A Guizhou Trichoderma 15-28 strain and its application

Abstract

The present invention provides a Guizhou Trichoderma 15-28 strain and its application, which relates to the technical field of agricultural microbial control. Trichoderma guizhouense ) strain number is 15-28, and it was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on July 18, 2024, with the deposit number CGMCC No. 41467; the bacteria can effectively promote the increase of plant height, leaf and stem diameter, biomass and chlorophyll content of Yunnan peony seedlings, and induce the resistance level of Yunnan peony plants to increase. In addition, the bacteria has a strong inhibitory effect on Alternaria alternata, the main pathogenic fungus of Yunnan peony black spot disease. Therefore, the bacteria provides an excellent strain resource for Yunnan peony growth promotion and disease resistance, and has good application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural microbial control, and in particular to a Guizhou Trichoderma 15-28 strain and an application thereof. Background Art

[0002] Rhizosphere fungi refer to fungal groups isolated from the soil around plant roots that are affected by root growth. Some species can increase plant growth rate and photosynthetic capacity by producing plant growth regulators or enhancing the solubility of slightly soluble or insoluble compounds in the soil and the availability of trace nutrients. At the same time, some species can also enhance the activity of plant antioxidant enzymes such as peroxidase (POD) and superoxide dismutase (SOD) and malondialdehyde (MDA) content, reduce the accumulation of reactive oxygen, protect plant cells from biological and non-biological stress such as drought, salinity, and pests and diseases, and improve the resistance level of host plants. In addition, some species not only have the advantage of competing with pathogenic fungi for nutrition and space, but also inhibit the growth and colonization of pathogens by secreting secondary metabolites, so they have disease resistance.

[0003] Yunnan peony is a national second-level protected wild plant and a unique species of the peony group distributed in the southernmost part of my country. It has rich flower colors, seed oil rich in various unsaturated fatty acids, and root bark that can be used as medicine. It is an excellent plant resource with ornamental, edible and medicinal value in the southwestern mountains. However, Yunnan peony has a long growth cycle, and it takes three years for seeds to bloom. It is also susceptible to a variety of diseases. Among them, black spot disease is a common and serious disease of Yunnan peony, which leads to a significant decline in the health, quality and yield of its plants. Therefore, screening strains with obvious growth-promoting and disease-resistant functions in the rhizosphere fungi of Yunnan peony to develop microbial agents can not only actively promote plant growth and development and improve plant disease resistance, but also effectively solve the problems of soil compaction, enhanced plant resistance and pesticide residue pollution caused by long-term application of chemical fertilizers and pesticides. It is an important way to promote the sustainable and healthy development of the Yunnan peony planting industry.

[0004] Studies have shown that Guizhou Trichoderma is one of the main species of rhizosphere fungi in Yunnan peony. Regarding the research on Guizhou Trichoderma, Chinese patent CN113528356A inoculated Guizhou Trichoderma NJAU4742 strain into solid culture medium for fermentation and dilution and then applied to tea seedlings, which had a significant growth-promoting effect on the rooting of tea seedlings; Chinese patent CN113462580A showed that the fermentation liquid of Guizhou Trichoderma Hz36 strain had a good effect on the root root disease of cruciferous plants rapeseed and Arabidopsis; Chinese patent CN110684674A showed that Guizhou Trichoderma TC952 had a good effect on Rhizoctonia solani ( Rhizoctonia solani )、Botrytis cinerea( Botrytis cinerea ) and Fusarium graminearum ( Fusarium graminearum ) has a significant inhibitory effect on three plant pathogens. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a Guizhou Trichoderma 15-28 strain and its application, which can not only promote the growth and development of Yunnan peony seedlings and improve their resistance, but also have a significant inhibitory effect on the black spot disease caused by Alternaria alternata, and has good application prospects.

[0006] To achieve the above objectives, the technical solution of the present invention is implemented through the following technical solutions:

[0007] A strain of Trichoderma guizhouensis Trichoderma guizhouense The Guizhou Trichoderma 15-28 strain is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with the deposit number: CGMCC No. 41467.

[0008] Guizhou Trichoderma 15-28 strain can promote the growth of Yunnan peony and prevent and control Yunnan peony diseases.

[0009] Preferably, the application method of Guizhou Trichoderma 15-28 strain in promoting the growth of Yunnan peony is: preparing Guizhou Trichoderma 15-28 spores with a concentration of 1×10 6 -1×10 8 The product was used to irrigate the roots of Yunnan peony seedlings with 100 g / mL of the product.

[0010] The Yunnan peony disease is caused by Alternaria alternata ( Alternaria spp.) caused by black spot.

[0011] The method for preventing and controlling Yunnan peony diseases by using Guizhou Trichoderma 15-28 strain is to prepare Guizhou Trichoderma 15-28 spores with a concentration of 1×10 6 -1×10 10 The product of 1000 g / mL was applied by foliar spraying.

[0012] The present invention provides a Guizhou Trichoderma 15-28 strain and its application, which has the advantages of:

[0013] The invention provides a Guizhou Trichoderma 15-28 strain, and the 15-28 spore liquid is poured into the soil around the stem base of Yunnan peony seedlings, which can effectively improve the plant height, leaf number, stem diameter, biomass and chlorophyll content of the Yunnan peony, and induce the plant antioxidant enzyme activity and malondialdehyde content to increase; in addition, the Guizhou Trichoderma 15-28 strain has an inhibition rate of 82.02% on Alternaria alternata, a main pathogenic fungus of Yunnan peony black spot disease, and the Guizhou Trichoderma 15-28 spore liquid is applied to Yunnan peony leaves by leaf spraying, and the black spot prevention and control effect reaches 75.35%, and the invention has good application development potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1Schematic diagram of the colony and microscopic morphology of Guizhou Trichoderma 15-28 of the present invention, wherein a is the colony morphology of Guizhou Trichoderma 15-28 cultured in PDA medium at 25°C for 7 days; b is the colony morphology of Guizhou Trichoderma 15-28 cultured in CMD medium at 25°C for 7 days; c is the colony morphology of Guizhou Trichoderma 15-28 cultured in SNA medium at 25°C for 7 days; d is the phialides of Guizhou Trichoderma 15-28 cultured in SNA medium at 25°C for 3 days, scale = 10 μm; e is the conidia of Guizhou Trichoderma 15-28 cultured in SNA medium at 25°C for 3 days, scale = 10 μm;

[0015] Figure 2 The Bayesian phylogenetic tree constructed based on the joint construction of tef1 and rpb2 genes in the present invention;

[0016] Figure 3 The effect of inoculation of Guizhou Trichoderma 15-28 on the growth characteristics of Yunnan peony seedlings is shown in the present invention, wherein T. guizhouense The groups inoculated with Guizhou Trichoderma 15-28 were used, and CK was used as the control group;

[0017] Figure 4 The effect of inoculation of Guizhou Trichoderma 15-28 on the biomass of Yunnan peony seedlings is shown in the present invention, wherein T. guizhouense The groups inoculated with Guizhou Trichoderma 15-28 were used, and CK was used as the control group;

[0018] Figure 5 The effect of inoculation of Guizhou Trichoderma 15-28 on the chlorophyll content of leaves of Yunnan peony seedlings is shown in the present invention. T. guizhouense The groups inoculated with Guizhou Trichoderma 15-28 were used, and CK was used as the control group;

[0019] Figure 6 The present invention is to inoculate Guizhou Trichoderma 15-28 on the resistance-related indicators of Yunnan peony seedling leaves, wherein T. guizhouense The groups inoculated with Guizhou Trichoderma 15-28 were used, and CK was the control group.

[0020] Figure 7 Schematic diagram of the inhibition of Trichoderma guizhouensis 15-28 on Alternaria alternata by the present invention; wherein a is the result of confrontation culture of Trichoderma guizhouensis 15-28 and Alternaria alternata on flat plates, with Alternaria alternata on the left and Trichoderma guizhouensis 15-28 on the right; b is the Alternaria alternata control.

[0021] Figure 8 The control effect of Guizhou Trichoderma 15-28 of the present invention on Yunnan Paeonia suffruticosa seedlings inoculated with Alternaria alternata, a is a treatment group inoculated with Alternaria alternata and Guizhou Trichoderma 15-28; b is a control group inoculated with Alternaria alternata. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] The following Guizhou Trichoderma Trichoderma guizhouense ) strain number 15-28, classification name: Guizhou Trichoderma Trichoderma guizhouense , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on July 18, 2024, the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.41467. Embodiment 1:

[0024] Species identification of Guizhou Trichoderma 15-28:

[0025] 1. Morphological identification

[0026] PDA culture medium formula: 200 g potato, 20 g glucose, 20 g agar powder, dilute to 1000 mL with distilled water, sterilize at 121°C for 20 min, and set aside.

[0027] CMD medium formula: 40 g corn flour, 20 g agar, 20 g glucose, dilute to 1000 mL with distilled water, sterilize at 121°C for 20 min, and set aside.

[0028] SNA medium formula: KH2PO4 1.0 g, KNO3 1.0 g, MgSO4-7H2O 0.5 g, KCl 0.5 g, glucose 0.2 g, sucrose 0.2 g, agar 20 g, distilled water 1000 mL, sterilize at 121℃ for 20 min, and set aside.

[0029] After culturing Guizhou Trichoderma 15-28 in PDA medium at 25℃ in the dark for 7 days, the edge colonies of the fungus were taken with a sterile cork borer with a diameter of 5 mm and transferred to one side of PDA, CMD and SNA medium. After culturing in the dark at 25℃ for 7 days, the colonies on PDA medium were cottony, and conidia formed thick and dense concentric rings; the colonies on CMD medium were cottony, and the hyphae were relatively sparse; the colonies on SNA medium were cottony.

[0030] Guizhou Trichoderma 15-28 was cultured in SNA medium at 25℃ in the dark for 3 days, and then conidiophores and conidia were picked up with a sterile dissecting needle under an optical microscope to make water slides to observe their microscopic morphological characteristics. Conidiophores were transparent and smooth-walled, phialopiles were mostly in 2-3 whorls, and conidia were single-celled and nearly spherical.

[0031] 2. Molecular Biology Identification

[0032] The DNA of the above-mentioned test Trichoderma was extracted by urea extraction method, and the three gene fragments of the ribosome internal transcribed spacer (ITS), transcription elongation factor (tef1) and RNA polymerase large subunit (rpb2) were PCR amplified from the DNA stock solution. The relevant primers and PCR reaction conditions are detailed in Table 1. The PCR amplification system used 25uL, including 1uL of DNA bacterial solution, 0.5uL of forward and reverse primers, 12.5µL of TaqMasterMix, and 10.5uL of sterile water. The amplified products were detected by gel electrophoresis and sent to Kunming Shuoqing Biotechnology Co., Ltd. for bidirectional sequencing. The sequencing results were manually spliced ​​and corrected in CExpress and then compared with NCBI. The literature was consulted and the tef1 and rpb2 reference sequences with higher similarity were downloaded. The phylogenetic tree was constructed based on the Bayesian method (BI) and the maximum likelihood method (ML) by combining the two gene fragments. Figure 2 As shown in the figure, Guizhou Trichoderma 15-28, T. guizhouense HGUP 0038 and T. guizhouense HGUP 0039 were clustered into one branch, with the Bayesian posterior probability and maximum likelihood bootstrap values ​​being 1.00 and 100%, respectively. Combining the colony and microscopic morphological characteristics, the fungus was identified as T. guizhouense ( Trichoderma guizhouense ).

[0033] In the present invention, the ITS sequence of Trichoderma guizhouensis 15-28 is shown in SQE ID No.1:

[0034] ACGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAA CCAAAACTCTTTTTGTATACCCTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCT CCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAA

[0035] The primer sequences and PCR amplification conditions of the target gene fragment of Guizhou Trichoderma 15-28 are shown in Table 1 below:

[0036] Table 1

[0037] Embodiment 2:

[0038] Growth-promoting effect of Guizhou Trichoderma 15-28 inoculated on Yunnan peony seedlings:

[0039] Seedling cultivation for the test: Select the Yunnan peony seeds of the same size and without disease symptoms, soak them in 0.5% potassium permanganate for 5 minutes, soak them in 300mg / L gibberellin solution for 48 hours, and then place the treated seeds in a sand pool for 4 months to germinate. Mix red soil (red soil: humus soil: perlite = 3: 2: 1) and sterilize them by high pressure, and use 75% ethanol to disinfect the surface of the nutrient pot. Transplant the germinated Yunnan peony seeds into the nutrient pot, apply sterile water regularly, and conduct the test when the Yunnan peony grows 3~4 leaves.

[0040] Preparation of test bacterial solution: Guizhou Trichoderma 15-28 was inoculated on a PDA plate in the dark at 25°C for 7 days. A 1 cm diameter bacterial cake was punched on the edge of the colony with a sterile puncher and placed in a PDA liquid culture medium. The culture was incubated in a constant temperature oscillator at 28°C and 180 r / min for 96 hours. The bacterial solution was filtered with sterile filter paper and the spore concentration of the fermentation liquid was diluted to 1×10 7 Pieces / ml.

[0041] The experiment set up a treatment group and a control group. The treatment group regularly applied 50 mL of the test bacteria solution to the soil around the stem base by root irrigation every month, and the control group applied the same amount of sterile water. The treatment was performed 6 times in total, with 20 replicates per treatment. Ten plants were taken from each treatment to measure the seedling height, leaf number and stem diameter before and after 6 months of culture. The plant height was measured from the stem base to the stem tip with a steel tape measure, and the stem diameter was measured with a vernier caliper to measure the stem base diameter. The 2nd to 4th functional leaves of each plant were collected and the POD, SOD, CAT activities and MDA content were determined by the kit method. The kit was purchased from Suzhou Keming Biotechnology Co., Ltd.

[0042] 1. Effects of inoculation with Guizhou Trichoderma on the growth characteristics of Yunnan peony seedlings:

[0043] like Figure 3 As shown in the figure, 6 months after inoculation with Guizhou Trichoderma 15-28 strain, the plant height increment, leaf increment and stem diameter of Yunnan peony seedlings were 3.00 cm, 3.60 leaves and 2.43 mm, respectively, which increased by 81.82%, 80.00% and 22.11% compared with the control, and the plant height increment and leaf increment were significantly different from the control, and the stem diameter was significantly different from the control. This shows that inoculation with this fungus can effectively promote the growth of Yunnan peony seedlings.

[0044] 2. Effect of inoculation with Trichoderma guizhouensis on biomass of Paeonia yunnanensis seedlings

[0045] like Figure 4 As shown, the fresh weight and dry weight of the plant after inoculation with Guizhou Trichoderma 15-28 strain were 3.43g and 1.12g, respectively, an increase of 45.96% and 20.43% compared with the control, and both were significantly different from the control, indicating that inoculation with this fungus can increase the biomass of Yunnan peony seedlings.

[0046] 3. Effect of inoculation with Guizhou Trichoderma on chlorophyll content in leaves of Yunnan peony seedlings:

[0047] like Figure 5 As shown in the figure, after inoculation with Guizhou Trichoderma 15-28 strain, the chlorophyll a, chlorophyll b and total chlorophyll of the leaves of Yunnan peony seedlings were 0.34 mg / g, 0.13 mg / g and 0.47 mg / g, respectively, which increased by 70.00%, 116.67% and 80.77% respectively compared with the control, and the differences with the control were extremely significant, indicating that inoculation with this bacterium can significantly promote the increase of chlorophyll content in Yunnan peony leaves.

[0048] 4. Effects of inoculation with Guizhou Trichoderma 15-28 strain on resistance-related indicators of Yunnan peony seedling leaves:

[0049] like Figure 6 As shown in the figure, after inoculation with Guizhou Trichoderma 15-28 strain, the POD, CAT and SOD activities and MDA content in the leaves and roots of Yunnan peony seedlings showed extremely significant differences compared with the control, indicating that inoculation with this fungus can significantly improve the resistance level of Yunnan peony seedlings. Embodiment 3:

[0050] The results of plate confrontation culture determination of the inhibition of Guizhou Trichoderma 15-28 on Alternaria alternata:

[0051] Guizhou Trichoderma 15-28 and Alternaria alternata were cultured in PDA medium for 5 days, and 10 mm diameter fungus cakes of Trichoderma and pathogen were taken with a sterile puncher and inoculated on the same PDA medium with a diameter of 90 mm. The two fungus cakes were 5 cm apart and on the same straight line through the center of the medium. They were cultured in an incubator at (25±2) ℃ for 12 days, with 5 replicates for each treatment. The antagonistic ability of each fungus was observed and determined, expressed as the percentage of radial inhibition of pathogen growth and endophytic fungus growth;

[0052] The calculation formula is: PIRG = (R1−R2) / R1×100%, where R1 represents the radial growth diameter of the pathogenic fungus in the control, R2 represents the radial growth diameter of the pathogenic fungus in the antagonistic test, and PIRG is the inhibition rate. Figure 7 As shown, Guizhou Trichoderma 15-28 had a strong inhibitory effect on Alternaria alternata, and its inhibition rate was 82.02%±1.65%. Embodiment 4:

[0053] The control effect of Guizhou Trichoderma 15-28 spore suspension on Yunnan peony black spot disease:

[0054] Seedling cultivation and management are the same as in Example 2;

[0055] Preparation method of spore suspension: Guizhou Trichoderma 15-28 was inoculated on a PDA plate and cultured until spores were produced. A small amount of sterile water was sucked with a pipette and added to the surface of the culture medium. The spores were scraped with a sterile coating stick and filtered through a sterile funnel to obtain a spore suspension. The spore concentration was counted by a hemocytometer and the Guizhou Trichoderma 15-28 suspension was diluted to 1×10 8 Place the 100g / mL in a small spray bottle for later use.

[0056] The experiment set up one treatment group and one control group. In the treatment group, Alternaria was first cultured on PDA medium at 25℃ in the dark for 7 days before use. Then, the sterilized absorbent cotton was moistened with sterile water and gently wiped on the front and back of the Yunnan peony leaves. After natural air drying, a cross wound was cut with a sterilized surgical blade, and a 10 mm diameter bacterial cake was inoculated on the wound with a puncher. When inoculating, one side of the hyphae was in contact with the leaves, and then the Guizhou Trichoderma 15-28 spore suspension was evenly sprayed on the front and back of the inoculated leaves, with the dripping of Trichoderma liquid as the spraying standard, and finally the leaves of the plants were covered with a fresh-keeping bag. The control group sprayed the leaves with sterile water as the control, and the rest of the operations were the same as the treatment group. Nine Yunnan peony plants were inoculated in each treatment, and three leaves were inoculated for each plant. After 14 days, the disease index and the control effect of Trichoderma in the treatment groups inoculated with pathogens and inoculated with Trichoderma and pathogens were counted. The disease grading standards for black spot disease are detailed in Table 2:

[0057] Table 2

[0058]

[0059] Incidence rate = (number of diseased leaves / total number of leaves surveyed) × 100%, disease index = ∑ (number of diseased leaves at each level × disease grade) / (total number of leaves surveyed × highest grade) × 100%, prevention and control effect = (disease index of control group - disease index of treatment group) / disease index of control group × 100%.

[0060] See Table 3 below for details:

[0061] Table 3

[0062]

[0063] As can be seen from Table 3, 14 days after inoculation with Alternaria and Guizhou Trichoderma 15-28 spore suspension, the disease incidence of the seedlings was investigated and statistically analyzed; the incidence rate of the seedlings inoculated with Alternaria reached 100%, while the incidence rate of the seedlings inoculated with Guizhou Trichoderma 15-28 spore suspension and Alternaria was 74.08%. Among them, the disease index of Yunnan peony seedlings inoculated with Alternaria was 46.30%, and the disease index was reduced to 18.52% by foliar spraying of Guizhou Trichoderma 15-28 spore suspension, which was significantly different from the control, and the prevention efficiency reached 75.35%.

[0064] like Figure 8As shown, 14 days after inoculation with pathogens and Trichoderma spore solution, the lesions around the inoculation point were not obvious or the area was small, while in the control group inoculated with pathogens, the lesions around the inoculation point were obvious and the area increased.

[0065] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A strain of Trichoderma guizhouensis ( Trichoderma guizhouense ) strain 15-28, characterized in that The Guizhou Trichoderma 15-28 strain is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with the deposit number: CGMCC No. 41467.

2. An application of Guizhou Trichoderma 15-28 strain as claimed in claim 1 in promoting the growth of Yunnan peony and preventing and controlling Yunnan peony diseases, wherein the Yunnan peony disease is Alternaria alternata ( Alternaria spp .) caused by black spot.

3. The use according to claim 2, characterized in that: The application method of Guizhou Trichoderma 15-28 strain in promoting the growth of Yunnan peony is as follows: preparing Guizhou Trichoderma 15-28 spores with a concentration of 1×10 6 -1×10 8 The product was used to irrigate the roots of Yunnan peony seedlings with 100 g / mL of the product.

4. The use according to claim 2, characterized in that: The method for preventing and controlling Yunnan peony diseases by using Guizhou Trichoderma 15-28 strain is to prepare Guizhou Trichoderma 15-28 spores with a concentration of 1×10 6 -1×10 10 The product of 1000 g / mL was applied by foliar spraying.

Images