Rice cytokinin response regulator gene OsRR24 and its application
By overexpressing or knocking out the OsRR24 gene in rice and studying its role in resistance to brown planthoppers, the problem of the unclear mechanism of rice's insect resistance response was solved, and rice's resistance to brown planthoppers was significantly improved, providing a theoretical basis for molecular design breeding.
Patent Information
- Application Number
- CN202411301397.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-18
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-09-18
AI Technical Summary
In the existing technology, the regulatory mechanism of rice resistance to brown planthoppers is unclear, especially how the response regulatory factors in the cytokinin signaling pathway participate in the insect resistance response is still unclear, which makes rice vulnerable to diseases and pests in high temperature and high humidity environments, affecting yield.
By discovering and verifying the rice cytokinin response regulator gene OsRR24, we used genetic transformation methods to overexpress or knock out OsRR24 in rice to study its effects on resistance to brown planthoppers. We found that OsRR24 overexpressing plants enhanced resistance, while knockout plants weakened resistance, providing the molecular mechanism of OsRR24 in rice insect resistance.
OsRR24-overexpressing plants significantly enhanced their resistance to brown planthoppers, while RNAi-inhibited plants significantly weakened their resistance, providing a theoretical basis and genetic resources for the design of insect-resistant molecules in rice and improving the resistance of rice to brown planthoppers.
Smart Images

Figure CN118956899B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant genetic engineering technology, and specifically relates to a rice cytokinin response regulator gene OsRR24 and applications. Background Art
[0002] Rice ( Oryza sativa ) is one of the most important food crops in my country. During rice cultivation, the high temperature and high humidity environment are very conducive to the growth and reproduction of pathogens and pests. Therefore, there are a lot of threats from diseases and pests during rice growth. Among them, brown planthopper (BPH; Nilaparvata lugens The brown planthopper (Brown Planthopper) is one of the most widespread and devastating rice pests in my country. The brown planthopper (Brown Planthopper) is a typical piercing-sucking pest, using its specialized needle-like mouthparts to pierce rice stems and suck phloem sap, causing damage. This damage leads to nutrient loss, yellowing leaves, wilting and lodging, and severe yield reductions, even to total crop failure (Wang et al., 2008; Cheng et al., 2012). In addition to direct damage, the brown planthopper can also indirectly harm rice by spreading or inducing various diseases. According to statistics, brown planthoppers infect an average of 3.87 mu (approximately 1.2 million hectares) of rice in my country each year, resulting in approximately 1.2 million tons of rice losses, accounting for 29.5% of the total losses from various rice pests and diseases. It is the leading pest in my country's rice production (Liu Wancai et al., 2016). Therefore, curbing the development and damage of the brown planthopper is crucial to ensuring the safety of rice production in my country. Summary of the Invention
[0003] The present invention aims to provide a rice cytokinin response regulator gene OsRR24 And application, through the rice cytokinin response regulator gene OsRR24 accomplish.
[0004] Cytokinins (CKs) are widely involved in plant growth, development, and responses to biotic and abiotic stresses. Current research has found that spraying exogenous CKs significantly enhances rice resistance to the brown planthopper (Nilaparvata lugens), while spraying the CK biosynthesis inhibitor lovastatin (Lov) significantly reduces resistance. This suggests that CKs are involved in rice resistance to NLA, but the underlying mechanism remains unclear.
[0005] The perception and transduction pathway of cytokinin signals in plants is a two-component system (TCS) similar to that of bacteria, primarily composed of receptor proteins: histidine kinases (HKs), histidine-containing phosphotransfer proteins (HPs), and downstream response regulators (RRs). Within the cytokinin signaling system, RRs are the terminal components of cytokinin signal transduction and play a crucial role in plant growth, development, and responses to abiotic stresses. Based on their sequence and structural characteristics, RRs can be divided into three categories: type-A, type-B, and type-C. They all contain a conserved signal-receiving domain containing aspartate. However, unlike type-A and type-CRRs, type-B RRs, including type-A RRs, contain a DNA-binding domain that can directly regulate downstream gene expression.
[0006] Although the cytokinin signaling pathway is now well understood, how RRs mediate CK's involvement in various biological processes and which genes they directly regulate to enable hormone signaling have been hot topics in recent years. However, whether RRs participate in insect resistance and the molecular mechanisms underlying this involvement remain largely unexplored.
[0007] Rice brown planthopper resistance gene Bph6 It is a new broad-spectrum insect-resistant gene that encodes a protein that has never been studied before. It is highly resistant to brown planthoppers and white-backed planthoppers and has important application value in rice breeding for brown planthopper resistance. Bph6 However, the mechanism by which CK regulates insect resistance through specific RRs is still unclear.
[0008] In order to solve the above technical problems, the present invention adopts the following technical solutions:
[0009] The first aspect of the present invention is to provide a rice cytokinin response regulator gene OsRR24 Its CDS sequence is shown in SEQ ID NO. 1, and its ORF is 1881 bp in length.
[0010] Those skilled in the art will understand that, based on the nucleotide sequence shown in SEQ ID No. 1, replacing, deleting, and / or adding one or more nucleotides can obtain an amino acid sequence with the same function. For example, in sequences in different rice backgrounds, replacing or deleting one or more nucleotides will result in an amino acid sequence with no frameshift mutation, but only partial amino acid deletions or point mutations. Therefore, the gene described in the present invention also includes a nucleotide sequence with the nucleotide sequence shown in SEQ ID No. 1 having the same function as obtained by replacing, deleting, and / or adding one or more nucleotides.
[0011] OsRR24 Gene discovery and experimental progress:
[0012] 1) Discovery process: A rice cytokinin response regulator gene was found by screening the interacting proteins of the anti-brown planthopper protein BPH6 in the rice 9311 library. OsRR24 .
[0013] 2) Genetic transformation verification function: OsRR24 The full-length ORF of the gene was connected to the vector pRHV containing the ubi promoter, and the overexpression vector was introduced into Nipponbare using the genetic transformation method mediated by Agrobacterium EHA105. OsRR24 25 overexpression transgenic plants were grown. OsRR24 RNAi vector transformation Bph6 -NIL, and 20 knockout mutant plants were obtained.
[0014] The screening primers are
[0015] Hyg-L:GCTCCATACAAGCCAACCAC (5'-3')
[0016] Hyg-R:GAAAAAGCTGAACTCACCG (5'-3')
[0017] The insect resistance of the T3 generation homozygous transgenic plants was identified. OsRR24 Overexpression of the plant showed increased resistance to brown planthoppers. OsRR24 The resistance of knockout plants to brown planthoppers was significantly downregulated.
[0018] The second aspect of the present invention is the rice cytokinin response regulator gene OsRR24 Application in breeding rice varieties resistant to brown planthopper.
[0019] OsRR24 Method for cultivating overexpressing plants: 1) transforming plant cells with a polynucleotide containing a rice tRNA isopentenyltransferase gene OsRR241) an ORF, the nucleotide sequence of which is shown in SEQ ID NO. 1; 2) regenerating the transformed plant cell into a plant; 3) culturing the regenerated plant and overexpressing the polynucleotide.
[0020] The plant cultivated here is a monocotyledonous plant, specifically, the monocotyledonous plant is rice.
[0021] Rice cytokinin response regulator gene OsRR24 The molecular detection method is as follows: the genomic DNA of the transgenic rice to be tested is amplified using the primer pair, and the amplified product is detected. The primers are vector primers, and this sequence does not exist in the wild-type rice genome. If a 728bp amplified fragment is amplified using primers Hyg-F and Hyg-R, it indicates that the plant is transgenic-positive; if this fragment is not amplified, it indicates that the plant is transgenic-negative.
[0022] The third aspect of the present invention is to provide a protein encoded by the aforementioned gene, the amino acid sequence of which is shown in SEQ ID NO.2.
[0023] It should be understood that without affecting the gene OsRR24 On the premise that the encoded protein is active (i.e., not in the active center of the protein), those skilled in the art can make various substitutions, additions and / or deletions of one or several amino acids to the amino acid sequence shown in SEQ ID NO. 2 to obtain an amino acid sequence with equivalent function, which is all within the protection scope of the amino acid sequence.
[0024] The fourth aspect of the present invention is the use of the protein encoded by the aforementioned gene in breeding rice varieties resistant to brown planthoppers.
[0025] The fifth aspect of the present invention is the rice cytokinin response regulator gene OsRR24 recombinant vector.
[0026] The sixth aspect of the present invention is the rice cytokinin response regulator gene OsRR24 Application of recombinant vectors in breeding rice varieties resistant to brown planthopper.
[0027] The seventh aspect of the present invention is the rice cytokinin response regulator gene OsRR24 transformants.
[0028] The eighth aspect of the present invention is the rice cytokinin response regulator gene OsRR24 Application of transformants in breeding rice varieties resistant to brown planthopper.
[0029] Specifically, the present invention also includes a sense sequence or antisense sequence based on the polynucleotide, including a cloning vector or expression vector containing the polynucleotide sequence or a fragment thereof, a host cell containing the vector, a transformed plant cell containing the nucleotide sequence or a fragment thereof, and a transgenic plant.
[0030] Advantages and effects of the present invention: The rice cytokinin response regulatory factor gene OsRR24 It encodes a protein containing a DNA binding domain and a conserved aspartate-containing signal receiving domain, and is a response regulator downstream of the rice CK signaling pathway. OsRR24 During the functional process in rice, it was transferred into Nipponbare and Bph6 In the -NIL, overexpressing plants showed significantly enhanced resistance to brown planthoppers, while RNAi-inhibited plants showed significantly reduced resistance. The gene of this invention provides a good theoretical basis for studying how cytokinins participate in rice insect resistance through response regulatory factors. It has reference significance for studying gene molecular functions and also provides genetic resources for the design and breeding of insect-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:
[0032] Figure 1 The rice cytokinin response regulator gene of the present invention OsRR24 Expression detection statistics.
[0033] Figure 2 These are photos of plant growth status and charts of analysis results during the group insect resistance identification process of transgenic and knockout mutant plants at the seedling stage.
[0034] Figure 3 This is a chart showing the analysis results of insect resistance identification of transgenic and knockout mutant plants using the honeydew and insect weight gain methods. DETAILED DESCRIPTION
[0035] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the technical means used are conventional means familiar to those skilled in the art; the experimental methods used are all conventional methods and can be completed according to the described recombinant technology (see Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can all be obtained from commercial channels.
[0036] rice OsRR24 Acquisition of genes
[0037] By fighting brown planthopper genes Bph6 A cytokinin response regulator, OsRR24, was identified by screening the rice 9311 library for interacting proteins. Primers were designed for the ORF and PCR amplified using Nipponbare rice cDNA as a template using the high-fidelity enzyme KOD-Plus-Neo (TOYOBO, Japan) in a 50 µl reaction. PCR conditions were: 94°C pre-denaturation for 2 minutes, 95°C denaturation for 10 seconds, and 68°C annealing and extension for 30 seconds / kb for 32 cycles. The PCR system is as follows:
[0038] Element Volume (μl) Final concentration Double distilled water 31 μl - 10× PCR Buffer 5μl 1× 2 mM dNTPs 5μl 0.2mM each <![CDATA[25 mM Mg 2+ ]]> 3 μl 1.5mM Primer F + Primer R (10 μM) 1.5μl + 1.5μl 0.3μM each KOD-Plus-Neo (U / μl) 1 μl 1U / 50μl DNA template 2 μl (100 ng / μl) 200ng / 50μl Total volume 50 μl -
[0039] The PCR product was recovered and ligated into the pMD18-T vector, and positive clones were screened and sequenced. The result is shown in SEQ ID No. 1.
[0040] rice OsRR24 Quantitative PCR detection of genes
[0041] To understand OsRR24 Whether the gene is induced by brown planthopper feeding, Bph6 -NIL was subjected to expression analysis of samples fed by brown planthoppers at different times. The results showed that this gene was upregulated by brown planthopper feeding ( Figure 1 A).
[0042] To verify OsRR24 -Ri transgenic plants OsRR24 To investigate the RNAi inhibition effect, we analyzed the T3 generation OsRR24 RNAi homozygous transgenic plants OsRR24 The expression of genes was found to be Bph6 -NIL (also called WT) compared to OsRR24-Ri In transgenic plants OsRR24 The gene expression level was significantly decreased ( Figure 1 B), confirmed OsRR24-Ri middle OsRR24 The inhibitory effect is significant.
[0043] Combine Figure 1 As shown, in Figure 1 middle," OsRR24 relative expression" is " OsRR24 "Relative expression level"; "BPH infestation for hours" is "brown planthopper feeding time"; " Bph6 -NIL" stands for "carrying resistance to brown planthopper Bph6 Near-isogenic plants";" OsRR24 -Ri-1" and " OsRR24 -Ri-6" stands for "RNAi inhibition OsRR24 Transgenic plants".
[0044] Combine Figure 1 It can be seen that after brown planthoppers feed, OsRR24 The expression level was significantly upregulated. OsRR24 Expression is induced by feeding by brown planthoppers; OsRR24 Gene expression in OsRR24 -RNAi plants OsRR24- Ri-1 and OsRR24 -Ri-6 showed significant inhibition.
[0045] The primers used for quantitative PCR are:
[0046] RR24-qRTF: GTTTGGTGTTCATGGTTTGCTG (5'-3')
[0047] RR24-qRTR: GTGCACCTCTGATCATGTTACC (5'-3')
[0048] OsRR24 Construction of gene overexpression vectors, RNAi suppression vectors and Agrobacterium-mediated genetic transformation
[0049] 1. OsRR24 Overexpression vector construction
[0050] The inventor will OsRR24 A primer was designed from each end of the ORF, and the sequence is as follows:
[0051] OERR24-F: ATTCCCGGGTATGACGGTGGAGGAGAGGC (5'-3')
[0052] OERR24-R: ATTCCCGGGCTAGACCAGCTCCCAGTCCC (5'-3')
[0053] The vector used was pRHV (provided by Ning Yuese, a researcher at the Institute of Plant Protection, Chinese Academy of Agricultural Sciences). The pRHV vector was digested with SamI, and the exogenous fragment was digested and directly connected to the vector after digestion and dephosphorylation. According to the series of SEQ ID No.1, the ORF was amplified by PCR and then connected to the vector after digestion. After sequencing verification, the resulting vector was OsRR24 Gene overexpression vector was electroporated into Agrobacterium tumefaciens EHA105. Single clone was picked and expanded for culture. After PCR verification, an equal volume of 50% glycerol was added and mixed, and stored at -80℃ for later use.
[0054] 2. OsRR24 Suppression vector construction
[0055] The inventors designed primers based on a non-homologous sequence of OsRR24, the sequence of which is as follows:
[0056] RiRR24-R1F: ATTCCCGGGTGAAACACAAACTGTCATGAAGGG (5'-3')
[0057] RiRR24-R1R: ATTCCCGGGGAAACACAAACTGTCATGAAGGG (5'-3')
[0058] RiRR24-R1P3: GGGGTACCGAATTCCTCGAGTCATCTCTACTTTTCCGTGACTGC (5'-3')
[0059] RiRR24-R1P4: CAGTTGGGAAATTGGGTTCGAATCATCTCTACTTTTCCGTGACTGC (5'-3')
[0060] At the same time, the PDK intron fragment was determined and the primers were designed as follows:
[0061] PdkP3 F: CTCGAGGAATTCGGTACCCC
[0062] PdkP4 R: TTCGAACCCAATTTCCCAACTG
[0063] The vector used was pRHV (provided by Researcher Ning Yuese of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences). The pRHV vector was digested with SamI, and the exogenous fragment was digested and directly ligated into the dephosphorylated vector. Based on the sequence of SEQ ID No. 1, a specific sequence on OsRR24 and the PDK intron were amplified using PCR. The nonhomologous sequence and the PDK intron were then linked together using overlapping PCR, digested, and ligated into the vector. After sequencing verification, the resulting vector was confirmed as the OsRR24 gene RNAi suppression vector. This vector was then transformed into Agrobacterium tumefaciens EHA105. A single colony was selected for expansion and verification by PCR. After mixing with an equal volume of 50% glycerol, the mixture was stored at -80°C until further use.
[0064] 3. Genetic Transformation
[0065] The genetic transformation method mediated by Agrobacterium tumefaciens EHA105 was used (Hiei et al., 1994, Efficient transformation of rice ( Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) OsIPT9 The gene overexpression vector was introduced into Nipponbare.
[0066] Transgenic progeny were tested using hygromycin primers Hyg-L and Hyg-R, yielding 25 overexpressing transgenic plants and 20 RNAi knockout transgenic plants. Southern blot analysis and progeny PCR analysis yielded three homozygous transgenic lines at different insertion sites and two homozygous lines at different insertion sites.
[0067] OsRR24 Phenotypic analysis of gene overexpression and RNAi knockdown plants
[0068] 1. Seedling Group Method
[0069] The materials to be identified ( OsRR24 Overexpression plants ( OsRR24 -OE)、 OsRR24 Suppressing plants ( OsRR24-Ri ), Nippon Haruwa Bph6Clean approximately 60 seeds from the NIL, soak and germinate them, and then sow them in 10 cm diameter plastic cups, sowing approximately 20 seeds per cup. Plant three cups per batch. When the seedlings reach the three-leaf stage, remove those in poor condition. Cover each cup with a mesh bag and seed the bag with 2nd-3rd instar brown planthopper nymphs, at a rate of eight per seedling. When more than 90% of the susceptible control has died, read the resistance rating of each cup.
[0070] See Figure 2 , Figure 2 "Nipponbare" in OsRR24 Overexpression of transgenic receptors and highly susceptible brown planthopper control plants", OsRR24 -Ri-1" and " OsRR24 -Ri-6" stands for "RNAi inhibition OsRR24 Transgenic plants, Bph6 -NIL OsRR24 knockout transgenic receptor and high brown planthopper resistance control; OsRR24-OE-2 、 OsRR24-OE-4 and OsRR24-OE-7 for OsRR24 Overexpression homozygous transgenic T3 plants; "BPH resistance scores" are brown planthopper resistance values (the lower the value, the stronger the resistance). Figure 2 It can be seen that with Bph6 -NIL compared to OsRR24 Knockout ( OsRR24 ) after the rice seedlings wilted significantly increased, and the brown planthopper resistance value also increased significantly, indicating that the insect resistance decreased significantly; compared with Nipponbare, OsRR24 Overexpression ( OsRR24 -OE) rice seedling wilting degree was significantly reduced, and the brown planthopper resistance value was also significantly reduced, indicating that the insect resistance was significantly improved. Figure 2 It can be seen that the resistance level of overexpression plants to brown planthoppers was significantly increased, while the resistance level of knockout mutant plants to brown planthoppers was significantly reduced, indicating that OsRR24 Positive regulation of rice resistance to brown planthopper.
[0071] 2. Determination of honeydew yield and weight gain of brown planthoppers
[0072] Form parafilm into bags of appropriate sizes, number each bag, weigh it on a scale, and tie it to the rice stem. Meanwhile, capture newly emerged female brown planthoppers, number them, weigh them on a scale, and place them into the corresponding numbered wax bag. After the brown planthoppers have fed for 48 hours, weigh the brown planthoppers and wax bag separately on a scale. The difference between the two wax bag weighings is recorded as the amount of honeydew on the brown planthoppers, and the difference between the two weighings of the brown planthopper nymphs is recorded as the brown planthopper weight gain. Thirty independent biological replicates were performed for each material.
[0073] The statistical results are as follows Figure 3 As shown, Figure 3 In the data, “BPH gain weight” refers to the weight gain of brown planthoppers (the lower the value, the stronger the resistance), and “BPH honeydew secretion” refers to the honeydew secretion of brown planthoppers (the lower the value, the stronger the resistance). OsRR24-Ri-1, OsRR24-Ri-6, OsRR24-OE-2 、 OsRR24-OE-4 and OsRR24-OE-7 、 Bph6 -NIL, Nipponbare, these plants have statistical results. OsRR24 After overexpression, the body weight and honeydew excretion of brown planthoppers were significantly reduced compared with Nipponbare, indicating that the insect resistance was significantly improved; OsRR24 After knockout, Bph6 Compared with -NIL, the body weight and honeydew excretion of brown planthopper increased significantly, indicating that the insect resistance was significantly reduced. Figure 3 It can be seen that the resistance of overexpression plants to brown planthoppers was significantly enhanced, while the resistance of knockout mutant plants to brown planthoppers was significantly weakened, indicating that OsRR24 Positive regulation of rice resistance to brown planthopper.
[0074] Cytokinins, as important plant hormones, are widely involved in plant growth, development, and interactions with both biotic and abiotic factors. While cytokinins (CKs) have been extensively studied in regulating plant growth and development, the molecular mechanisms underlying their resistance to biotic and abiotic stresses remain relatively unexplored. In rice, little research has been conducted on how cytokinins regulate resistance to the brown planthopper (Nilaparvata lugens) through specific cytokinin response regulators (CRRs). OsRR24 Containing a conserved aspartate signal receiving domain and DNA binding domain, it is the RRs of CK downstream signal transduction. OsRR24 The role of the rice cytokinin response regulator gene in rice resistance to brown planthoppers is unknown. OsRR24 The research on its application is a good example of the involvement of cytokinin response regulators in crop resistance to insects, which has certain reference value for understanding the function of cytokinin response regulators and the regulation of CK on pest resistance. OsRR24 The study of genes provides a good theoretical basis for the molecular mechanism of rice brown planthopper resistance genes and is of great significance for molecular design breeding.
[0075] It should be noted that, in this document, terms such as "comprises", "includes" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article or apparatus.
[0076] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.
Claims
1. Rice cytokinin response regulator gene OsRR24 Application of the rice cytokinin response regulator gene in breeding rice varieties resistant to brown planthoppers OsRR24 The nucleotide sequence is shown in SEQ ID NO.
1.
2. Rice cytokinin response regulator gene OsRR24 The encoded protein is used in breeding rice varieties resistant to brown planthoppers. The amino acid sequence of the protein is shown in SEQ ID NO.
2.
3. A rice cytokinin response regulator gene according to claim 1 OsRR24 Application of recombinant vectors in breeding rice varieties resistant to brown planthopper.
4. A rice cytokinin response regulator gene according to claim 1 OsRR24 Application of transformants in breeding rice varieties resistant to brown planthopper.
Citation Information
Patent Citations
Rice brown-planthopper-resistant gene Bph37, protein, vector, host cell, molecular marker, method and application
CN110951748A
Transcriptional inhibition factor OsSMAX1 gene and application thereof in brown planthopper resistance of rice
CN116286861A
Cited By
Application of cytokinin response regulatory factor ZmARR2 gene and encoded protein thereof in regulation of plant salt tolerance
CN121874204A