A Baeyer-Villiger monooxygenase mutant, engineered bacteria and application thereof

Abstract

The invention discloses a Baeyer-Villiger monooxygenase mutant, an engineering bacterium and an application thereof, and belongs to the field of enzyme engineering. The Baeyer-Villiger monooxygenase gene is derived from Pseudomonas fluorescens ACB, and its codon-optimized nucleotide sequence is shown in SEQ ID NO:1, and its amino acid sequence is shown in SEQ ID NO:2; the mutant is obtained by mutating the 213th alanine in the amino acid sequence shown in SEQ ID NO:2 to glutamine, the 312th glycine to alanine, and the 434th serine. The Baeyer-Villiger monooxygenase mutant engineering strain constructed by the present invention has an increase of 189.2% over the original enzyme activity, and is successfully used for the enzymatic synthesis of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester, which solves the problems of high cost, poor optical selectivity and low yield of chemical synthesis, and realizes high-yield green production.

Description

Technical Field

[0001] The invention belongs to the field of enzyme engineering, and specifically relates to a Baeyer-Villiger monooxygenase mutant, an engineering bacterium and applications thereof. Background Art

[0002] Chiral pesticides, a class of pesticides with chiral molecular structures, can show stereoselectivity and exist in the form of enantiomers. At present, about 30% of the active ingredients of pesticides registered worldwide contain one or more asymmetric centers. Indoxacarb is a typical representative of oxadiazine insecticides. It mainly acts on the voltage-dependent sodium ion channels in the target insect nerve cells, causing the target biological nerve cells to lose function. The target insects will show paralysis symptoms, poor coordination ability, and eventually die. Indoxacarb has two isomers, R and S. Only the S-enantiomer has a killing effect on insects, and the R-isomer is inactive. As the key chiral intermediate of S-indoxacarb, (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester, its enantiomeric excess value (ee value) directly affects the insecticidal activity of indoxacarb. At present, the methods for synthesizing (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester mainly include chemical method and biocatalytic method, but the chemical method has the disadvantages of complex reaction, difficult reaction control and low optical selectivity.

[0003] Biocatalysis is a very promising method with advantages such as environmental friendliness and high conversion efficiency. Baeyer-Villiger monooxygenase (BVMO) is an important biocatalyst that can catalyze the Baeyer-Villiger (BV) oxidation reaction of various organic ketone / aldehyde compounds, as well as the oxidation reaction of some heteroatom substrates containing sulfur, selenium, boron, etc. BVMO not only has excellent stereoselectivity and regioselectivity, but also has the common advantages of biocatalysts such as mild reaction conditions, high efficiency, and environmental friendliness. Therefore, BVMO has undisputedly become the best catalyst for green asymmetric oxidation reactions and is widely used in the synthesis of chiral oxidation products. Summary of the invention

[0004] The invention aims at the defects of the existing chemical synthesis process of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester and provides a Baeyer-Villiger monooxygenase-producing mutant, a recombinant bacterium and a whole cell thereof as a catalyst for the synthesis of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester.

[0005] The present invention is achieved through the following technical solutions:

[0006] The present invention provides a Baeyer-Villiger monooxygenase mutant, which is BV2-A213Q-G312A-S434Y. The mutant is a Baeyer-Villiger monooxygenase mutant in which alanine at position 213 is mutated to glutamine, glycine at position 312 is mutated to alanine, and serine at position 434 is mutated to tyrosine (BV2-A213Q-G312A-S434Y) in the amino acid sequence shown in SEQ ID NO: 2.

[0007] Preferably, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2 is shown in SEQ ID NO:1.

[0008] The present invention also relates to a gene encoding the Baeyer-Villiger monooxygenase mutant, the nucleotide sequence of the gene encoding is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:4.

[0009] The invention provides an engineering bacterium containing the encoding gene.

[0010] The present invention also provides a biological preparation, which contains the mutant or engineered bacteria.

[0011] The present invention also provides an application of the Baeyer-Villiger monooxygenase mutant and the engineered bacteria in catalyzing 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester to synthesize (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester.

[0012] Furthermore, the application method is to use bacterial cells harvested by fermentation centrifugation of engineered bacteria containing Baeyer-Villiger monooxygenase mutant genes as whole-cell catalysts, and the components and final concentrations in the catalytic system are: 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester 5-100 g / L, nicotinamide adenine dinucleotide phosphate (NADP) 0.2 g / L, glucose 10-150 g / L, glucose dehydrogenase bacterial cells 10 g / L, cosolvent 50 mL / L, Baeyer-Villiger monooxygenase bacterial cells 50-100 g / L, and react for 3-15 hours at a speed of 200 r / min, pH 6.5-8.0, and a temperature of 25-37°C.

[0013] Furthermore, in the conversion system, the co-solvent is a mixture of one or more of ethanol, acetonitrile, methanol and dimethyl sulfoxide.

[0014] Furthermore, wet cells of engineered bacteria containing the Baeyer-Villiger monooxygenase mutant gene are prepared as follows: the recombinant Escherichia coli containing the Baeyer-Villiger monooxygenase mutant gene is inoculated into an LB slant culture medium and cultured at 37°C for 12 to 20 hours; the slant bacteria are inoculated into an LB liquid seed culture medium and cultured at 37°C for 4 to 8 hours; the seed liquid is inoculated into a container containing a fermentation medium, cultured at 37°C for 5 to 10 hours, cooled to 20 to 30°C, and isopropyl-β-D-thiogalactopyranoside (IPTG) is added to continue inducing expression for 16 to 32 hours. After the fermentation is completed, the cells are collected and washed to obtain a Baeyer-Villiger monooxygenase mutant whole-cell catalyst.

[0015] Furthermore, the LB slant culture medium comprises: 5 g / L yeast extract + 10 g / L peptone + 5 g / L NaCl + 100 mg / L ampicillin (filter sterilized) + 20 g / L agar, and the pH of the LB slant culture medium is 6.8-7.0.

[0016] Furthermore, the LB liquid seed culture medium comprises: 5 g / L yeast extract + 10 g / L peptone + 5 g / L NaCl + 100 mg / L ampicillin (filtered and sterilized); the pH of the LB liquid seed culture medium is 7.0-7.2.

[0017] Furthermore, the fermentation medium is a mixed solution of glycerol 20 g / L + peptone 10 g / L + yeast extract powder 5 g / L + soybean powder 10 g / L + MgSO4 2 g / L + KH2PO4 15 g / L + NH4Cl 2 g / L + riboflavin 5 mg / L + adenosine 10 mg / L, and the pH of the fermentation medium is 7.0-7.2.

[0018] The beneficial effects of the present invention compared with the prior art are as follows: the present invention uses error-prone PCR technology to successfully mutate the Baeyer-Villiger monooxygenase from Pseudomonas fluorescens ACB and construct an engineering strain, the screened mutant enzyme activity is 189.2% higher than the original enzyme, and is used for the enzymatic synthesis of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester, the product concentration can reach up to 99.8g / L, the conversion rate can reach up to 93.2%, and ee%>99%. At the same time, the production method of the present invention is simple and easy to implement, and the production cost is low. The established whole-cell transformation system solved the problems of high cost, poor optical selectivity and low yield in the chemical synthesis of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester, and realized the high-yield green production of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further explained below by way of embodiments, but the protection scope of the present invention is not limited in any form by the embodiments.

[0020] Preparation method of LB slant culture medium: yeast extract 5g / L + peptone 10g / L + NaCl 5g / L + ampicillin 100mg / L (filter sterilized) + agar 20g / L, pH 6.8-7.0, high-pressure steam sterilization at 121℃ for 20min.

[0021] LB liquid seed culture medium: yeast extract 5 g / L + peptone 10 g / L + NaCl 5 g / L + ampicillin 100 mg / L (filter sterilized); pH 7.0-7.2, 121°C high-pressure steam sterilization for 20 min.

[0022] The fermentation medium is a mixed solution of glycerol 20 g / L + peptone 10 g / L + yeast extract powder 5 g / L + soybean powder 10 g / L + MgSO4 2 g / L + KH2PO4 15 g / L + NH4Cl 2 g / L + riboflavin 5 mg / L + adenosine 10 mg / L, pH 7.0-7.2, and high-pressure steam sterilization at 121°C for 20 min.

[0023] Glucose dehydrogenase: Preparation method of glucose dehydrogenase for regeneration of coenzyme NADP: The base sequence of glucose dehydrogenase from Bacillus tequilensis (GenBank: QIW79596.1) is SEQ ID NO.5, and the amino acid sequence is SEQ ID NO.6. After amplification using specific primers (upstream primer: tggacagcaaatgggtcgcggatccatgggtaaatttgaaggtaaa (SEQ ID NO.7), downstream primer: agtggtggtggtggtggtggtgctcgagttatacctgtgctagcccgcca (SEQ ID NO.8); wherein the lowercase black italics are homology arm sequences), homologous recombination reaction was carried out with the BamHI and Xho I double restriction fragment of pET28a to construct the recombinant plasmid pET28a-BtGluDH. E. coli BL21 (DE3) was transformed by heat shock to obtain E. coli BL21 (DE3) / pET28a-BtGluDH expressing glucose dehydrogenase, and then cultured at 37°C for 6 h using TB medium (glycerol 4 g / L, peptone 12.0 g / L, yeast extract 24.0 g / L, potassium dihydrogen phosphate 2.2 g / L, potassium dihydrogen phosphate 9.4 g / L), and then added with 5 g / L lactose while cooling to 25°C and continuing to culture for 20 h. After the fermentation was completed, the cells were collected by centrifugation at 8000 r / min and 4°C for 10 min, washed twice with sterile saline, and frozen at -20°C for later use.

[0024] Example 1: Construction of expression vector and engineering bacteria.

[0025] Baeyer-Villiger monooxygenase BV2 (GenBank: AAK54073.1) of PseudomonasfluorescensACB was searched and selected in the NCBI database through literature reports and gene sequence homology. After codon optimization (base sequence is SEQ ID No.1, amino acid sequence is SEQ ID No.2), the whole gene was synthesized and constructed between BamHI and Xho I of vector pET32a to obtain recombinant plasmid pET32a-BV2. Recombinant Escherichia coli E.coli BL21 (DE3) / pET32a-BV2 expressing Baeyer-Villiger monooxygenase was obtained by heat shock transformation of E.coli BL21 (DE3).

[0026] The recombinant vector pET32a-BV2 was used as a template to construct a random mutation library using error-prone PCR technology. The forward primer BV2-F was 5'-acgacaaggccatggctgatatcggatcc--3' (the bold italics are the BamHI restriction site, SEQ ID No. 9), and the reverse primer BV2-R was 5'-tcagtggtggtggtggtggtgctcgag--3' (the bold italics are the Xho I restriction site, SEQ ID No. 10). The reaction system of error-prone PCR is: PCR Grade Water 39μL, 10×TITANIUMTaqBuffer 5μL, MnSO48 mM 1μL, dGTP 2mM1μL, 50×Diversify dNTP Mix 1μL, primer mixture 1μL, template 1μL, TITANIUM TaqPolym 1μL, a total of 50μL system, wherein the primer mixture in the reaction system is a mixed solution of 0.5μL of each upstream and downstream primer. The error-prone PCR reaction conditions are: 94℃30s, 1 cycle; 94℃30s, 68℃1min30s, 25 cycles; 68℃1min, 1 cycle. The error-prone PCR amplification product was detected with 1% agarose gel and purified with AxyPrep DNA gel recovery kit. The purified fragments were homologously recombined with the double-digested vector pET32a (BamHI and XhoI). The reaction system was: 4μL 5×CE II Buffer, 2μL Exase II, and 20μL was supplemented with ddH2O. After mixing, the mixture was incubated at 37°C for 30 minutes, and immediately placed on ice for 10 minutes, and then transformed into E. coli BL21 (DE3). The cells were cultured at 37°C and 200r / min for 1 hour for activation. The activated recombinant cells were spread on LB plates containing 100mg / L ampicillin resistance and incubated at 37°C overnight to obtain the Baeyer-Villiger monooxygenase mutant expression library.

[0027] A high-throughput screening method was used to screen highly active mutant strains from the obtained Baeyer-Villiger monooxygenase mutant expression library colonies. The specific screening method is as follows: 2,000 single colonies were randomly picked from the plate, inoculated into a 96-deep-well plate, the culture medium was LB liquid culture medium, cultured at 37°C, 180r / min for 6 hours, inoculated into a fermentation medium at a 5% inoculation rate, cultured at 37°C, 220r / min for 6 hours, IPTG was added to a final concentration of 0.5mM and the temperature was lowered to 20°C to induce expression; the bacteria were collected by centrifugation and the enzyme activity was determined. Standard enzyme activity detection system: Baeyer-Villiger monooxygenase wet cells 10g / L, 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester 5g / L, methanol 50mL / L, NADP 0.2g / L, glucose 10g / L, glucose dehydrogenase bacteria 10g / L, reaction pH and temperature are 7.5 and 30℃ respectively. Definition of unit enzyme activity: Under standard reaction conditions, the amount of enzyme required to generate 1μmol (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester per minute is one enzyme activity unit U. A highly active Baeyer-Villiger monooxygenase mutant strain was screened and sequenced to be a Baeyer-Villiger monooxygenase mutant (base sequence is SEQ ID No. 3, amino acid sequence is SEQ ID No. 4) in which alanine at position 213 in the amino acid sequence shown in SEQ ID NO: 2 is mutated to glutamine, glycine at position 312 is mutated to alanine, and serine at position 434 is mutated to tyrosine (BV2-A213Q-G312A-S434Y). The corresponding engineering strain is E. coli BL21 (DE3) / pET32a-BV2-A213Q-G312A-S434Y. The enzyme activity of the mutant is shown in Table 1;

[0028] Table 1 Enzyme activity of Baeyer-Villiger monooxygenase mutants

[0029]

[0030] Example 2: Production of Baeyer-Villiger monooxygenase BV2 mutant A213Q-G312A-S434Y by fermentation using recombinant bacteria and enzymatic conversion to produce (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester.

[0031] (1) The BV2 mutant was inoculated into LB slant medium and cultured at 37°C for 14 hours; the slant strain was inoculated into LB liquid seed medium and cultured at 37°C and 200 r / min for 6 hours. The seed liquid was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of fermentation medium at a 5% inoculation amount and cultured at 37°C and 220 r / min for 4 hours. The temperature was lowered to 25°C and 1 mmol / L isopropyl-β-D-thiogalactopyranoside (IPTG) was added to induce expression for 16 hours. After the fermentation was completed, the cells were collected by centrifugation at 8000 r / min and 4°C for 10 minutes, and the cells were washed twice with sterile saline to obtain the Baeyer-Villiger monooxygenase BV2 mutant whole cell catalyst.

[0032] (2) The whole cell of Baeyer-Villiger monooxygenase mutant was used to catalyze the production of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester. The conversion conditions were as follows: 50 g / L of Baeyer-Villiger monooxygenase mutant cells, 20 g / L of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester, 50 mL / L of dimethyl sulfoxide, and NADP 0.2g / L, glucose 30g / L, glucose dehydrogenase bacteria 10g / L, pH7.5, reaction volume 20mL, put into 100mL Erlenmeyer flask and place on air shaker open for reaction, shaker speed 200r / min, reaction at 30℃ for 5h, liquid phase determination of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester concentration is 20.4g / L, molar conversion rate is 95.3%, ee%>99%.

[0033] Example 3: (1) The BV2 mutant was inoculated into LB slant medium and cultured at 37°C for 12 hours; the slant strain was inoculated into LB liquid seed medium, and cultured at 37°C and 200 r / min for 6 hours. The seed liquid was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of fermentation medium at a 5% inoculation amount, and cultured at 37°C and 220 r / min for 4 hours. The temperature was lowered to 25°C and 1 mmol / L isopropyl-β-D-thiogalactopyranoside (IPTG) was added to continue inducing expression for 16 hours. After the fermentation was completed, the cells were collected by centrifugation at 8000 r / min and 4°C for 10 minutes, and the cells were washed twice with sterile saline to obtain the Baeyer-Villiger monooxygenase BV2 mutant whole cell catalyst.

[0034] (2) The whole cell of Baeyer-Villiger monooxygenase mutant was used to catalyze the production of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester. The conversion conditions were as follows: 70 g / L of Baeyer-Villiger monooxygenase mutant cells, 50 g / L of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester, 50 mL / L of methanol, and NADP 0.2g / L, glucose 80g / L, glucose dehydrogenase bacteria 10g / L, pH7.0, reaction volume 20mL, put into 100mL Erlenmeyer flask and place on air shaker open for reaction, shaker speed 200r / min, reaction at 30℃ for 10h, liquid phase determination of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester concentration is 50.9g / L, molar conversion rate is 95.0%, ee%>99%.

[0035] Example 4: Production of Baeyer-Villiger monooxygenase BV2 mutant A213Q-G312A-S434Y by fermentation using recombinant bacteria and enzymatic conversion to produce (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester.

[0036] (1) The Baeyer-Villiger monooxygenase BV2 mutant A213Q-G312A-S434Y was inoculated into LB slant medium and cultured at 37°C for 14 hours; the slant strain was inoculated into LB liquid seed medium and cultured at 37°C and 200 r / min for 6 hours. The seed liquid was inoculated into a 500 mL Erlenmeyer flask containing 50 mL fermentation medium at a volume ratio of 3%, and cultured at 37°C and 220 r / min for 4 hours. The temperature was lowered to 20°C and 0.5 mmol / L isopropyl-β-D-thiogalactopyranoside (IPTG) was added to induce expression for 16 hours. After the fermentation was completed, the cells were collected by centrifugation at 8000 r / min and 4°C for 10 minutes, and the cells were washed twice with sterile saline to obtain the Baeyer-Villiger monooxygenase mutant whole cell catalyst.

[0037] (2) The whole cell of Baeyer-Villiger monooxygenase mutant was used to catalyze the production of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester. The conversion conditions were as follows: 100 g / L of Baeyer-Villiger monooxygenase mutant cells, 100 g / L of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester, 50 mL / L of dimethyl sulfoxide, and 100 mL / L of NADP. .2g / L, glucose 150g / L, glucose dehydrogenase bacteria 10g / L, pH8.0, reaction volume of 20mL, put into 100mL Erlenmeyer flask and place on air shaker open for reaction, shaker speed 200r / min, reaction at 37℃ for 15h, liquid phase determination of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester concentration is 99.8g / L, molar conversion rate is 93.2%, ee%>99%.

[0038] Comparative Example 1: Production of Baeyer-Villiger monooxygenase BV2 by fermentation using recombinant bacteria and enzymatic conversion to produce (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester.

[0039] (1) The BV2 engineering strain was inoculated into LB slant medium and cultured at 37°C for 14 hours; the slant strain was inoculated into LB liquid seed medium and cultured at 37°C and 200 r / min for 6 hours. The seed liquid was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of fermentation medium at a 5% inoculation amount and cultured at 37°C and 220 r / min for 4 hours. The temperature was lowered to 25°C and 1 mmol / L isopropyl-β-D-thiogalactopyranoside (IPTG) was added to induce expression for 16 hours. After the fermentation was completed, the cells were collected by centrifugation at 8000 r / min and 4°C for 10 minutes, and the cells were washed twice with sterile saline to obtain the Baeyer-Villiger monooxygenase BV2 mutant whole cell catalyst.

[0040] (2) The whole cell of Baeyer-Villiger monooxygenase mutant was used to catalyze the production of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester. The conversion conditions were as follows: 50 g / L of Baeyer-Villiger monooxygenase mutant cells, 20 g / L of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester, 50 mL / L of dimethyl sulfoxide, and NADP 0.2g / L, glucose 30g / L, glucose dehydrogenase bacteria 10g / L, pH7.5, reaction volume 20mL, put into 100mL Erlenmeyer flask and place on air shaker open for reaction, shaker speed 200r / min, reaction at 30℃ for 5h, liquid phase determination of (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester concentration is 15.2g / L, molar conversion rate is 71%, ee%>99%.

[0041] The parameters in the above embodiment are only one specific implementation mode. Any change in the parameters based on the above shall be within the protection scope of the present invention without departing from the scope of the present invention.

[0042] Nucleotide sequence of Baeyer-Villiger monooxygenase (organism: Pseudomonas fluorescens ACB, sequence number SEQ ID No. 1):

[0043]

[0044] The amino acid sequence of Baeyer-Villiger monooxygenase (organism: Pseudomonas fluorescens ACB, sequence number SEQ ID No. 2):

[0045] .

[0046] Nucleotide sequence of Baeyer-Villiger monooxygenase mutant (organism: artificially synthesized, sequence number SEQ ID No. 3):

[0047]

[0048] Amino acid sequence of Baeyer-Villiger monooxygenase mutant (organism: artificially synthesized, sequence number SEQ ID No. 4):

[0049] .

[0050] The base sequence of Bacillus tequilensis glucose dehydrogenase (organism: Bacillus tequilensis, sequence number SEQ ID No. 5):

[0051] ATGGGTAAATTTGAAGGTAAAATAGCGCTTGTAACGGGTGGAACAAGTGGTATTGGTCTTGCTACAGCACAAAAATTTGTAAACGAAGGTGCATATGTTTATATCACGGGACGTAGACAAAATGAACTTGATAAAGCTGTTAACCAAATTGGCAAGAACGTAACCGGTGTTCAAGGTGATATTTCTAAGCTTGAAGACTTAGACAAACTATATGACATTATAAAGCAGGAAAAAGGTAAGTTGGACATTCTTTTTGCTAATGCAGGCACCGGCAACTTCCTTCCATTAGGTGAAATTACTGAAGAGCAGGTTGATAGAACGTTCGACATTAACGTTAAAGGAACCATCTTTACTGTTCAAAAAGCGTTATCACTATTCCCGGACAAAGTAGGTTCTATTATTGTAACGGGCTCTACTGCTGGATCAATTGGCAACCCAGCGTTTAGTGTATATGGAGCATCTAAAGCAGCATTAAGAGCACTAGTTCGCAACTGGATTCTTGACCTAAAAGGGACTGAAATCCGCGTAAATGTGGTTAGTCCAGGAGTTATTCTTACACCTGCATACGATGAGCTTTTTGGTGATGCACTTGAAGGAGCAATGGAGAATACCAGAAATACTGTTCCAGCTGGAAAAGTTGGGACACCTGAAGAAGTAGCAAACGCTGTATCTTTCCTTGCTTCAGACGAAAGCAGTTACTTGACGGGTGTTGAATTGTTCGTAGATGGCGGGCTAGCACAGGTATAA。

[0052] Amino acid sequence of glucose dehydrogenase from Bacillus tequilensis (Organism: Bacillus tequilensis, Sequence Listing No. SEQ ID No. 6):

[0053] MGKFEGKIALVTGGTSGIGLATAQKFVNEGAYVYITGRRQNELDKAVNQIGKNVTGVQGDISKLEDLDKLYDIIKQEKGKLDILFANAGTGNFLPLGEITEEQVDRTFDINVKGTIFTVQKALSLFPDKVGSIIVTGSTAGSIGNPAFSVYGASKAALRALVRNWILDLKGTEIRVNVVSPGVILTPAYDELFGDALEGAMENTRNTVPAGKVGTPEEVANAVSFLASDESSYLTGVELFVDGGLAQV.

Claims

1. A Baeyer-Villiger monooxygenase mutant, characterized in that The mutant is BV2-A213Q-G312A-S434Y, which is a Baeyer-Villiger monooxygenase mutant in which alanine at position 213 is mutated to glutamine, glycine at position 312 is mutated to alanine, and serine at position 434 is mutated to tyrosine based on the amino acid sequence shown in SEQ ID NO:

2.

2. A Baeyer-Villiger monooxygenase mutant according to claim 1, characterized in that The nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2 is shown in SEQ ID NO:

1.

3. A Baeyer-Villiger monooxygenase mutant according to claim 1, characterized in that The encoding gene of the Baeyer-Villiger monooxygenase mutant is shown in SEQ ID NO:

3.

4. An engineered bacterium, characterized in that: The engineered bacteria contains the coding gene of the mutant according to claim 3.

5. Use of the Baeyer-Villiger monooxygenase mutant according to any one of claims 1 to 3 and the engineered bacteria according to claim 4, characterized in that: The application method is to use the Baeyer-Villiger monooxygenase mutant or engineered bacteria to catalyze 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester to synthesize (S)-5-chloro-2,3-dihydro-2-hydroxy-1-oxo-1H-indene-2-carboxylic acid methyl ester.

6. The use according to claim 5, characterized in that: The co-solvent is a mixture of one or more of ethanol, acetonitrile, methanol and dimethyl sulfoxide.

7. A biological agent, characterized in that: The biological preparation contains the mutant described in any one of claims 1 to 3 or the engineered bacteria described in claim 4.

Images