A recombinant Bacillus subtilis producing walnut active peptide and its construction method and application

Abstract

The present invention discloses a recombinant Bacillus subtilis producing walnut active peptides, a construction method and an application, and belongs to the field of bioengineering technology. The recombinant Bacillus subtilis producing walnut active peptides comprises a recombinant plasmid and an expression host; the recombinant plasmid is formed by introducing the HHHHHHK polypeptide coding sequence at the N-terminus of the active peptide TWLPLPR or the active peptide mutant TWLPYPR tandem sequence, and then homologously recombine into the expression plasmid; the expression host is Bacillus subtilis. The present invention adopts the strategy of tandem expression and signal peptide and host optimization to achieve efficient secretory expression of walnut active peptides and mutants thereof in food-grade hosts. The present invention lays a certain foundation for the efficient preparation of small molecule active short peptides and is suitable for industrial production and application.

Description

Technical Field

[0001] The invention relates to a recombinant bacillus subtilis producing walnut active peptide, a construction method and an application thereof, and belongs to the technical field of bioengineering. Background Art

[0002] Pecan is a high-quality nut food. Since ancient times, it has been widely favored for its unique taste and its health-building and intelligence-enhancing effects. Studies have shown that pecan kernels contain more than 22% crude protein, of which soluble protein is mainly composed of glutamic acid, followed by arginine and walnut kernel aspartic acid, and are rich in a variety of free essential amino acids. In recent years, studies have found that small molecule peptides (below 3000 Da) produced by the hydrolysis of pecan protein have important physiological activities, such as lowering blood sugar, lowering blood pressure and blood lipids, improving immunity, delaying aging, and other significant active effects. They are widely used in cosmetics, food, medicine and other industries. In addition, active short peptides are easily absorbed and transported by the human body and transported across the blood-brain barrier, so they have important application prospects in the fields of food, health care and medicine.

[0003] In the early stage, the team screened a strong antioxidant peptide TWLPLPR (TW) from walnut protein hydrolyzed peptides. Through in vitro cell model experiments and in vivo animal experiments, it was proved that TW has the ability to improve the learning and memory ability of mice with cognitive impairment induced by scopolamine. The derivative peptide TWLPYPR (TW-Y) produced by site-directed mutation of the TWLPLPR short peptide showed stronger biological activity. It can be seen that this active peptide has important application value and huge potential market. However, although active peptides can be obtained by enzymatic hydrolysis of walnut protein, separation and purification, they are still difficult to produce on a large scale due to the high cost of walnut raw materials, complex extraction process and low yield of pure products; as well as the high price, cumbersome steps and low synthesis efficiency of chemically synthesized peptides. In addition, the preparation of the derivative peptide TW-Y cannot be achieved by natural extraction. Therefore, the production of active peptides and their mutant derivative peptides by microbial fermentation has important research significance and industrialization potential.

[0004] As a Gram-positive bacterium that is harmless to the environment and has a clear genetic background, Bacillus subtilis is an internationally recognized food safety-grade host and has been widely used in the pharmaceutical and food industries. For example, the preparation of SOD superoxide dismutase protein in Bacillus subtilis is disclosed in the CN202211603290.X patent, and the application of Bacillus subtilis intracellular expression of recombinant ginseng peptides is disclosed in the CN202311267155.7 patent. However, Bacillus subtilis has a cell wall as a Gram-positive bacterium, and the extraction and separation of its intracellular products requires cell crushing treatment, and a large amount of contents such as nucleic acids, proteins, lipids, polysaccharides, etc. present in the cell will also increase the difficulty of separation and purification of the target product. Bacillus subtilis has less extracellular secretions, so the application of Bacillus subtilis extracellular secretion expression can avoid the cell crushing step, and the target product of higher purity can be obtained by directly collecting the fermentation supernatant, which greatly simplifies the separation and purification process of the expression product. However, there is no report on the expression and extracellular efficient secretion of walnut active peptides in Bacillus subtilis by genetic engineering technology. The inventors found in the research process that the secretion expression of active peptide TW by Bacillus subtilis has the following difficulties:

[0005] (1) Heterologously expressed active peptides are easily degraded, have low yields, and low secretion efficiency, and need to be matched with appropriate signal peptides for guidance. (2) The number of repeating units of active peptides expressed in tandem has a significant impact on the expression efficiency of the polypeptide and the stability of its recombinant plasmid. Summary of the invention

[0006] In order to overcome the above difficulties, the inventors constructed a secretion expression system of walnut active short peptide TW and mutant TW-Y in the food-grade microorganism Bacillus subtilis, and achieved high yield of active peptides in the food-grade microorganism Bacillus subtilis by connecting active peptide genes in series and optimizing the expression host. At the same time, signal peptides from different sources were fused to the N-terminus of the tandem active peptides to achieve efficient secretion expression of walnut active peptides. In particular, by accurately optimizing the active peptide tandem repeating units, fusion purification tags and signal peptide fragment sequences, the purification problems and easy degradation problems of active short peptide expression were overcome, and the bottleneck problem of large-scale preparation of active peptide TW and its mutants derived from walnut protein was solved. In particular, this project achieved the first efficient secretion of synthetic walnut active peptides by food-grade microorganisms, which has great application value and economic benefits.

[0007] The first aspect of the present invention provides a recombinant Bacillus subtilis producing walnut active peptides, the recombinant Bacillus subtilis comprising a recombinant plasmid and an expression host; the recombinant plasmid is formed by introducing a HHHHHHK polypeptide coding sequence at the N-terminus of an active peptide TWLPLPR or an active peptide mutant TWLPYPR tandem sequence, and then homologously recombine into the expression plasmid; the expression host is Bacillus subtilis.

[0008] In some embodiments of the present invention, the recombinant plasmid of the recombinant Bacillus subtilis further includes a signal peptide fragment sequence, and vector homologous sequences are added to the 5' upstream and 3' downstream of the signal peptide fragment sequence, respectively.

[0009] In some embodiments of the present invention, the number of repeats of the active peptide TWLPLPR or the active peptide mutant TWLPYPR in the tandem sequence is 5-20.

[0010] Preferably, the number of repetitions of the active peptide TWLPLPR or the active peptide mutant TWLPYPR in the tandem sequence is 14.

[0011] In some embodiments of the present invention, the signal peptide fragment sequence is one of SEQ ID NO.10 to SEQ ID NO.13.

[0012] In some embodiments of the present invention, the tandem sequence of the active peptide TWLPLPR is shown as SEQ ID NO.1; the tandem sequence of the active peptide mutant TWLPYPR is shown as SEQ ID NO.6.

[0013] In some embodiments of the present invention, preferably, the expression plasmid is a pMA5 plasmid, which contains a constitutive promoter P HpaII , promoter P HpaII The sequence is shown in SEQ ID NO.4; it contains an RBS sequence, and the RBS sequence is shown in SEQ ID NO.5. The Bacillus subtilis is one of Bacillus subtilis 168, B. subtilis WB600, and B. subtilis WB800; preferably, the Bacillus subtilis is B. subtilis WB600.

[0014] The second aspect of the present invention provides a method for constructing the recombinant Bacillus subtilis producing walnut active peptides described in the first aspect, which mainly comprises the following steps:

[0015] (1) Construction of active peptide recombinant plasmid: multiple active peptides TWLPLPR or active peptide mutants TWLPYPR are connected in series to form a tandem sequence, and then the HHHHHHK polypeptide coding sequence is introduced at the N-terminus of the tandem sequence to construct an active peptide recombinant expression gene; the constructed active peptide recombinant expression gene is connected to the expression plasmid to obtain an active peptide recombinant expression plasmid;

[0016] (2) Inserting a signal peptide into the active peptide recombinant expression plasmid: Select a signal peptide derived from Bacillus subtilis, insert the signal peptide fragment sequence into the NdeI site of the active peptide recombinant plasmid constructed in step (1), add homologous sequences of the vector to the 5' upstream and 3' downstream of the signal peptide fragment sequence respectively; add a His tag sequence between the signal peptide and the active peptide; and add an amino acid K between HT as a protease cleavage site;

[0017] (3) Construction of secretory expression host: HpaII The recombinant expression plasmids of , RBS, signal peptide and active peptide are transferred into the Bacillus subtilis host to obtain the recombinant Bacillus subtilis.

[0018] The third aspect of the present invention provides the use of the recombinant Bacillus subtilis described in the first aspect in preparing walnut active peptides.

[0019] In some embodiments of the present invention, the recombinant Bacillus subtilis is inoculated into a culture medium for culture, and the walnut active peptides in the fermentation supernatant are collected after centrifugation. The culture medium uses glucose or sucrose as a carbon source, the culture temperature is 30-37°C, the pH of the fermentation liquid is 6.0-7.0, and the fermentation time is 48-96 h.

[0020] The present invention provides an expression frame of a walnut active peptide TW, comprising a signal peptide and a coding gene for tandem expression of the walnut active peptide TW. An expression frame of a walnut active peptide mutant TW-Y, comprising a signal peptide and a coding gene for tandem expression of the walnut active peptide mutant TW-Y; the coding gene of the walnut active peptide TW / TW-Y has a plurality of walnut active peptide TW / TW-Y repeating sequences; the coding sequence of the signal peptide is shown in SEQ ID NO.10-13. The walnut active peptide TW / TW-Y expression frame also comprises a promoter sequence.

[0021] In one embodiment, the nucleotide sequence of the active peptide TW tandem sequence is shown as SEQ ID NO. 1; the nucleotide sequence of the active peptide mutant TW-Y tandem sequence is shown as SEQ ID NO. 6.

[0022] In one embodiment, the number of repeats of the walnut active peptide TW / TW-Y in the tandem sequence is 5-20; preferably, the number of repeats is 14.

[0023] The invention also provides a recombinant plasmid carrying the walnut active peptide TW / TW-Y expression frame.

[0024] In one embodiment, the plasmid includes but is not limited to pMA5.

[0025] The present invention also provides a method for increasing the extracellular expression of walnut active peptides, which comprises repeating one or more coding genes of the walnut active peptides and connecting a nucleotide sequence encoding HHHHHHK polypeptide to the 5' end of the gene sequence.

[0026] The present invention also provides a recombinant Bacillus subtilis that secretes and expresses the walnut active peptide TW / TW-Y, which contains the walnut active peptide TW / TW-Y expression frame.

[0027] In one embodiment, the recombinant Bacillus subtilis uses pMA5 as an expression vector and a constitutive promoter P HpaII Regulate the expression effect of the expression cassette.

[0028] The present invention also provides a method for preparing walnut active peptides by using the recombinant Bacillus subtilis. The method comprises culturing the recombinant Bacillus subtilis in a culture medium for a period of time, collecting the walnut active peptides in the fermentation supernatant, wherein the culture medium uses glucose or sucrose as a carbon source, the temperature is 30-37°C, the pH is 6.0-7.0, and the fermentation time is 48-96 h.

[0029] Beneficial effects: The present invention constructs a secretion expression system of walnut active peptide TW and its mutant-derived peptides in food-grade microorganism Bacillus subtilis, and realizes efficient expression of active peptides in food-grade microorganism Bacillus subtilis by connecting active peptide genes in series and optimizing expression hosts. The present invention also realizes efficient secretion expression of walnut active peptides by fusing signal peptides from different sources to the N-terminus of the active peptides. The present invention adopts genetic engineering means, and overcomes the purification problem of active peptide tandem expression and the easy degradation problem of active peptide sequences by accurately optimizing the number of short peptide repeating units, fusing purification tags and signal peptide fragment sequences, and solves the bottleneck problem of active peptides being difficult to prepare on a large scale. For the first time, efficient secretion expression of walnut active peptides and their mutant-derived peptides by food-grade microorganisms is realized, which has huge application value and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The effect of different numbers of tandem repeat units on the translation efficiency of the free energy level of the mRNA secondary structure.

[0031] Figure 2 This is a diagram of the tandem expression structure of the walnut active peptide TWLPLPR designed in one embodiment of the present invention.

[0032] Figure 3 This is a diagram showing the product detection results of different signal peptides using SDS-PAGE protein electrophoresis.

[0033] Figure 4 The figure is a comparison chart of the active peptide concentrations in each fermentation supernatant.

[0034] Figure 5 This is the result of purification and electrophoresis detection of the target product secreted outside the cell. DETAILED DESCRIPTION

[0035] The mass spectrometry sequencing analysis of the active peptides of the secretory expression product is as follows:

[0036] Sample enzymatic hydrolysis: Use trypsin to enzymatically hydrolyze the protein sample and cut the protein sample into polypeptide samples. The polypeptide samples are desalted, freeze-dried and re-dissolved in preparation for LC-MS analysis.

[0037] LC-MS / MS mass spectrometry data acquisition: The peptide mixture after enzymatic hydrolysis is analyzed by LC-MS / MS. The peptide mixture is first separated on liquid chromatography; the separated peptides are collected according to the order of peaks using mass spectrometry data dependent acquisition strategy (DDA, Data dependent acquisition) to collect the secondary spectrum of the separated peptides. Based on the mass-to-charge ratio information of the peptide, the molecular weight information of the peptide can be obtained.

[0038] Detection of active peptide expression:

[0039] The culture supernatant of Bacillus subtilis after fermentation was collected by centrifugation, and the protein electrophoresis sample was prepared according to the ratio of supernatant to loading buffer of 5:1, and then SDS-PAGE analysis was performed using protein gel with an acrylamide concentration of 12%.

[0040] The electrophoresis conditions are: 60 V electrophoresis for 20-30 min, then 120 V electrophoresis for 60-80 min, until the bromophenol blue indicator reaches the protein gel substrate and stops electrophoresis. Coomassie brilliant blue staining is used to determine the expression yield of active polypeptides based on the width (thickness) of the protein band, and the secretory expression yield is determined using the BCA kit.

[0041] Example 1 Construction of recombinant expression systems pMA5-TW and pMA5-TW-Y

[0042] The active peptide sequence TWLPLPR used in the present invention is derived from the enzymatic short peptide of the protein extract of Juglans mandshurica Maxim. The nucleic acid sequence is optimized according to the codon table and the Bacillus subtilis expression host, and a fusion design of a nucleic acid sequence of multiple repeating units in series is performed; the repeating unit series sequence is designed as SEQ ID NO. 1. In order to avoid the structural instability of the repeating sequence to the expression plasmid, the nucleic acid coding sequence of each repeating unit is appropriately codon optimized, and 1, 5, 10, 14 and 20 TWLPLPR series expression nucleic acid sequences are constructed respectively, and the HHHHHHK polypeptide coding sequence (composed of a histidine tag sequence and a trypsin cleavage site K residue) is introduced at the N-terminus to artificially synthesize the gene.

[0043] According to the optimized synthetic gene sequence information, primers TWF / TWR were designed respectively, and the synthesized DNA was used as a template, and a standard PCR amplification system and procedure were used to amplify and obtain the TW-NUM gene fragment; wherein NUM represents the number of tandem sequences.

[0044] Primer sequence information: 5'-3' direction

[0045] TW-F( SEQ ID NO.2 ):ccgtcagcaaaagccgctCACCACCACCACCACCACAAGACCT;

[0046] TW-R( SEQ ID NO.3 ):ggtaccaagcttgtcgacTTAACGAGGCAGGGGCAGCC。

[0047] At both ends of the upstream and downstream primers, 18 bp upstream and downstream of the EcoRI restriction enzyme site of the vector pMA5 were introduced as homology arm sequences (underlined parts) for seamless cloning and recombination. HpaII The vector pMA5 containing the sequences of SEQ ID NO.4 and PBS (SEQ ID NO.5) was digested with restriction endonuclease EcoRI; after detection by agarose gel electrophoresis, the DNA fragment and vector were recovered by solution; the recovered products were seamlessly cloned and connected, the system was 5 μl: 1 μl single-cut vector, 3 μl target fragment, 1 μl seamless cloning mixture enzyme, and ice-bathed at 4 ℃ for 30 min; then the connection product was transformed into JM109 competent cells, single colony PCR was picked for verification, positive recombinants were sequenced, and the alignment was correct, and the recombinant plasmid pMA5-TW-NUM was successfully constructed. The recombinant plasmids were transformed into B. subtilis 168, and the recombinants were screened on LB plates containing 50 μg / ml kanamycin. The recombinant strains were verified by PCR and sequencing, and the Bacillus subtilis that successfully transformed pMA5-TW-NUM was preserved for backup.

[0048] The verified transformants were fermented and cultured. The specific steps were as follows: the strain was inoculated with 1 mL of inoculum into 100 mL of LB medium containing 50 μg / ml kanamycin, cultured at 37°C for 24 h, centrifuged and the bacterial cell supernatant was collected, and the protein was purified after being broken and the protein yield was determined. In order to investigate the effect of the tandem sequence of the repeating unit on the stability of the mRNA secondary structure and the minimum free energy, the mRNA minimum free energy MFE of CDS was evaluated by RNAfold WebServer online software. The lower the free energy, the more stable the secondary structure formed by mRNA; its effect on translation efficiency was further verified by protein expression.

[0049] The results are as follows Figure 1 As shown, the translation efficiency of the protein is relatively highest when 14 repeating units are connected in series.

[0050] Therefore, considering the expression level of the target protein and the stability of gene synthesis, 14 repeating units were preferably tandemly expressed in TW-14, and the recombinant plasmid was named pMA5-TW. Figure 2 shown.

[0051] The recombinant plasmid pMA5-TW-Y was constructed according to the method of pMA5-TW, and the repeating unit tandem sequence was designed as SEQ ID NO. 6;

[0052] The synthetic primer sequences are:

[0053] TW-Y-F( SEQ ID NO.7 ):ccgtcagcaaaagccgctCACCACCACCACCACCACAAGACCT;

[0054] TW-Y-R( SEQ ID NO.8 ):ggtaccaagcttgtcgacTTAACGAGGATAGGGCAGCC。

[0055] Example 2 Optimization of the construction of secretory expression vector for recombinant active peptide TW

[0056] Eight signal peptides (SP1 to SP8) from candidate Bacillus subtilis were designed and recombined into the plasmid pMA5-TW constructed in Example 1, and the signal peptide fragment sequence was placed upstream of the histidine tag. For seamless cloning, the signal peptide fragment sequence was inserted into the NdeI site of the recombinant plasmid, and an 18 bp vector homologous sequence (underlined) was added 5' upstream of the signal peptide fragment sequence, and an 18 bp vector homologous sequence (underlined) was added 3' downstream of the signal peptide fragment sequence; 8 signal peptide fragments were obtained by gene synthesis, and the sequences of the SP1 to SP8 signal peptide fragments are shown in the sequences SEQ ID NO.9 to SEQ ID NO.16:

[0057] SP1 (SEQ ID NO.9):

[0058] CTAAAAAGGAGCGATTTA ATGGTCAGCATCCGCCGCAGCTTCGAAGCGTATGTCGATGACATGAATATCATTACTGTTCTGATTCCTGCTGAACAAAAGGAAATCATG CATATGAAATTTGTAAAA;

[0059] SP2(SEQ ID NO.10):

[0060] CTAAAAAGGAGCGATTTA ATGAGGAAAAAAACGAAAAACAGACTCATCAGCTCTGTTTTAAGTACAGTTGTCATCAGTTCACTGCTGTTTCCGGGAGCAGCCGGGGCA CATATGAAATTTGTAAAA;

[0061] SP3(SEQ ID NO.11):

[0062] CTAAAAAGGAGCGATTTA ATGGGTTTAGGTAAGAAATTGTCTGTTGCTGTCGCTGCTTCGTTTATGAGTTTATCAATCAGCCTGCCAGGTGTTCAGGCT CATATGAAATTTGTAAAA;

[0063] SP4(SEQ ID NO.12):

[0064] CTAAAAAGGAGCGATTTA ATGAAAAAGTTCGCGTTACTATTCATCGCTTTGGTCACTGCCGTTGTCATTTCTGCATGCGGAAACCAAAGCACAAGCAGCAAAGGT CATATGAAATTTGTAAAA;

[0065] SP5(SEQ ID NO.13):

[0066] CTAAAAAGGAGCGATTTA ATGAAACGTATTCGTATCCCAATGACACTTGCTCTTGGTGCCGCTTTGACAATTGCCCCTTTGTCCTTTGCTTCCGCT CATATGAAATTTGTAAAA;

[0067] SP6(SEQ ID NO.14):

[0068] CTAAAAAGGAGCGATTTAATGAGCGATGAACAGAAAAAGCCAGAACAAATTCACAGACGGGACATTTTAAAATGGGGAGCGATGGCGGGGGCAGCCGTTGCG CATATGAAATTTGTAAAA;

[0069] SP7 (SEQ ID NO.15):

[0070] CTAAAAAGGAGCGATTTA ATGCTAAAAGAACTTCATTCGTATCTCATTATTCATCAGTTCAGCTGTTTTACTATCAATCTTACTTCCTTCGGGCCAAGCTCATGCA CATATGAAATTTGTAAAA;

[0071] SP8 (SEQ ID NO.16):

[0072] CTAAAAAGGAGCGATTTA ATGGTCAAGTCATTTCGTATGAAAGCTTTGATTGCGGGAGCTGCGGTGGCGGCGGCTGTTTCGGCCGGCGCTGTTTCTGATGTGCCCGCTGCCAAAGTGCTTCAGCCGACAGCTGCTTATGCG CAT ATGAAATTTGTAAAA .

[0073] The recombinant plasmid pMA5-TW was single-cut with NdeI restriction endonuclease and seamlessly cloned and recombined with artificially synthesized signal peptide fragments (SEQ ID NO.9~SEQ ID NO.16) to prepare a 5 μl recombinant system: 1 μl single-cut vector, 3 μl signal peptide fragment, 1 μl seamless cloning mixture enzyme, and incubated at 4 ℃ for 30 minutes; the ligation product was then transformed into JM109 competent cells, single colonies were picked for PCR verification, and positive recombinants were sequenced, and 8 recombinant plasmids pMA5-SP1-TW, pMA5-SP2-TW, pMA5-SP3-TW, pMA5-SP4-TW, pMA5-SP5-TW, pMA5-SP6-TW, pMA5-SP7-TW, and pMA5-SP8-TW were successfully constructed. Finally, eight secretory recombinant plasmids were obtained and transformed into Bacillus subtilis 168, WB600 and WB800 competent cells, respectively. The recombinants were screened on LB plates containing 50 μg / ml kanamycin, and the recombinant strains were verified by PCR and sequencing.

[0074] The same operation as the previous plasmid construction was used to obtain pMA5-SP1-TW-Y, pMA5-SP2-TW-Y, pMA5-SP3-TW-Y, pMA5-SP4-TW-Y, pMA5-SP5-TW-Y, pMA5-SP6-TW-Y, pMA5-SP7-TW-Y, and pMA5-SP8-TW-Y plasmids.

[0075] The eight secretory recombinant plasmids were used to transform Bacillus subtilis competent cells B. subtilis168, WB600 and WB800, respectively. The recombinants were screened on LB plates containing 50 μg / ml kanamycin, and the recombinant strains were verified by PCR and sequencing.

[0076] Example 3 Recombinant secretory expression of walnut active peptides

[0077] The recombinant bacteria constructed in Example 2 were selected for shake flask fermentation culture. A single clone was inoculated into 50 mL (250 mL shake flask) of LB medium containing 50 μg / ml kanamycin as seed preparation, and cultured overnight at 200 rpm and 37°C for 12 h. The shake flask was inoculated and cultured at an inoculum of 10%, and the fermentation medium was LB medium containing 50 μg / ml kanamycin and 1% glucose, and the fermentation culture was cultured at 200 rpm and 30°C for 48 h.

[0078] After the fermentation, the fermentation broth was collected and centrifuged at 10,000 rpm for 10 min at room temperature. The collected supernatant of the fermentation broth contained the tandem recombinant protein containing walnut active peptides.

[0079] The target protein product was detected by SDS-PAGE protein electrophoresis. Figure 3 The concentration of active peptides in each fermentation supernatant is shown as Figure 4 shown.

[0080] The results showed that in the host WB600, the recombinant expression plasmids containing signal peptides SP2, SP3, SP4, SP5, and SP6 produced obvious target bands at the expected positions, and the concentrations of active peptides in the corresponding fermentation supernatants were 0.15, 0.17, 0.13, 0.21, and 0.19 mg / mL, respectively. Therefore, signal peptide SP5 was the optimal signal peptide for walnut active peptides and their mutants; no target product bands were seen in the fermentation supernatants of other signal peptides corresponding to the hosts B. subtilis 168, WB600, or WB800, or the product amounts were low. This indicates that the recombinant expression of active peptides from different sources may require comprehensive screening and optimization based on the amino acid sequence characteristics of the active peptides and the adaptability of the signal peptides and the expression host. Nickel column affinity chromatography was further used to preliminarily purify the target product, and the results are shown in the figure. Figure 5shown.

[0081] The purified bands were cut from the gel and then identified by protein spectrum. The results are shown in Table 1 below.

[0082] Table 1 Protein spectrum identification results

[0083] 1 2 3 4 A2 High High High Sequence TWLPLPRTWLPLPRTWLPLPR TWLPLPRTWPLPR TWLPLPR #PSMs 2 3 84 #Proteins 1 1 1 #Protein Groups 1 1 1 Protein Group Accessions sp sp sp ΔCn 0 0 0 XCorr 5.22 3.7 1.98 Charge 3 2 2 NH+[Da] 2609.51419 1746.01384 882.51958 ΔM[ppm] -3.47 -4.35 -0.07 RT[min] 73.07 70.92 61.3 #Missed Cleavages 2 1 0

[0084] The results showed that the detected product sequence was identified as a TWLPLPR tandem combination.

[0085] The above results show that the present invention realizes the fermentation preparation of walnut active peptides with efficient secretory expression by food-grade hosts through gene recombination technology and optimization of protein secretory expression conditions.

[0086] Although the preferred embodiments of the present invention have been disclosed as above, they are not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An application of recombinant Bacillus subtilis in preparing walnut active peptides, characterized in that: The recombinant Bacillus subtilis comprises a recombinant plasmid and an expression host; the recombinant plasmid is formed by introducing a HHHHHHK polypeptide coding sequence at the N-terminus of a tandem sequence of an active peptide TWLPLPR or an active peptide mutant TWLPYPR, and then homologously recombining the sequence into an expression plasmid; the expression host is Bacillus subtilis; the tandem sequence of the active peptide TWLPLPR is shown in SEQ ID NO.1; the tandem sequence of the active peptide mutant TWLPYPR is shown in SEQ ID NO.6; the expression plasmid is a pMA5 plasmid, and the pMA5 plasmid comprises a constitutive promoter P HpaII , promoter P HpaII The sequence is shown in SEQ ID NO.4, and the RBS sequence, the RBS sequence is shown in SEQ ID NO.5, the Bacillus subtilis is B. subtilis WB600; the recombinant plasmid in the recombinant Bacillus subtilis also includes a signal peptide fragment sequence, and vector homologous sequences are added to the 5' upstream and 3' downstream of the signal peptide fragment sequence respectively; the signal peptide fragment sequence is one of SEQ ID NO.10 to SEQ ID NO.

14.

2. The use according to claim 1, characterized in that: The following steps are involved: (1) Construction of active peptide recombinant plasmid: multiple active peptides TWLPLPR or active peptide mutants TWLPYPR are connected in series to form a tandem sequence, and then the HHHHHHK polypeptide coding sequence is introduced at the N-terminus of the tandem sequence to construct an active peptide recombinant expression gene; the constructed active peptide recombinant expression gene is connected to the expression plasmid to obtain an active peptide recombinant expression plasmid; (2) Inserting a signal peptide into the active peptide recombinant expression plasmid: Select a signal peptide derived from Bacillus subtilis, insert the signal peptide fragment sequence into the NdeI site of the active peptide recombinant expression plasmid constructed in step (1), and add vector homologous sequences to the 5' upstream and 3' downstream of the signal peptide fragment sequence respectively; add a His tag sequence between the signal peptide and the active peptide; and add an amino acid K between HT as a protease cleavage site; (3) Construction of secretory expression host: HpaII The recombinant expression plasmids of , RBS, signal peptide and active peptide are transferred into the Bacillus subtilis host to obtain the recombinant Bacillus subtilis.

3. The use according to claim 2, characterized in that: The recombinant Bacillus subtilis is inoculated into a culture medium for cultivation, and the fermentation supernatant is collected after centrifugation, and the walnut active peptide is obtained after separation and purification; the culture medium uses glucose or sucrose as a carbon source, is fermented at 30-37°C, pH 6.0-7.0, and is fermented for 48-96 hours.

Images