is added under stirring, the method further comprises:

[0023] The first mixed solution is added dropwise to the PBS solution under stirring, and the obtained mixed solution is continuously ultrasonically mixed for 15-30 min after the dropwise addition is completed.

[0024] Further, the mass ratio of the delivery carrier to the maitansine is 10:1-3; the stirring speed in the process of preparing the maitansine albumin nanoparticle by stirring reaction is 500-700 rpm, and the stirring temperature is 30-40 DEG C; the molar ratio of the glutaraldehyde to the aptamer is 1-2:1, and the mass concentration of the glutaraldehyde solution is 0.5-1%;

[0025] The stirring speed of the first mixed solution added dropwise into the PBS solution is 500-700 rpm, and the stirring temperature is 30-40 DEG C.

[0026] The third object of the present application is to provide the application of the above-mentioned maitansine albumin nanoparticle for targeting esophageal cancer in tumor treatment.

[0027] The beneficial effects of the present application are:

[0028] The maitansine albumin nanoparticle for targeting esophageal cancer provided by the present application and the preparation method and application have the following effects:

[0029] Firstly, the thiol-modified aptamer is coupled with albumin through a linker molecule to generate a delivery carrier, and the delivery carrier is used to load maitansine, thereby improving the solubility and bioavailability of maitansine, achieving targeted drug delivery of maitansine, and achieving the effect of controlled release of drugs for the treatment of esophageal cancer and improving the efficacy of drugs.

[0030] Secondly, the aptamer (AS1411, EGFR, HER2) selected in the present application can target tumor tissues, specifically recognize tumor cells, and has high binding capacity with tumor cells, so that the drug can be specifically enriched in tumor tissues, improve the residence time of the drug in the tumor site, and prolong the half-life of the drug.

[0031] Thirdly, the maitansine albumin nanoparticle prepared by the preparation method has a particle size of 100-200 nm, a drug loading rate of 11-19%, and an encapsulation rate of 69-81%.

[0032] Finally, the maitansine albumin nanoparticle can be made into various preparations for treating esophageal cancer, can target and kill esophageal cancer cells, has no obvious damage to normal tissues, and reduces the toxic and side effects.

[0033] Other features and advantages of the present application will be set forth in the following description, and in part will become apparent to those skilled in the art from the description, or can be learned by practice of the present application. The objects and other advantages of the present application can be achieved and obtained by the structures indicated in the specification, claims and drawings. BRIEF DESCRIPTION OF DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings required by the embodiments or prior art description will be briefly introduced. Obviously, the accompanying drawings in the following description are some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor.

[0035] Figure 1 Fig. 1 shows the characterization results of AS1411-BSA@ERN nanoparticles according to an embodiment of the present application;

[0036] Figure 2 Fig. 2 shows the analysis results of the affinity activity of AS1411-BSA and esophageal cancer cells according to an embodiment of the present application;

[0037] Figure 3 Fig. 3 shows the analysis of the uptake capacity of esophageal cancer cells for AS1411-BSA according to an embodiment of the present application;

[0038] Figure 4 Fig. 4 shows the analysis of the mechanism of esophageal cancer cells taking up AS1411-BSA conjugates by flow cytometry and laser confocal experiments according to an embodiment of the present application;

[0039] Figure 5 Fig. 5 shows the analysis of the biodistribution of AS1411-BSA in nude mice according to an embodiment of the present application;

[0040] Figure 6 Fig. 6 shows the analysis of the effect of AS1411-BSA@ERN on the proliferation of esophageal cancer cells in vitro according to an embodiment of the present application;

[0041] Figure 7 Fig. 7 shows the analysis of the effect of AS1411-BSA@ERN and ERN on cell apoptosis and ROS generation according to an embodiment of the present application. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present application. Obviously, the described embodiments are some embodiments of the present application, but not all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0043] A preparation method of a porphyrin albumin nanoparticle for targeting esophageal cancer according to an embodiment of the present application, characterized in that it comprises:

[0044] Step one: the thiol-modified aptamer is coupled with albumin through a linker molecule to prepare a delivery carrier, and the delivery carrier is resuspended in a PBS buffer solution to obtain a solution containing the delivery carrier;

[0045] Step two: the solution containing the delivery carrier and an ethanol solution of maitaux are mixed to prepare a first mixed solution, and then a glutaraldehyde solution is added under stirring to prepare maitaux albumin nanoparticles.

[0046] In step one of some embodiments of the present application, the specific operation of the coupling reaction is as follows:

[0047] i. After mixing the linker molecule, albumin and PBS buffer solution, the reaction is carried out under ice water bath and stirring for 3-6 h, and then the second reaction solution is obtained by centrifugation and resuspension in a PBS buffer solution;

[0048] ii. The aqueous solution of the aptamer and the solution of the thiol reducing agent are mixed and reacted under ice bath and stirring for 20-80 min to obtain a third reaction solution containing the thiol-modified aptamer;

[0049] iii. The second reaction solution and the third reaction solution are mixed and reacted under ice bath and stirring for 10-24 h, and then the delivery carrier is obtained by centrifugation and resuspension in a PBS buffer solution to obtain a solution containing the delivery carrier.

[0050] In step i of some embodiments of the present application, the albumin is bovine serum albumin (abbreviated as BSA) or human serum albumin;

[0051] In step i of some embodiments of the present application, the mass ratio of the linker molecule to albumin is 2.5-3.5:40, and the stirring speed during the preparation of the second reaction solution is 50-100 rpm;

[0052] The linker molecule is 4-(N-maleimide methyl) cyclohexane-1-carboxylic acid sulfonic succinimidyl ester sodium salt, which is abbreviated as Sulfo-SMCC.

[0053] In step ii of some embodiments of the present application, the molar ratio of the aptamer to the thiol reducing agent is 1:70,000-85,000;

[0054] The aptamer is one of AS1411, EGFR and HER2,

[0055] The AS1411 is a 26-mer DNA aptamer with G-quadruplex structure, which is commonly known as anti-nucleolin aptamer, and can specifically bind to the overexpressed target nucleolin receptor on cancer cells, and the sequence is 5'-SH-AAAAAA-GGTGGTGGTGGTTGTGGTGGTGGTGG-3'.

[0056] the sequence of the EGFR is 5'-SH-TACCAGTGCGATG CTCAGTGCCGTTTCTTCTCTTTCGCTTTTTTTGCTTTTGAGCATGCTGACGCATTCGGTTGAC;

[0057] the sequence of the HER2 is 5'-SH-GCAGCGGTGTGGGGGCAG CGGTGTGGGGGCAGCGGTGTGGGG;

[0058] the thiol-based reducing agent is TCEP (an abbreviation of tris(2-carboxyethyl)phosphine);

[0059] the stirring speed in the process of obtaining the third reaction solution is 50-100 rpm,

[0060] in step iii of some embodiments of the present application, the mixing of the second reaction solution and the third reaction solution is performed according to a molar ratio of the linker molecule to the aptamer of 6000-7200:1.

[0061] in some embodiments of the present application, the mixing of the solution containing the delivery carrier and the ethanol solution of mithramycin is performed according to a mass ratio of the delivery carrier to the mithramycin of 10:1-3;

[0062] the molar ratio of the glutaraldehyde to the aptamer is 1-2:1;

[0063] the stirring speed in the process of preparing the mithramycin-albumin nanoparticle by stirring reaction is 500-700 rpm, and the stirring temperature is 30-40℃; the mass concentration of the glutaraldehyde solution is 0.5-1%.

[0064] in another certain embodiments of the present application, in step ii, before the subsequent stirring and the addition of the glutaraldehyde solution, the process further comprises:

[0065] step x. the first mixed solution is added dropwise into the PBS solution under stirring, and after the completion of the dropwise addition, the obtained mixture is continuously ultrasonically mixed for 15-30 min.

[0066] in another certain embodiments of the present application, in step x, the stirring speed of the dropwise addition of the first mixed solution into the PBS solution is 500-700 rpm, and the temperature is 30-40℃;

[0067] the ultrasonic condition is ultrasonic treatment under 100-120 W, and during the ultrasonic treatment, the ultrasonic treatment is performed for 5 s and stopped for 5 s.

[0068] The particle size of the maitansine albumin nanoparticle prepared by the preparation method of the maitansine albumin nanoparticle for targeting esophageal cancer provided in the above embodiment is 100-200 nm.

[0069] Example 1

[0070] This embodiment exemplarily shows the preparation process of the maitansine albumin nanoparticle, and obtains a delivery carrier and a maitansine albumin nanoparticle, wherein the aptamer in the delivery carrier is AS1411, the albumin is BSA, the abbreviation of the delivery carrier is AS1411-BSA, and the abbreviation of the maitansine albumin nanoparticle is AS1411-BSA@ERN, and the process is specifically as follows:

[0071] 1.1 Preparation of AS1411-BSA carrier

[0072] ① 40 mg of BSA and 2.88 mg of Suflo-SMCC were dissolved in 6 mL of PBS, and reacted on a shaker (65 rpm) under ice bath conditions for 4 h.

[0073] ② After the reaction, the liquid was placed in an ultrafiltration tube (MWCO, 30 kDa), centrifuged at 12000 rpm for 15 min, and then taken out and resuspended with 2 mL of PBS.

[0074] ③ 10 μL of AS1411 aqueous solution with a concentration of 100 μM was added to 1490 μL of pure water, and 100 μL of 800 mM TCEP solution was added, and reacted on a shaker (65 rpm) under ice bath conditions for 30 min to fully expose the thiol group.

[0075] ④ The liquids of steps ② and ③ were mixed, and reacted on a shaker (100 rpm) under ice bath conditions overnight.

[0076] ⑤ After the reaction, the liquid of step ④ was placed in an ultrafiltration tube (MWCO, 30 kDa), centrifuged at 12000 rpm for 15 min, and then resuspended with 6 mL of PBS.

[0077] 1.2 Preparation of AS1411-BSA@ERN

[0078] ① 2.5 mg of ERN (the abbreviation of maitansine) was dissolved in 1 mL of anhydrous ethanol, and 0.8 mL was taken for standby.

[0079] ② The solution containing 10 mg of AS1411-BSA was dissolved in 0.8 mL of ERN ethanol solution.

[0080] iii. Add 5 mL PBS in a conical flask and place on a magnetic stirrer (37°C, 600 rpm). Slowly drop the solution from step ii. into the 5 mL PBS drop by drop (at a constant speed of 2 mL / min).

[0081] iv. Use a probe sonicator to sonicate the mixture solution at 100 W for 20 min (5 s on, 5 s off).

[0082] v. To stabilize the nanoparticles, add 20 μL of 0.8% glutaraldehyde solution (diluted with pure water) and continue stirring at 37°C, 600 rpm for 8 h.

[0083] Place the mixed solution in a vacuum desiccator to remove the organic solvent.

[0084] Centrifuge the resulting solution at 12000 rpm for 15 min to precipitate the AS1411-BSA@ERN nanoparticles. Then suspend the AS1411-BSA@ERN nanoparticles in 6 mL of PBS and store at 4°C for further use (or at -80°C for long-term storage).

[0085] Physical property test:

[0086] I. Agarose gel electrophoresis method to detect the coupling of AS1411-BSA and characterize the DNA band presented by the drug-loaded nanoparticles:

[0087] 1. Weigh 0.25 g of agarose into a 50 mL conical flask, add 25 mL of 1x TAE electrophoresis buffer solution. Shake well, heat in a microwave oven to dissolve.

[0088] 2. When the gel cools to about 50°C, add 2.5 μL of SuperRed nucleic acid dye, shake gently to avoid air bubbles, pour into the gel chamber, insert the comb, and pull out the comb after cooling and solidifying at room temperature.

[0089] 3. Place the gel in the electrophoresis tank, add 1x TAE electrophoresis buffer to cover the gel by 1-2 mm.

[0090] 4. Use a pipette to transfer 5 μL of AS1411, AS1411-BSA, AS1411-BSA@ERN, and BSA solutions into EP tubes, respectively, then add 1 μL of 6x DNA loading buffer, mix them on the ice box with the gun head, and carefully add them to the sample well.

[0091] 5. Turn on the power switch, adjust the voltage to 120 V, and run the electrophoresis for 35 min.

[0092] 6. After electrophoresis, the gel was taken out and placed in a Tanon-1600 Gel Image system to observe the DNA bands.

[0093] II. Determination of the encapsulation efficiency and drug loading of AS1411-BSA@ERN by high performance liquid chromatography

[0094] Chromatographic conditions: mobile phase: acetonitrile: 0.05% phosphoric acid = 37:63; detection wavelength: 230 nm; flow rate: 1.0 mL / min; column temperature: 25°C; flow rate 1.0 mL / min; injection volume: 10 μL. The standard curve was linear in the range of 0-0.4 mg / mL, with a correlation coefficient R 2 = 0.998.

[0095] The encapsulation efficiency and drug loading of the drug were calculated by the following formula, and the total nanoparticle mass was the mass of the nanopowder after lyophilization.

[0096] EE = (Total ERN added-unencapsulated ERN) / (Total ERN added) x 100%

[0097] DL= (Total ERN added-unencapsulated ERN) / (Total nanoparticles) x 100%

[0098] III. Determination of the particle size and zeta potential of drug-loaded nanoparticles

[0099] The Malvern Nano ZS90 dynamic light scattering instrument was turned on and preheated for 30 min.

[0100] The AS1411-BSA@ERN solution was filtered using a 0.22 μm filter and then ultrasonicated for 30 min.

[0101] 1 mL of the AS1411-BSA@ERN solution was taken into the particle size sample cell and the potential cell, respectively.

[0102] The particle size and zeta potential of AS1411-BSA@ERN were determined at 25°C.

[0103] IV. In vitro drug release determination

[0104] 1. The dialysis bag (MWCO, 14 kDa) was placed in boiling water and boiled for 20 min to activate it, and then water was added to the dialysis bag to observe whether it leaked.

[0105] 2. 2 mL of ERN-loaded nanoparticles (containing 2.5 mg of ERN) were taken and placed in the dialysis bag.

[0106] 3. The dialysis bag is clamped at both ends with dialysis bag clamps, and the excess part is cut off.

[0107] 4. A PBS (pH 7.2) solution containing 0.1% Tween 80 is placed in a conical flask, and then the dialysis bag is placed in the conical flask so as to be immersed in the PBS.

[0108] 5. The dialysis bag is placed in a constant temperature shaker under the condition of 37°C and 100 rpm.

[0109] 6. At different time points (0 h, 2 h, 3 h, 4 h, 5 h, 7 h, 9 h, 12 h, 24 h, 36 h, 48 h), 1 mL of the release medium is taken out and 1 mL of PBS is added. Subsequently, the amount of drug released at each time point is determined by the HPLC method, and a drug release curve is drawn. The calculation formula of drug release is: Drug release (%) = M1 / M0 x 100%, wherein M1 is the mass of the released drug, and M0 is the total mass of the drug in the nanoparticles.

[0110] Five, analysis of the in vitro binding ability of AS1411-BSA and esophageal cancer cells

[0111] (I) Culture of esophageal cancer cells

[0112] This test intends to use human esophageal cancer cell lines KYSE520, KYSE150, KYSE70, EC109, ECA109 as the research object. The human esophageal cancer cell lines are cultured in RPMI-1640 medium containing 10% fetal bovine serum and adding 1% double-antibiotic (100 U / mL ampicillin, 100 μg / mL streptomycin). All cells are cultured in a cell incubator at 37°C, 5% CO2. The growth state of the cells is observed under a microscope, and when the cell confluence reaches 80% to 90%, the original cell culture medium is discarded, washed with PBS, and then an appropriate volume of 0.25% trypsin is added for digestion, centrifuged at 1500 rpm for 5 min, washed with PBS, and then subcultured or stored.

[0113] (II) Flow cytometry detection of the binding ability of Cy5-AS1411-BSA and esophageal cancer cells

[0114] 1. KYSE520, KYSE70, EC109, ECA109 esophageal cancer cells in the logarithmic growth phase were taken, centrifuged, and washed for standby.

[0115] 2. Different groups were set for each strain of esophageal cancer cells, and 3 x 10 5Cells were resuspended in 2 mL PBS. 5 Cells were resuspended in 2 mL PBS.

[0116] 3. After mixing, the samples were ice-bathed for 4 h in the dark.

[0117] 4. After filtration with a 200-mesh nylon screen, the samples were detected by flow cytometry.

[0118] (Three) Laser confocal detection of the binding ability of Cy5-AS1411-BSA and esophageal cancer cells

[0119] 1. KYSE520, EC109, KYSE150 cells were seeded in 8-well chamber slides at a cell density of 3x10 4 -4x10 4 cells / well and cultured for 24 h.

[0120] 2. 0.1 mg / mL CY5-labeled AS1411-BSA was added to each well and incubated at 37°C for 4 h.

[0121] 3. Discard the liquid in the 8-well chamber slides.

[0122] 4. Fix the cells with 200 μL of 4% paraformaldehyde in the dark for 20 min.

[0123] 5. Add an anti-fluorescence quencher and react at room temperature in the dark for 15 min.

[0124] 6. Observe and photograph under laser confocal (200x).

[0125] Six, Study on the mechanism of esophageal cancer cell uptake of AS1411-BSA

[0126] (One) Flow cytometry evaluation of the uptake channel involved in the uptake of AS1411-BSA by esophageal cancer cells

[0127] 1. KYSE520 and EC109 cells were seeded in 6-well plates at a cell density of 5x10 5 -6x10 5 cells / well and cultured for 24 h.

[0128] 2. After 24 h, different groups were set for each cell, and 1 mL of complete medium solution containing 200 μM genistein, 30 μM chlorpromazine, 80 μM EIPA and 2.5 mM methyl-β-cyclodextrin was added to the corresponding cells in different groups, and the control group contained only complete medium, which was incubated at 37°C for 1 h.

[0129] 3. The culture solution was discarded, and CY5-labeled AS1411-BSA (0.1 mg / mL) was added to different groups of KYSE520 cells, and 0.4 mg / mL was added to different groups of EC109 cells, which were incubated at 37°C for 4 h.

[0130] 4. The cells were collected by digestion, centrifugation and washing, and then resuspended in 1 mL of PBS.

[0131] 5. After filtration with a 200-mesh nylon screen, the cells were detected on a flow cytometer.

[0132] The percentage of cell uptake in each group was calculated according to the formula: Relative Cellular uptake (%) = MFI (with inhibitor group) / MFI (without inhibitor group) x 100%.

[0133] (II) Laser confocal verification of the uptake mode of esophageal cancer cells to AS1411-BSA

[0134] 1. KYSE520 and EC109 cells were seeded in an 8-well chamber cover glass at a cell density of 1 x 10 5 cells / well and cultured for 24 h.

[0135] 2. After 24 h, the cells were grouped, and 1 mL of 200 μM genistein, 30 μM chlorpromazine, 80 μM EPIA and 2.5 mM methyl-β-cyclodextrin were added to the corresponding cells in each group, and the control group did not contain inhibitors, which was incubated at 37°C for 1 h.

[0136] 3. The culture solution was discarded, and CY5-labeled AS1411-BSA (0.1 mg / mL) was added to different groups of KYSE520 cells, and 0.4 mg / mL was added to different groups of EC109 cells, which were incubated at 37°C for 4 h.

[0137] 4. The liquid in the 8-well chamber cover glass was discarded, and the cells were washed with PBS three times at room temperature in the dark.

[0138] 5. The cells were fixed with 200 μL of 4% paraformaldehyde for 20 min in the dark.

[0139] 6. The cells were washed with PBS three times for 3 min each time in the dark.

[0140] 7. Cover the slide after adding DAPI-containing anti-fluorescence quenching agent and reacting for 15 min at room temperature in the dark.

[0141] 8. Observe and take photos under laser confocal microscopy and record whether esophageal cancer cells have taken up AS1411-BSA through the above-mentioned uptake.

[0142] Seven, in vivo targeting analysis of AS1411-BSA

[0143] (I) Targeted enrichment analysis of Cy5-AS1411-BSA

[0144] Digest and PBS-wash the cultured human esophageal cancer cells KYSE520 and EC109, resuspend the cells in PBS, count, and inoculate 5x10 6 cells / 0.2 mL into the axillary subcutis of female BALB / c nude mice with a body weight of 18-20 g, and when the tumor volume grows to about 600 mm 3 (the volume size calculation formula is V=ab 2 / 2 (a: tumor long diameter, b: tumor short diameter), inject CY5-labeled AS1411-BSA (20 mg / kg) into the nude mice through the tail vein, and observe the fluorescence imaging using a small animal live (Tanon) imaging instrument. At different time points, observe the fluorescence distribution of AS1411-BSA in the nude mice after isoflurane anesthesia of the nude mice. After the end of the experiment, air embolism the nude mice, strip the tumor mass, and take out the heart, liver, spleen, lung, and kidney and place them in the small animal live imaging system for fluorescence imaging of the ex vivo organs.

[0145] (II) Fluorescence enrichment analysis of tumor tissue sections

[0146] 1. Place the collected tumor tissue in 4% paraformaldehyde and store at room temperature for three days.

[0147] 2. Embed the tissue after culturing in a 30% sucrose solution for 6 h

[0148] 3. Place the slide in PBS (pH 7.4) and shake-wash on a decolorizing shaker for 3 times, 5 min each time. Add DAPI staining solution, incubate at room temperature in the dark for 10 min.

[0149] 4. Place the slide in PBS (pH 7.4) and shake-wash on a decolorizing shaker for 3 times, 5 min each time. Add anti-fluorescence quenching mounting medium for mounting.

[0150] 5. Observe and take photos under laser confocal microscopy (200x).

[0151] Eight, in vitro anti-esophageal cancer activity and mechanism of AS1411-BSA@ERN

[0152] (I) CCK-8 method was used to detect the killing activity of ERN and AS1411-BSA@ERN on tumor cells.

[0153] 1. The esophageal cancer cell lines KYSE520, EC109 and KYSE150 in logarithmic growth phase were taken, digested, centrifuged and washed.

[0154] 2. After counting, the cells were inoculated in 96-well plates at a density of 4000 cells per well, and 100 μL of complete culture medium was added to each well. Blank group (only containing complete culture medium group) and control group (without drug group) were set.

[0155] 3. The cells were incubated in a 37℃ cell incubator for 24 h.

[0156] 4. After 24 h of culture, ERN and AS1411-BSA@ERN were added to the corresponding wells at the same concentration gradient. The concentration gradient of ERN and AS1411-BSA@ERN acting on KYSE520 and KYSE150 was 240 nM, 120 nM, 60 nM, 30 nM, 15 nM and 0 nM. The concentration gradient acting on EC109 cells was 960 nM, 480 nM, 240 nM, 120 nM, 60 nM, 30 nM and 0 nM.

[0157] 5. After 48 h of culture, 10 μL of CCK-8 was added to each well, and the plate was incubated in the incubator for 1-2 h (the time was determined according to the depth of the reaction color).

[0158] 6. The 96-well plate was taken out and shaken evenly, and the absorbance value was measured at 450 nm by a microplate reader. The cell survival rate was calculated according to the following formula:

[0159] Cell survival rate = (A drug group - A blank group) / (A control group - A blank group) x 100% (A represents absorbance value), and the IC value of the drug was calculated by prism. 50

[0160] (II) Plate colony formation experiment was used to evaluate the effect of ERN and AS1411-BSA@ERN on cell colony formation

[0161] 1. The cells in logarithmic growth phase were digested, centrifuged and washed, and then inoculated in 6-well plates at a density of 1000-2000 cells per well, and 2 mL of complete culture medium was added to each well. Incubate in a 37℃ cell incubator for 24 h.

[0162] ​2. After 24 h, discard the culture solution, and add 2 mL of the corresponding ERN and AS1411-BSA@ERN complete culture medium solution (the final concentration of ERN should be consistent) to the corresponding well, and culture in a 37°C cell incubator for 48 h. The drug concentration for KYSE520 is 30 nM, and the drug concentration for EC109 is 120 nM.

[0163] 3. After 48 h, discard the drug-containing culture solution, and add fresh culture solution, and change the culture solution every day for continuous culture for 6-8 days.

[0164] 4. Observe every day, and when visible clones appear in the 6-well plate, remove the culture solution and wash with PBS for 3 times.

[0165] 5. Add 0.5 mL of 4% paraformaldehyde to fix the cells in each well for 15 min, and discard the fixing solution.

[0166] 6. Add 0.5 mL of crystal violet staining solution to each well, and stain for 20 min, and then wash off the staining solution with pure water.

[0167] 7. After drying, take a picture using a Canon EOS M50 II camera.

[0168] (Three) Calcein AM / PI staining method is used to analyze the influence of ERN and AS1411-BSA@ERN on cell survival and death.

[0169] 1. KYSE520 and EC109 cells in the logarithmic growth phase are inoculated in a 96-well plate at a cell density of 4000 cells / well for 24 h.

[0170] 2. After 24 h, add 100 μL of the corresponding ERN and AS1411-BSA@ERN (the final concentration of ERN should be consistent) to the corresponding well, and culture in a 37°C cell incubator for 48 h. The drug concentration for KYSE520 cells is 30 nM, and the drug concentration for EC109 cells is 120 nM.

[0171] 3. After 48 h, add 50 μL of Calcein AM / PI detection working solution to each well.

[0172] 4. Incubate at 37°C for 30 min, and then observe under a fluorescence microscope and take a picture (100x).

[0173] (Four) Flow cytometry is used to detect the influence of ERN and AS1411-BSA@ERN on cell apoptosis

[0174] Annexin V-FITC / PI double staining method was used to detect the effect of AS1411-BSA@ERN on the apoptosis of esophageal cancer cells by flow cytometry. The experimental data were processed by FlowJo analysis software.

[0175] 1. KYSE520 and EC109 cells were seeded in 6-well plates at a cell density of 5x10 5 -6x10 5 cells / well for 24 h.

[0176] 2. After 24 h, 2 mL of complete medium solution containing E R N and AS1411-BSA@ERN (the final concentration of E R N should be consistent) was added to each corresponding well, and incubated in a 37°C cell incubator for 48 h. The dosing concentration of KYSE520 was 30 nM, and that of EC109 was 120 nM.

[0177] 3. The cells were collected by digestion and centrifugation (the supernatant was also collected), and washed twice with PBS. The action should be gentle when blowing to prevent cell damage.

[0178] 4. The cells were resuspended with 400 μL of 1x Annexin V binding solution.

[0179] 5. Add 5 μL of Annexin V-FITC staining solution to the cell suspension, mix gently, and incubate at 2-8°C in the dark for 15 min.

[0180] 6. Add 5 μL of PI staining solution and mix gently, then incubate at 2-8°C in the dark for 5 min.

[0181] 7. The cells in the Annexin V binding buffer should not be stored for a long time, and should be immediately detected by flow cytometry.

[0182] 8. Before detection, three quality control samples of the cells to be tested must be used to set the fluorescence compensation of the flow cytometer and set the range of the cross gate. They are:

[0183] Blank tube: unstained cells, no Annexin V staining solution, no PI, only Annexin V binding buffer for voltage adjustment.

[0184] Single staining tube: stained only with Annexin V-FITC, used for compensation adjustment.

[0185] Single staining tube: stained only with PI, used for compensation adjustment.

[0186] Detection tube: the processing cells to be tested, add Annexin V-FITC, add PI, and use blank tubes and single dye tubes to adjust the voltage compensation, then obtain the required flow data, and analyze the data using flowjo flow software.

[0187] (five) Fluorescence microscope detection ERN, AS1411-BSA@ERN on the influence of intracellular reactive oxygen species level

[0188] 1. Take the KYSE520, EC109 cells in logarithmic growth phase, and inoculate 4000 cells per hole in 96 wells for 24 h.

[0189] 2. After 24 h, add 100 μL of corresponding ERN and AS1411-BSA@ERN (the final concentration of ERN needs to be consistent) to the corresponding hole, and incubate in 37°C cell incubator for 48 h. The drug concentration of KYSE520 cells is 30 nM, and the drug concentration of EC109 cells is 120 nM.

[0190] 3. Dilute DCFH-DA probe with serum-free medium according to 1:1000, so that the concentration is 10 μM, 50 μL per hole is added to the corresponding hole, and incubated at 37°C for 20 min.

[0191] 4. Avoid light, wash 3 times with serum-free medium, and then take pictures under fluorescence microscope (100x).

[0192] Physical property test results:

[0193] I. Characterization of AS1411-BSA@ERN nanoparticles:

[0194] The results of agarose gel electrophoresis of free AS1411, AS1411-BSA conjugate, AS1411-BSA@ERN, and BSA are shown in Figure 1 A;

[0195] From Figure 1 A, it can be seen that the free AS1411 aptamer moves downward in the gel, and the mobility in the lane is high; compared with free AS1411, the electrophoretic speed of AS1411-BSA conjugate is slow, the downward mobility in the gel is low, and the band position is higher, which reveals that the molecular weight of the conjugate has increased compared with AS1411, indicating that AS1411 has been successfully conjugated with BSA; after the preparation of nanoparticles by encapsulating malachite green, it cannot effectively move downward in the gel, and still remains in the loading well. BSA without AS1411 modification does not show signal in the lane.

[0196] The particle size of AS1411-BSA@ERN nanoparticles was determined by dynamic light scattering (DLS) asFigure 1 Figure C shows the drug release profile of AS1411-BSA@ERN nanoparticles in PBS solution at 37℃, pH 7.2, wherein the particle size, zeta potential, PDI, encapsulation efficiency and drug loading of AS1411-BSA@ERN nanoparticles are shown in Table 1, and the data are expressed as mean ± standard deviation (n = 3);

[0197] Figure C shows the drug release profile of AS1411-BSA@ERN nanoparticles in PBS solution at 37℃, pH 7.2, wherein the particle size, zeta potential, PDI, encapsulation efficiency and drug loading of AS1411-BSA@ERN nanoparticles are shown in Table 1, and the data are expressed as mean ± standard deviation (n = 3);

[0198] Table 1

[0199]

[0200] From Figure 1 As shown in Figure C and Table 1, the particle size of AS1411-BSA@ERN is 159.3 ± 7.29 nm, the zeta potential is -14.1 ±.95 mv, and the PDI is 0.3 ± 0.10. The drug encapsulation efficiency and drug loading are 75 ± 6% and 15.3 ± 4%, respectively, as measured by HPLC method. In order to evaluate the release characteristics of ERN, the drug-loaded nanoparticles were placed in PBS solution, and the concentration of mithramycin released from the drug-loaded nanoparticles at different time points was determined by HPLC method, and the drug release profile was plotted, as shown in Figure 1 Figure C shows the drug release profile of AS1411-BSA@ERN nanoparticles in PBS solution at 37℃, pH 7.2, wherein the particle size, zeta potential, PDI, encapsulation efficiency and drug loading of AS1411-BSA@ERN nanoparticles are shown in Table 1, and the data are expressed as mean ± standard deviation (n = 3);

[0201] II. Evaluation of the affinity activity of AS1411-BSA and esophageal cancer cells:

[0202] Figure A shows the results of agarose gel electrophoresis evaluation of Cy5-modified AS1411 coupled with BSA, Figure B shows the representative fluorescence histograms measured by flow cytometry after KYSE520, KYSE70, EC109 and ECA109 esophageal cancer cells were given different concentrations of Cy5-AS1411-BSA, and Figure C shows the statistical column chart of the average fluorescence intensity (MFI) of the affinity of Cy5-AS1411-BSA and esophageal cancer cells. Figure 2 Figure 2 Figure B shows the statistical column chart of the average fluorescence intensity (MFI) of the affinity of Cy5-AS1411-BSA and esophageal cancer cells. Figure 2 Figure 2 Figure C shows the statistical column chart of the average fluorescence intensity (MFI) of the affinity of Cy5-AS1411-BSA and esophageal cancer cells.

[0203] Figure C shows the statistical column chart of the average fluorescence intensity (MFI) of the affinity of Cy5-AS1411-BSA and esophageal cancer cells. Figure 2 ​​Cy5-AS1411 was successfully conjugated to BSA as shown in Fig. 1A. 0.1 mg / mL and 1 mg / mL of CAB were incubated with each esophageal cancer cell for 4 h, as shown in Fig. 1B. Figure 2 As shown in Fig. 1B-C, each esophageal cancer cell could bind to CAB, and the fluorescence intensity gradually increased with the increase of CAB concentration, proving that CAB could bind to esophageal cancer cells in a dose-dependent manner.

[0204] III. In vitro evaluation of the uptake ability of esophageal cancer cells to AS1411-BSA

[0205] Western blot analysis of nucleolin expression levels in KYSE520, EC109, KYSE150 esophageal cancer cells Figure 3 As shown in Fig. 2A, the expression levels of nucleolin in KYSE520, EC109, KYSE150 esophageal cancer cells were quantitatively analyzed as shown in Fig. 2B. Figure 3 As shown in Fig. 2B, the laser confocal images of KYSE520, EC109, KYSE150 esophageal cancer cells incubated with 0.1 mg / mL CAB for 4 h are shown in Fig. 2C. Figure 3 As shown in Fig. 2C, Figure 3 Scale bar: 20 μm; * indicates a significant difference, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0206] From the affinity experiment, it can be seen that AS1411-BSA can bind to esophageal cancer cells. Western Bloting technology was used to detect the content of nucleolin in KYSE520, EC109, KYSE150 cells, as shown in Fig. 3A-B. Figure 3 As shown in Fig. 3A-B, among the three esophageal cancer cells, KYSE520 had the highest expression of nucleolin, EC109 was in the middle, and KYSE150 had the lowest expression of nucleolin. In order to detect whether the expression level of nucleolin is related to the degree of uptake of AS14111-BSA conjugate by cells, laser confocal was used to detect the uptake degree of CAB by KYSE520, EC109, KYSE150 cells. 0.1 mg / mL Cy5 modified AS1411-BSA was incubated with KYSE520, EC109, KYSE150 for 4 h, and then observed and photographed by laser confocal, as shown in Fig. 3C. Figure 3As shown in Fig. 2C, the uptake of AS1411-BSA was more in KYSE520 cells with high nucleolin expression, while the uptake of AS1411-BSA was less in EC109 and KYSE150 cells with relatively low nucleolin expression. The uptake of KYSE520 cells treated with CAB was significantly stronger than that of EC109 and KYSE150 cells. This indicates that the ability of esophageal cancer cells to uptake AS1411-BSA is related to the expression of nucleolin, revealing that AS1411-BSA can be specifically taken up by esophageal cancer cells.

[0207] IV. Mechanism of uptake of AS1411-BSA conjugate by esophageal cancer cells:

[0208] The macropinocytosis inhibitor amiloride (EIPA), the lipid raft inhibitor methyl-β-cyclodextrin (MβCD), the clathrin inhibitor chlorpromazine (CPZ), and the caveolin inhibitor genistein (Gen) were used to treat cells for 1 h, and then CY5-AS1411-BSA conjugate was incubated with the cells for 4 h. The pathways involved in the uptake of AS1411-BSA conjugate by KYSE520 and EC109 cells were detected by flow cytometry as shown in Fig. 2A and Fig. 2B. Figure 4 and Fig. 2B. Figure 4 and Fig. 2C.

[0209] The fluorescence quantification analysis of flow cytometry is shown in Fig. 2A and Fig. 2B. Figure 4 and Fig. 2B. Figure 4 and Fig. 2C.

[0210] The pathways involved in the uptake of AS1411-BSA conjugate by KYSE520 and EC109 cells were verified by laser confocal as shown in Fig. 2E. Figure 4 and Fig. 2E.

[0211] Figure 4 Fig. 2E: Blue represents the nucleolus stained by DAPI; red represents Cy5-AS1411-BSA; scale bar: 20 μm.

[0212] In order to explore the possible pathways through which AS1411-BSA@ERN enters cells, four inhibitors, macropinocytosis inhibitor amiloride (EIPA), lipid raft inhibitor methyl-β-cyclodextrin (MβCD), clathrin inhibitor chlorpromazine (CPZ), and caveolin inhibitor genistein (Gen), were used to explore the possible endocytosis pathways involved in the uptake of AS1411-BSA by KYSE520 and EC109 human esophageal cancer cells. First, the cells were pretreated with various inhibitors for one hour, and then CY5-AS1411-BSA conjugate was incubated with the cells for 4 hours. After digestion and washing, flow cytometry was used to determine the cell uptake level of each group. As shown in Fig. 2A and Fig. 2B. Figure 4As shown in Figure AB, in KYSE520 cells, the most significant decrease in cell uptake of the Cy5-AS1411-BSA conjugate was observed after EIPA treatment. Treatment with Gen, CPZ, and MβCD all slightly reduced the uptake of the Cy5-AS1411-BSA conjugate, indicating that AS1411-BSA primarily enters KYSE520 esophageal cancer cells via macropinocytosis, with lipid raft, clathrin, and microvesicle protein pathways being secondary pathways. In EC109 cells, as... Figure 4 As shown in the CD, the relative uptake of EC109 cells treated with CPZ and Gen was significantly reduced, indicating that AS1411-BSA was mainly taken up by EC109 esophageal cancer cells through the clathrin and vesicle protein pathways.

[0213] To validate the flow cytometry uptake results, laser confocal microscopy was used to further investigate the various pathways by which Cy5-AS1411-BSA enters KYSE520 and EC109 esophageal cancer cells. Cells were seeded on eight-well slides, treated with an inhibitor and CY5-AS1411-BSA, and then mounted with a DAPI-containing antifluorescence quencher. Observation under laser confocal microscopy revealed that the nucleoli were stained blue by DAPI, while CY5-AS1411-BSA appeared red. Figure 4 As shown in Figure E, in KYSE520 cells, the red fluorescence intensity of CY5-AS1411-BSA in cells treated with EIPA was significantly reduced; the red fluorescence intensity of cells treated with Gen, CPZ, and MβCD was also slightly reduced, indicating that AS1411-BSA mainly enters KYSE520 esophageal cancer cells via macropinocytosis, with lipid raft, clathrin, and microvesicle protein pathways being secondary pathways. In EC109 cells, as... Figure 4 As shown in Figure E, the red light intensity of CY5-AS1411-BSA cells treated with CPZ and Gen was significantly reduced, while the red light intensity of cells treated with EIPA and MβCD remained almost unchanged. This indicates that AS1411-BSA mainly enters EC109 esophageal cancer cells via the clathrin and caveolin pathways.

[0214] V. In vivo imaging analysis of small animals to determine the target distribution of AS1411-BSA in vivo:

[0215] Representative fluorescence images of EC109 and KYSE520 cell xenografts in nude mice at specific time points following tail vein injection of 20 mg / kg Cy5-AS1411-BSA are shown below. Figure 5 As shown in A;

[0216] The fluorescence signals of tumor tissues and main organs of EC109 and KYSE520 cell xenograft nude mice were imaged ex vivo after administration of Cy5-AS1411-BSA for 408 h (1, 2, 3, 4, 5, and 6 represent tumor, heart, liver, spleen, lung, and kidney, respectively) as shown in Figure 5 Fig. 1B (EC109 cells) and as shown in Figure 5 Fig. 1C (KYSE520 cells);

[0217] The fluorescence intensity comparison of tumor tissues of EC109 and KYSE520 cell xenograft nude mice after administration of Cy5-AS1411-BSA for 408 h is shown in Figure 5 Fig. 1D;

[0218] The fluorescence images of tumor sections observed by laser confocal microscope are shown in Figure 5 Fig. 1E;

[0219] Figure 5 Fig. 1F: Blue represents DAPI-stained nucleolus; red represents Cy5-AS1411-BSA; scale bar: 20 μm.

[0220] The tail vein of Balb / c nude mice inoculated with KYSE520 and EC109 esophageal cancer cells was injected with 20 mg / kg Cy5-AS1411-BSA conjugate, and the real-time detection of CY5-AS1411-BSA targeting distribution and enrichment in nude mice was performed by Tanon ABL X5 small animal live imaging instrument. As shown in Figure 5 Fig. 2A, Cy5-AS1411-BSA gradually enriched in the tumor site and stayed there for a long time, and still had strong fluorescence at 408 h. After the experiment, the tumor tissues and main organs of nude mice were taken out for ex vivo imaging, and it was observed that Cy5-AS1411-BSA enriched in the tumor site, and did not appear obviously in other organs, indicating that AS1411-BSA conjugate can accurately target the tumor site and reduce the toxicity to non-tumor tissues and main organs (Figs. 2B-C). Figure 5 The tumor tissues of EC109 and KYSE520 cell xenograft nude mice were observed at the same time, and the fluorescence signals were collected, and it was observed that the fluorescence intensity of KYSE520 nude mouse tumor model at the tumor site was significantly stronger than that of EC109 nude mouse tumor model at the tumor site (Fig. 2D). Figure 5 In addition, the fluorescence signal images of tumor sections were observed by laser confocal microscope as shown in Figure 5As shown in Fig. 5A, it is clearly shown that AS1411-BSA conjugate is significantly taken up by tumor cells in nude mice, and the Cy5-AS1411-BSA fluorescence signal of tumor tissue section in KYSE520 cells with high nucleolin expression is obviously stronger than that of EC109 tumor tissue, which is consistent with the results of in vitro uptake experiment. The above experimental results show that AS1411-BSA can more specifically target and penetrate into tumor tissues with high nucleolin expression, and has good in vivo specific tumor targeting ability.

[0221] VI. Evaluation of the effect of AS1411-BSA@ERN on the proliferation ability of esophageal cancer cells in vitro

[0222] The effect of AS1411-BSA@ERN on the viability of KYSE520 cells was evaluated by CCK8 experiment after 24 h and 48 h of administration as shown in Fig. 5B; Figure 6 A;

[0223] The effect of AS1411-BSA@ERN on the viability of EC109 cells was evaluated by CCK8 experiment after 24 h and 48 h of administration as shown in Fig. 5C; Figure 6 B;

[0224] The effect of ERN and AS1411-BSA@ERN on the proliferation activity of KYSE520 cells at the same concentration was evaluated by CCK8 experiment after 48 h of administration as shown in Fig. 5D; Figure 6 C;

[0225] The effect of ERN and AS1411-BSA@ERN on the proliferation activity of EC109 cells at the same concentration was evaluated by CCK8 experiment after 48 h of administration as shown in Fig. 5E; Figure 6 D;

[0226] The effect of ERN and AS1411-BSA@ERN on the proliferation activity of KYSE150 cells at the same concentration was evaluated by CCK8 experiment after 48 h of administration as shown in Fig. 5F; Figure 6 E;

[0227] The effect of ERN and AS1411-BSA@ERN on the viability of KYSE520 and EC109 esophageal cancer cells was evaluated by colony formation experiment as shown in Fig. 5G; Figure 6 F;

[0228] The Calcein-AM / PI staining processed live / dead cell fluorescence images are shown in Fig. 5H; Figure 6 G;

[0229] Figure 6 Note: Contol is the group without drug treatment.

[0230] Calcein-AM means calcein staining group, PI means propidium iodide staining group, Merge means merging fluorescent dye staining group.

[0231] IC50 of cells determined after AS1411-BSA@ERN 50 The values are shown in Table 2 (unit: nM).

[0232] Table 2

[0233]

[0234] From Figure 6 the CCK-8 experiment results shown in A-B of FIG. 1, it is shown that the cell survival rate after 48 h of AS1411-BSA@ERN administration is obviously less than that after 24 h. After 48 h of administration of ERN and AS1411-BSA@ERN, the influence of naked drug and nano-drug on the proliferation activity of KYSE520 cells, EC109 cells and KYSE150 cells at the same concentration was evaluated by CCK-8 experiment. As shown in C-E of FIG. 1, in KYSE520 cells with high nucleolin expression, the proliferation inhibition ability of AS1411-BSA@ERN on cells is stronger than that of naked drug, and the IC50 is obviously lower than that of ERN (as shown in Table 2). In esophageal cancer cells with medium and low nucleolin expression, the proliferation inhibition ability of AS1411-BSA@ERN on cells is almost equivalent to that of naked drug. It is shown that AS1411-BSA@ERN has specific targeted killing activity on esophageal cancer cells with nucleolin expression. The results of colony formation experiment are shown in F of FIG. 1, and both ERN and AS1411-BSA@ERN inhibit the colony formation of KYSE520 and EC109, and the inhibition effect of AS1411-BSA@ERN is more obvious than that of ERN. Figure 6 50 Figure 6

[0235] In order to further verify the above experimental results, Calcein-AM / PI staining method was used to observe the survival state of cells treated by ERN and AS1411-BSA@ERN, wherein green fluorescence represents living cells and red fluorescence represents dead cells. As shown in G of FIG. 1, after treatment of KYSE520 and EC109 esophageal cancer cells by ERN and AS1411-BSA@ERN, the living cells decrease and the dead cells increase. Compared with naked drug, AS1411-BSA@ERN obviously reduces the existence of living cells, and the effect is more obvious in cells with high nucleolin expression. Figure 7

[0236] The above experimental results all confirm that AS1411-BSA@ERN has specific killing ability on esophageal cancer cells with high nucleolin expression.​​​​

[0237] Seven, the influence of AS1411-BSA@ERN on cell apoptosis and ROS generation:

[0238] Annexin V-FITC / PI double staining analysis of the effect of drugs on KYSE520 cell apoptosis is shown in Figure 7 A;

[0239] Annexin V-FITC / PI double staining analysis of the effect of drugs on EC109 cell apoptosis is shown in Figure 7 B;

[0240] DCF staining analysis of the effect of ERN, AS1411-BSA@ERN on ROS induction is shown in Figure 7 C;

[0241] Control is a group without drug treatment.

[0242] After the cells were stained with Annexin V-FITC / PI, they were detected by flow cytometry. The experimental results are shown in Figure 7 A-B, after 48 h of ERN and AS1411-BSA@ERN treatment, the apoptosis effect induced by AS1411-BSA@ERN nanoparticles is more obvious.

[0243] When the content of reactive oxygen species is excessive, it will have a destructive effect on cells. Therefore, the fluorescent probe DCFH-DA was used for reactive oxygen detection. After DCFH-DA passes through the cell membrane, it is hydrolyzed to DCFH. The reactive oxygen in the cell can oxidize the non-fluorescent DCFH to fluorescent DCF. By detecting the fluorescence value of DCF, the expression level of reactive oxygen in the cell can be known. As shown in ​ C, in KYSE520 and EC109 esophageal cancer cells, the content of reactive oxygen generated by AS1411-BSA@ERN is higher than that of the ERN group, indicating that AS1411-BSA@ERN can cause oxidative damage to esophageal cancer cells by causing up-regulation of intracellular ROS, and then induce cell apoptosis.

[0244] Although the present application has been described in detail with reference to the foregoing embodiments, it will be understood by those skilled in the art that modifications can be made to the technical solutions described in the foregoing embodiments, or equivalent replacements can be made to part of the technical features; and such modifications or replacements do not cause the essence of the corresponding technical solution to deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A mithramycin albumin nanoparticle targeted to esophageal cancer, characterized in that, The delivery carrier is prepared by coupling reaction of thiol-modified aptamer and albumin through a linker molecule, and resuspended in PBS buffer solution to obtain a solution containing the delivery carrier; The nanoparticles are prepared by the following steps: The thiol-modified aptamer is coupled with albumin through a linker molecule to prepare a delivery carrier, and resuspended in PBS buffer solution to obtain a solution containing the delivery carrier; The solution containing the delivery carrier and the ethanol solution of mithramycin are mixed to prepare a first mixed solution, and then a glutaraldehyde solution is added under stirring to prepare mithramycin albumin nanoparticles by stirring reaction. The linker molecule is 4-(N-maleimide methyl) cyclohexane-1-carboxylic acid sulfonic succinimidyl ester sodium salt. The aptamer is AS1411, and the albumin is bovine serum albumin or human serum albumin.

2. The folate-albumin nanoparticle targeted to esophageal cancer according to claim 1, wherein, The particle size of the mithramycin albumin nanoparticles is 100-200 nm.

3. The folate-albumin nanoparticle targeted to esophageal cancer according to any one of claims 1-2, wherein, The drug loading rate of the mithramycin albumin nanoparticles is 11-19%, and the encapsulation rate is 69-81%.

4. A method of preparing a furodan albumin nanoparticle targeted to esophageal cancer, characterized by, The mithramycin albumin nanoparticles are the mithramycin albumin nanoparticles of any one of claims 1-3, comprising: The thiol-modified aptamer is coupled with albumin through a linker molecule to prepare a delivery carrier, and resuspended in PBS buffer solution to obtain a solution containing the delivery carrier; The solution containing the delivery carrier and the ethanol solution of mithramycin are mixed to prepare a first mixed solution, and then a glutaraldehyde solution is added under stirring to prepare mithramycin albumin nanoparticles by stirring reaction.

5. The method for preparing spinal albumin nanoparticles targeting esophageal cancer according to claim 4, characterized in that, The specific operation of the solution containing the delivery carrier is as follows: The linker molecule, albumin and PBS buffer solution are mixed, and then reacted under ice water bath and stirring for 3-6 h, centrifuged, resuspended in PBS buffer solution to obtain a second reaction solution; The aqueous solution of the aptamer and the thiol reducing agent solution are mixed, and then reacted under ice bath and stirring for 20-80 min to obtain a third reaction solution containing thiol-modified aptamer; The second reaction solution and the third reaction solution are mixed, and then reacted under ice bath and stirring for 10-24 h, centrifuged to obtain a delivery carrier, and resuspended in PBS buffer solution to obtain a solution containing the delivery carrier.

6. The method for preparing spinal albumin nanoparticles targeting esophageal cancer according to claim 5, characterized in that, The mass ratio of the linker molecule to albumin is 2.5-3.5:40, and the stirring speed during the preparation of the second reaction solution is 50-100 rpm; The molar ratio of the aptamer to the thiol reducing agent is 1:70,000-85,000; The stirring speed during the preparation of the third reaction solution is 50-100 rpm, and the molar ratio of the linker molecule to the aptamer is 6,000-7,200:

1.

7. A method for preparing esophageal cancer-targeting dendritic albumin nanoparticles according to any one of claims 4-6, characterized in that, Before the glutaraldehyde solution is added under subsequent stirring, it further comprises: The first mixed solution is added dropwise to the PBS solution under stirring, and after the addition is completed, the obtained mixed solution is continuously ultrasonically mixed for 15-30 min.

8. The method of claim 7, wherein the maitansine albumin nanoparticle is targeted to esophageal cancer. The mass ratio of the delivery carrier to the mithramycin is 10:1-3; the stirring speed in the process of preparing the mithramycin albumin nanoparticle by stirring reaction is 500-700 rpm, and the stirring temperature is 30-40℃; the molar ratio of the glutaraldehyde to the aptamer is 1-2:1, and the mass concentration of the glutaraldehyde solution is 0.5-1%; The stirring speed of the first mixed solution added dropwise into the PBS solution is 500-700 rpm, and the stirring temperature is 30-40℃.

9. Use of the mithramycin albumin nanoparticle for targeting esophageal cancer according to any one of claims 1-3 in the preparation of a tumor treatment drug. The tumor is esophageal cancer.

Images