Use of osaap16 in regulating grain type and weight of rice
By knocking out or overexpressing the OsAAP16 gene and using CRISPR/Cas9 technology to regulate rice grain length, grain width and 1000-grain weight, the problem of insufficient application of rice grain shape genes in existing technologies is solved, and grain optimization is achieved, which has important breeding significance.
Patent Information
- Application Number
- CN202310543185.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-15
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-05-15
AI Technical Summary
In the existing technology, the application of rice grain shape genes in actual production still has problems, and there is a lack of new genes for regulating grain shape to cultivate large-grain varieties.
By knocking out or overexpressing the OsAAP16 gene, using CRISPR/Cas9 technology to construct a vector and transform rice, the grain length, grain width and 1000-grain weight of rice grains can be regulated, thereby increasing or decreasing the grain length, grain width and grain weight.
The grain length, width and 1000-grain weight of rice grains were successfully regulated. Knocking out the OsAAP16 gene increased the grain length, width and 1000-grain weight of the grains; overexpressing the OsAAP16 gene shortened the grain length, narrowed the grain width and reduced the 1000-grain weight of the grains, which has important breeding significance.
Smart Images

Figure CN118956887B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of rice genetic engineering, and particularly relates to application of OsAAP16 in regulating rice grain type and grain weight. BACKGROUND
[0002] Three factors affecting the yield of rice crops are effective panicle number per plant, grain number per panicle and 1000-grain weight, and the rice grain type is an important factor for determining the 1000-grain weight and further affecting the yield of rice.
[0003] According to statistics, more than 600 QTLs related to grain type have been successfully located, including 136 QTLs related to grain length, 139 QTLs related to grain width, 53 QTLs related to grain thickness, 74 QTLs related to length-width ratio, and 220 QTLs related to grain weight. Studies have found that a single base substitution in the second exon of GS3 in large-grain varieties leads to an increase in rice grain size (Wan X Y, Wan J M, Jiang L, et al. QTL analysis for rice grain length and fine mapping of an identified QTL with stable and major effects[J]. Theoretical and Applied Genetics, 2006, 112(7): 1258-1270). GL7 leads to an increase in rice grain length due to a 17.1 kb tandem repeat in its locus (Wang Y X. Cloning, functional research and breeding utilization of rice grain shape gene GL7[D]. Beijing: Chinese Academy of Agricultural Sciences, 2015). GW2 negatively regulates rice grain width and weight mainly by inhibiting the division of rice hull cells and the rate of grain filling (SONG X J, HUANG W, SHIM, et al. A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase[J]. Nature Genetics, 2007, 39(5): 623-630). qSW5 / GW5 has a similar function to GW2, negatively regulating rice grain width by inhibiting the division of hull cells; GW8 positively regulates grain width, mainly by affecting genes related to the cell cycle of hull cells and thereby affecting grain width (Wang S, Wu K, Yuan Q, et al. Control of grain size, shape and quality by OsSPL16 in rice[J]. Nature genetics, 2012, 44(8): 950). GW7, TGW3, and GS2 can all change the length-width ratio of rice grains by changing the cells of rice grains.Through the aggregation of yield advantage genes such as GS3 and GW5 into the male parent 9311, the Jiangsu Academy of Agricultural Sciences successfully bred the super hybrid rice variety Liangyoupeijiu (Zeng D, Tian Z, Rao Y, et al. Rational design of high-yield and superior-quality rice [J]. Nature plants, 2017, 3(4): 17031), which has been widely used in many regions of China.
[0004] It is of great significance to convert the basic research of grain type into practical application for improving crop yield. So far, great progress has been made in the research of the localization and principle of different grain type genes of rice, but there are still different problems in the application of these grain type genes in actual production. Therefore, new genes for regulating grain type need to be explored to provide new choices for breeding large-grain varieties. SUMMARY
[0005] Therefore, the purpose of the present application is to provide the application of OsAAP16 gene in regulating the grain type and grain weight of rice, and the amino acid transporter protein OsAAP16 encoded by the OsAAP16 gene can negatively regulate the grain length, grain width and thousand-grain weight of rice.
[0006] To solve the above technical problems, the present application provides the following technical solutions.
[0007] The present application provides the application of OsAAP16 gene in regulating the grain type and grain weight of rice, and the OsAAP16 gene encodes a protein consisting of the amino acid sequence shown in SEQ ID NO. 1.
[0008] Preferably, the nucleotide sequence of the OsAAP16 gene is shown in SEQ ID NO. 2.
[0009] Preferably, the coding sequence of the OsAAP16 gene is shown in SEQ ID NO. 3.
[0010] Preferably, the regulation refers to knocking out the OsAAP16 gene, and the grain length, grain width and grain weight of rice are all increased; overexpressing the OsAAP16 gene, and the grain length, grain width and grain weight of rice are all reduced.
[0011] The present application provides a method for increasing the grain length, grain width and grain weight of rice, a target site is designed for the OsAAP16 gene to construct a CRISPR / Cas9 vector, the constructed vector is genetically transformed into rice, and a homozygous deletion mutant plant is obtained by screening, and the grain length, grain width and grain weight of the mutant plant are all increased.
[0012] Preferably, the nucleotide sequence of the target site is shown as SEQ ID NO. 13.
[0013] The application also provides a method for reducing the grain length, grain width and grain weight of rice, wherein the OsAAP16 gene is constructed into an expression vector, the rice is transformed, a homozygous positive transgenic plant is obtained, and the grain of the positive transgenic plant is collected, and the grain length, grain width and grain weight of the grain are reduced.
[0014] Preferably, the expression vector is a modified pCambia1300 skeleton vector.
[0015] Preferably, the rice is Zhonghua 11.
[0016] Preferably, the homozygous positive transgenic plant is obtained through hygromycin screening and genome level identification.
[0017] The application provides an application of OsAAP16 in regulating the grain type and grain weight of rice, and the application confirms that the amino acid transporter protein OsAAP16 encoded by the OsAAP16 gene can negatively regulate the grain length, grain width and thousand-grain weight of rice by constructing a gene knockout vector and an overexpression vector of OsAAP16 and transforming the rice plant, wherein the grain length of the rice is lengthened, the grain width is widened, and the thousand-grain weight is increased by knocking out the OsAAP16 gene in the rice; and the grain length of the rice is shortened, the grain width is narrowed, and the thousand-grain weight is reduced by overexpressing the OsAAP16 gene in the rice. The application has important significance for subsequent breeding of rice. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 Figure 6 is a mutation type identification diagram of the gene knockout material;
[0019] Figure 2 Figure 7 is a grain length and grain width phenotype diagram of the gene knockout material, wherein A is the grain length and B is the grain width;
[0020] Figure 3 Figure 8 is a grain length, grain width and thousand-grain weight data statistical diagram of the gene knockout material, wherein A is the grain length, B is the grain width, and C is the thousand-grain weight;
[0021] Figure 4 Figure 9 is an overexpression material OsAAP16 relative expression amount data analysis diagram;
[0022] Figure 5 Figure 10 is a grain length and grain width phenotype diagram of the OsAAP16 overexpression material, wherein A is the grain length and B is the grain width;
[0023] Figure 6 Figure 11 is a grain length, grain width and thousand-grain weight data statistical diagram of the OsAAP16 overexpression material, wherein A is the grain length, B is the grain width, and C is the thousand-grain weight. DETAILED DESCRIPTION
[0024] The application provides application of an OsAAP16 gene in regulating grain type and grain weight of rice, wherein the OsAAP16 gene encodes a protein consisting of an amino acid sequence shown in SEQ ID NO. 1.
[0025] In the application, the nucleotide sequence of the OsAAP16 gene is shown in SEQ ID NO. 2, and the coding sequence of the OsAAP16 gene is shown in SEQ ID NO. 3. The protein consisting of the amino acid sequence shown in SEQ ID NO. 1 is an amino acid transporter OsAAP16; the OsAAP16 negatively regulates grain length, grain width and 1000-grain weight of rice, and the regulation refers to that when the OsAAP16 gene is knocked out, the grain length, grain width and grain weight of rice are all increased; when the OsAAP16 gene is overexpressed, the grain length, grain width and grain weight of rice are all reduced.
[0026] The application provides a method for increasing grain length, grain width and grain weight of rice, a target site is designed according to the OsAAP16 gene to construct a CRISPR / Cas9 vector, the constructed vector is genetically transformed into rice, and a homozygous deletion mutant plant is obtained through screening, so that the grain length, grain width and grain weight of the mutant plant are all increased.
[0027] In the application, the nucleotide sequence of the target site is preferably the reverse complementary sequence of a gene coding sequence CGCCGTGATGCTCCTCTTCG: CGAAGAGGAGCATCACGGCG (SEQ ID NO. 13). In the application, the transformed rice is preferably Nipponbare. The application does not have special limitation on the specific construction method of the CRISPR / Cas9 gene knockout vector, and the vector can be constructed according to the conventional technical means in the art. In the application, the homozygous deletion mutant plant is preferably screened and identified, the identification primer is preferably designed according to the upstream and downstream of the target site, and the specific sequence of the primer is preferably as follows:
[0028] Identification primer F: AGTTTGGCAAGTACTCCACTA (SEQ ID NO. 4)
[0029] Identification primer R: GGCGTCCATGTAGGTGTAGTT (SEQ ID NO. 5).
[0030] The application also provides a method for reducing grain length, grain width and grain weight of rice, the OsAAP16 gene is constructed into an expression vector, the rice is transformed, a homozygous positive transgenic plant is obtained, and the grains of the positive transgenic plant are collected, so that the grain length, grain width and grain weight of the grains are all reduced.
[0031] In the present application, the OsAAP16 gene is preferably amplified by taking Nipponbare cDNA as template; the primers for amplification are preferably OE16-BamH1-F: CAGGTCGACTCT AGAGGATCCATGGCGTCGGGGCAGAAGGTGGTGA (SEQ ID NO. 6) and OE16-Sac1R: CGATCGGGGAAATTCGAGCTCTCATCCGCTG AACGGTCTGTACAC (SEQ ID NO. 7). In the present application, the expression vector is preferably a modified pCambia1300 backbone vector, and the modification method is preferably as follows: connecting the Ubi promoter sequence and the poly-cloning enzyme point sequence fragment on the pUN1301 vector to the pCambia1300 vector to obtain the modified pCambia1300 backbone vector. In the present application, the rice is preferably Zhonghua 11. In the present application, the homozygous positive transgenic plant is preferably obtained by hygromycin screening and genome level identification.
[0032] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be described in detail below in conjunction with the embodiments, but they should not be understood as limiting the scope of protection of the present application.
[0033] In the following examples, all are conventional methods unless otherwise specified.
[0034] In the following examples, the materials, reagents and the like used are commercially available unless otherwise specified.
[0035] Example 1
[0036] Construction of OsAAP16 gene knockout strain:
[0037] 1. A target site CGAAGAGGAGCATCACGGCG (SEQ ID NO. 13) is designed for OsAAP16, and a vector is constructed by CRISPR / Cas9 technology by BGI-GENOMICS (Jiangsu) Co., Ltd., and is genetically transformed into Nipponbare variety.
[0038] 2. The mutation type identification steps of the gene knockout material are as follows:
[0039] (1) CTAB method to extract rice genomic DNA: Take fresh gene knockout material leaves or roots to 2 mL centrifuge tube, liquid nitrogen freeze grinding to powder, add 600 μL 2% CTAB extraction buffer, gently stir, placed in 65°C water bath for 60 min, every 15 min during the reverse mixed, cooled 2 min after adding equal volume of chloroform reverse mixed, 12000 rpm centrifugation 10 min, take 400 μL supernatant to a new centrifuge tube, take equal volume of isopropanol, reverse mixed, 12000 rpm centrifugation 10 min discard supernatant, add 1 mL 75% ethanol, light transfer or light pipe tip, so that the DNA block precipitated in the tube bottom floating in the liquid, placed 2 min after 12000 rpm centrifugation 3 min discard supernatant, 7000 rpm centrifugation 15 s, gun head suction residual liquid, dry DNA (natural air dry or air blower dry), add 30 μL sterile ultrapure water, dissolve the resulting DNA;
[0040] (2) a pair of specific primers are designed for the target site upstream and downstream of CRISPR material, for mutant genotype detection; wherein:
[0041] Identification primer F: AGTTTGGCAAGTACTCCACTA (SEQ ID NO. 4)
[0042] Identification primer R: GGCGTCCATGTAGGTGTAGTT (SEQ ID NO. 5)
[0043] Another target site of OsAAP16 knockout, there is another matching site in the rice genome, located in the gene LOC_Os12g08130 (http: / / rice.uga.edu / website accession number), in order to determine the mutation of the site, the specific primers are also designed in the upstream and downstream of the matching region for detection; wherein:
[0044] Identification primer F2: CGGCAACTCAGACTCCTCCAT (SEQ ID NO. 12)
[0045] Reverse primer is the same as identification primer R (SEQ ID NO. 5);
[0046] Each 2 μL total DNA was used as a template, and identification primer F + identification primer R, identification primer F2 + identification primer R were used as amplification primers for PCR amplification, the PCR reaction system was shown in Table 1, the amplification program was shown in Table 2, and Hunan Qikexing Biotechnology Co., Ltd. was commissioned to sequence the product using identification primer F and identification primer F2, and the mutation type of each single strain was determined according to the sequencing results of the PCR amplified fragments. After sequencing comparison, the Cr541-11 strain with homozygous deletion of 5 bp of OsAAP16 and only one base T changed to C of LOC_Os12g08130 was finally identified, but the encoded amino acid did not change (GGT to GGC, both were glycine); the results were shown in Figure 1 .
[0047] Table 1 PCR reaction system
[0048]
[0049] Table 2 PCR amplification program
[0050]
[0051] 3. After the homozygous plants were harvested, the grain length, grain width and thousand seed weight were counted using Wanshen SC-G automatic seed analysis instrument, and the data were analyzed and plotted using GraphPad Prism 8, and Figure 2 and Figure 3 were obtained.
[0052] It was found that the grain length of the wild type material was 7.45 mm, the grain width was 3.26 mm, and the thousand seed weight was 25.81 g; the grain length of the knockout mutant Cr541-11 was 7.61 mm, the grain width was 3.32 mm, and the thousand seed weight was 27.30 g. The grain length of Cr541-11 increased by 0.16 mm, the grain width increased by 0.06 mm, and the thousand seed weight increased by 1.49 g. Knocking out OsAAP16 led to longer grain length, wider grain width and increased thousand seed weight of rice grains.
[0053] Example 2
[0054] 1. The specific steps for constructing the OsAAP16 overexpression strain were as follows:
[0055] (1) The Ubi promoter sequence and the multi-cloning site sequence fragment on the pUN1301 vector were connected to the pCambia1300 vector by using Hind3 and Sac1 enzyme points, and a modified pCambia1300 backbone vector was obtained, which was used for subsequent overexpression of OsAAP16;
[0056] (2) The OsAAP16 (LOC_Os12g08090) cDNA sequence was downloaded from the RGAP database (http: / / rice.uga.edu / ), and the amplification primers OE16-Ba mH1-F (SEQ ID NO. 6) and OE16-Sac1R (SEQ ID NO. 7) for the overexpression vector were designed.
[0057] (3) Using the sequenced japonica rice variety Nipponbare cDNA as a template, PCR amplification of the target band was performed using Vazyme's 2×Phanta Master (P511-03). The reaction system and amplification procedures are shown in Tables 3 and 4.
[0058] Table 3 PCR reaction system
[0059]
[0060] Table 4 PCR amplification program
[0061]
[0062] (4) The PCR amplified product was subjected to agarose gel electrophoresis and recovered. The modified pCambia1300 backbone vector was double-digested with BamH1 and Sac1 to recover the fragment. The PCR recovered product was recombined with the vector recovered fragment. The recombinant ligation was carried out using Vazyme's ClonExpress II One Step Cloning Kit enzyme at 37°C for 30 minutes. The ligation system is shown in Table 5.
[0063] Table 5 Ligation reaction system
[0064]
[0065] The PCR amplification product was recovered from the gel using the AxyPrep DNA Gel Recovery Kit (AP-GX-250). The specific steps are as follows:
[0066] a. Cut the agarose gel containing the target DNA under UV light;
[0067] b. Add 600 μL of Buffer DE-A, mix well, and heat at 75°C until the gel is completely melted;
[0068] c. Add 300 μL of Buffer DE-B and mix well;
[0069] d. Pipette the mixture from step c and transfer it to a DNA preparation tube. Centrifuge at 12,000 × g for 1 min and discard the filtrate.
[0070] e. Put the preparation tube back into the centrifuge tube, add 0.5 mL Buffer Wl, centrifuge at 12000 x g for 30 s, discard the filtrate;
[0071] f. Put the preparation tube back into the centrifuge tube, add 0.7 mL Buffer W2 (add anhydrous ethanol according to the specified volume on the reagent bottle before use), centrifuge at 12000 x g for 30 s, discard the filtrate; wash once more with 0.7 mL Buffer W2 in the same way, centrifuge at 12000 x g for 1 min;
[0072] g. Put the preparation tube into a 2 mL centrifuge tube, centrifuge at 12000 x g for 1 min;
[0073] h. Put the preparation tube into a clean 1.5 mL centrifuge tube, add 30 μL sterile ultrapure water in the center of the DNA preparation membrane, stand at room temperature for 1 min; centrifuge at 12000 x g for 1 min to elute the DNA;
[0074] (5) Transform the expression vector connected in step (4) into E. coli, and coat it on a LB plate containing Kan+resistance for screening, the specific steps are as follows:
[0075] a. Take 10 μL of the recombination product and add it to 100 μL of competent cells DH5α that have been thawed on ice in advance, mix it by flicking the tube wall, and stand it on ice for 30 min;
[0076] b. After placing it in a water bath at 42°C for 45 s, immediately place it on ice to cool for 2 min 30 s;
[0077] c. Add 900 μL of LB liquid medium without adding antibiotics, and place it in a shaker (37°C, rotation speed 230 rmp) for 1 h;
[0078] d. Preheat the LB solid medium with the corresponding antibiotic added in a 37°C incubator;
[0079] e. Centrifuge at 5000 rpm for 5 min at room temperature, discard 900 μL of supernatant, resuspend the bacterial cells with the remaining medium, and evenly coat it on the plate with a sterile coating rod; finally, incubate it in a 37°C incubator overnight;
[0080] (6) After the culture medium in step (5) is left overnight, a single colony is picked up, and after positive clones are identified by liquid bacterial PCR, sequencing is performed by Hunan Qikexing Biotechnology Co., Ltd., the primers used are Ubi-F: CCTGCCTTCATACGCTATTT (SEQ ID NO. 8) and M13-R: CAGGAAACAGCTATGACC (SEQ ID NO. 9); the plasmid of the liquid bacterial solution with correct sequencing is extracted to obtain an overexpression plasmid vector; wherein the SanPrep column plasmid DNA small extraction kit (B518191-0100) of Shengong is used for plasmid extraction;
[0081] (7) The overexpression plasmid vector obtained in step (6) is genetically transformed into the receptor material Zhonghua 11 by Baige Gene Technology (Jiangsu) Co., Ltd., and an overexpression strain is obtained.
[0082] 2. Gene expression level detection
[0083] (1) Overexpression plant RNA extraction:
[0084] a. Homogenate treatment, mortar is pre-cooled in a-20°C refrigerator overnight or pre-cooled in liquid nitrogen for 30 s, leaf and root tissue of the overexpression rice plant are ground in liquid nitrogen, after grinding, they are quickly transferred to a 1.5 mL RNA free centrifuge tube; 1 mL Trizol (50-100 mg / mL Trizol) is added, mixed thoroughly, and placed at room temperature for 5 min to completely separate the nucleic acid protein complex, after 5 min on ice, shake again, and then place at room temperature for 10 min;
[0085] b. 0.2 mL chloroform is added, and after vigorous shaking for 15 s, it is placed at room temperature for 5 min;
[0086] C. 4°C refrigerated centrifuge, 12000 rpm, centrifugation for 15 min; after centrifugation, the sample is layered, wherein the upper layer is RNA colorless water phase; the middle layer is DNA and broken tissue phase; and the lower layer is protein, phenol and chloroform phase;
[0087] d. 600 μL of supernatant is taken and placed in a new RNA free centrifuge tube;
[0088] e. 0.12 mL of chloroform is added, and after vigorous shaking, it is placed at room temperature for 5 min (do not shake in the middle);
[0089] f. 4°C refrigerated centrifuge, 12000 rpm, centrifugation for 10 min, and about 500 μL of supernatant is taken and placed in a new RNA free centrifuge tube;
[0090] g. Add 0.5 mL of isopropyl alcohol, mix well, and stand at room temperature for 10 min; centrifuge at 12000 rpm at 4°C for 10 min; this step precipitates RNA; at this time, prepare an agarose gel for subsequent RNA gel electrophoresis band detection;
[0091] h. Wash and discard the supernatant (do not pour out the RNA precipitate), add 1 mL of 75% ethanol, and wash the precipitate;
[0092] i. Centrifuge at 7500 rpm at 4°C for 5 min in a refrigerated centrifuge, and discard the supernatant; centrifuge briefly again and discard the supernatant completely;
[0093] j. Dry at room temperature on a clean bench for 5-10 min;
[0094] k. Add 30 μL of DEPC water, tap the bottom of the tube to mix well, and dissolve the RNA on ice for 3 min to obtain the RNA extraction solution.
[0095] (2) RNA reverse transcription to synthesize cDNA:
[0096] Use the HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) kit from Vazyme for reverse transcription. Add the reaction system to a 200 μL RNA-free centrifuge tube, and follow the reverse transcription operation steps as follows:
[0097] a. Remove residual genomic DNA: Configure the mixture (Table 6) in an RNase-free centrifuge tube, gently mix with a pipette, and incubate at 42°C for 2 min;
[0098] Table 6 Reverse transcription reaction system
[0099]
[0100] b. Prepare the reverse transcription reaction system (20 μL system), directly add 4xHifai III SuperMix plus to the reaction tube of step 1, gently mix with a pipette, and then perform the following table program reaction (Table 7) in a PCR instrument to synthesize cDNA. The product after the reaction can be immediately used for qPCR reaction, or stored in a -20°C refrigerator for standby.
[0101] Table 7 Reverse transcription operation steps
[0102]
[0103] (3) Real-time fluorescent quantitative PCR:
[0104] Use OsACTIN1 as the internal reference gene, and use the qPCR kit from YEASEN Company qPCR Green Master Mix(High Rox Plus) reagent was used to detect the expression of OsAAP16 in overexpression lines, and the primer sequences were as follows:
[0105] qRT-OE16-F: GTCTCGCTCAAGACGCTCAG (SEQ ID NO. 10);
[0106] qRT-OE16-R: GGGAAATTCGAGCTCTCATCC (SEQ ID NO. 11);
[0107] The reverse primer part is located in the OsAAP16 sequence and the vector binding site, and part is located in the vector sequence. The reaction system is shown in Table 8, and the amplification procedure is shown in Table 9:
[0108] Table 8 qRT-PCR reaction system
[0109]
[0110] Table 9 qRT-PCR reaction system
[0111]
[0112]
[0113] (4) Analyze the real-time fluorescence quantitative PCR data to obtain the expression amount of OsAAP16 in overexpression lines OE16-32 and OE16-33, and perform data analysis and mapping by using GraphPad Prism 8, and the results are as follows Figure 4 .
[0114] 3. According to the high and low of the expression level of the above-mentioned OsAAP16 gene, the overexpression lines OE16-32 and OE16-33 were selected to count the grain length, grain width and thousand seed weight: After the homozygous plants were harvested, the grain length, grain width and thousand seed weight were counted by using the automatic grain analysis instrument of Wan Shen SC-G, and the data analysis and mapping were performed by using GraphPad Prism 8, and the results are as follows Figure 5 and Figure 6 .
[0115] It can be seen that the grain length of wild type Zhonghua 11 is 7.41 mm, the grain width is 3.36 mm, and the 1000-grain weight is 27.76 g; the grain length of OE16-32 is 6.77 mm, the grain width is 2.91 mm, and the 1000-grain weight is 26.35 g; the grain length of OE16-33 is 6.90 mm, the grain width is 3.02 mm, and the 1000-grain weight is 26.01 g. Compared with wild type Zhonghua 11, OE16-32 and OE16-33 have significant decrease in grain length, grain width and 1000-grain weight, the 1000-grain weight of OE16-32 decreases by 5.08%, and the 1000-grain weight of OE16-33 decreases by 6.30%. It is shown that overexpression of OsAAP16 leads to shorter grain length, narrower grain width and lower 1000-grain weight of rice.
[0116] The above merely illustrates the embodiments of the present application, and does not limit the patent scope of the present application, and any equivalent structure or equivalent process transformation, or direct or indirect application in other related technical fields, are also included in the patent protection scope of the present application.
Claims
1. Application of the OsAAP16 gene in regulating rice grain shape and grain weight, characterized in that: The OsAAP16 gene encodes a protein consisting of the amino acid sequence shown in SEQ ID NO.1; the regulation refers to knocking out the OsAAP16 gene, and the grain length, grain width and grain weight of rice are all increased.
2. The use according to claim 1, characterized in that The nucleotide sequence of the OsAAP16 gene is shown in SEQ ID NO.
2.
3. The use according to claim 1, characterized in that The coding sequence of the OsAAP16 gene is shown in SEQ ID NO.
3.
4. A method for increasing rice grain length, width and weight, characterized in that: A target site was designed for the OsAAP16 gene and a CRISPR / Cas9 vector was constructed. The constructed vector was genetically transformed into rice, and homozygous deletion mutant plants were screened to obtain the mutant plants. The grain length, width and weight of the mutant plants were increased. The OsAAP16 gene encodes a protein consisting of the amino acid sequence shown in SEQ ID NO.
1.
5. The method according to claim 4, characterized in that The nucleotide sequence of the target site is shown in SEQ ID NO.13.