Corn disease-resistant gene ZmCRK10 and disease-resistant molecular marker and application
By regulating the maize gene ZmCRK10-T03 through overexpression and CRISPR knockout technology, and combining it with the development of the disease-resistant molecular marker ZmCRK10TypeB, the problem of insufficient maize resistance to diseases was solved, and broad-spectrum disease resistance was enhanced and breeding efficiency was improved.
Patent Information
- Application Number
- CN202411378352.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2044-09-30
AI Technical Summary
Existing technologies are insufficient to effectively improve corn's broad-spectrum resistance to diseases, especially resistance to leaf spot, gray leaf spot, and rust, which affects corn yield and quality.
By overexpressing the maize disease resistance gene ZmCRK10-T03 and knocking out ZmCRK10 using CRISPR/Cas9 technology, the immune response of maize was regulated. Combined with the development of the maize disease resistance molecular marker ZmCRK10TypeB, the expression of the ZmCRK10-T03 transcript was promoted to enhance disease resistance.
It significantly improved maize's resistance to small leaf spot, large leaf spot and gray leaf spot, provided molecular markers for maize disease resistance for breeding, and improved breeding efficiency and the ability to identify disease-resistant varieties.
Smart Images

Figure CN118956901B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering, specifically to a maize disease resistance gene ZmCRK10, its disease resistance molecular markers, and their applications. Background Technology
[0002] Corn is my country's largest grain crop, as well as an important source of feed and industrial raw materials. However, in agricultural production practices, biological stress caused by pathogens seriously affects the stable and high yields of corn in my country. Among these, foliar diseases such as large leaf spot (spring corn area), small leaf spot (summer corn area), and gray leaf spot (southwest mountainous area) severely damage plant photosynthesis, affect grain development, and ultimately affect yield. These diseases are widely distributed and cause severe damage, seriously restricting corn production in my country. Therefore, improving the broad-spectrum disease resistance of corn is of great significance.
[0003] Cysteine-rich receptor-like kinases (CRKs) are a large class of plant receptor kinases. CRKs are widely involved in plant immune responses and growth and development, and have been reported to participate in plant disease resistance responses in Arabidopsis, rice, and wheat. As surface receptors, CRKs can trigger pathogen-associated molecular patterning (PTI) responses by recognizing pathogen signals, and participate in disease resistance through the production of reactive oxygen species (ROS) or the accumulation of callose. Simultaneously, CRKs can also regulate programmed cell death, inducing cell necrosis, preventing pathogen invasion, and participating in effector-triggered immunity. Therefore, maize CRK genes may play an important role in regulating maize disease resistance responses and have potential application value in the breeding of new disease-resistant maize varieties.
[0004] Besides molecular breeding, the use of genetic methods to cultivate and improve disease-resistant maize varieties is also of great significance. Screening for molecular markers of maize disease resistance-related genes can effectively improve the efficiency of breeding disease-resistant maize varieties. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a maize disease resistance gene ZmCRK10, its molecular marker, and its applications. The maize disease resistance gene ZmCRK10 encodes a cysteine-rich receptor kinase, which participates in regulating plant immune responses. ZmCRK10 has two major transcripts. Overexpression of the T03 transcript of ZmCRK10 improves maize resistance to small leaf spot and large leaf spot; mutating the T03 transcript of ZmCRK10 using CRISPR / Cas9 leads to greater susceptibility of maize to gray leaf spot and large leaf spot. The maize disease resistance molecular marker ZmCRK10 is also included. Type BThis includes a transposon approximately 63.3 kb in length (containing multiple LTR long terminal repeat retropoles). The presence of this marker promotes maize resistance to large leaf spot, gray leaf spot, and rust. Its mechanism of action may involve promoting the expression of the downstream ZmCRK10-T03 transcript, thereby enhancing maize's disease resistance.
[0006] To achieve the above objectives, the technical solution designed by the present invention is as follows:
[0007] This invention provides a maize disease resistance gene ZmCRK10, the nucleotide sequence of the CDS of the disease resistance gene ZmCRK10 is shown in SEQ ID NO: 1.
[0008] The present invention also provides a disease resistance protein ZmCRK10-T03 encoded by the disease resistance gene ZmCRK10, the amino acid sequence of which is shown in SEQ ID NO: 2.
[0009] The present invention also provides a primer pair for obtaining the sequence of the maize disease resistance gene ZmCRK10CDS, wherein the primer pair is as follows:
[0010] ZmCRK10-T03-F0: GTCGACAAACGCACTAGTATCCCGGGATG TTCACCTGCCGCTGTGC, shown in SEQ IDNO: 4;
[0011] ZmCRK10-T03-R0: GGGTACATTTGGCGCGCCTTCCCGGGTCTA GGATACAGTTCACTGAGTGTA, shown in SEQ ID NO: 5.
[0012] The present invention also provides the application of the disease resistance gene ZmCRK10 or the disease resistance protein ZmCRK10-T03 in improving the disease resistance of maize.
[0013] The present invention also provides the application of the disease resistance gene ZmCRK10 or the disease resistance protein ZmCRK10-T03 in the breeding of new maize varieties.
[0014] This invention also provides a disease resistance molecular marker for maize, ZmCRK10. Type B The maize disease resistance molecular marker ZmCRK10 Type B The nucleotide sequence is shown in SEQ ID NO: 3.
[0015] The present invention also provides the maize disease resistance molecular marker ZmCRK10. TypeB Applications in improving maize disease resistance and in assisted breeding.
[0016] The present invention also provides a method for obtaining the maize disease resistance molecular marker ZmCRK10. Type B The primer pairs are as follows:
[0017] ZmCRK10 Type B -F1: GGCAGATGGCACAGAATCTAACTG, SEQ ID NO: 6;
[0018] ZmCRK10 Type B -R1: GCATAGGTGGAATCGTCGCAG, shown in SEQ ID NO: 7.
[0019] The present invention also provides an application of a kit for identifying maize varieties with excellent disease resistance characteristics, the kit comprising the primer pair described above.
[0020] The present invention also provides a method for identifying maize varieties with excellent disease resistance characteristics using the aforementioned kit, comprising the following steps:
[0021] (1) Extract DNA from the maize variety to be tested;
[0022] (2) Design the primer pairs as follows:
[0023] ZmCRK10 Type B -F1:GGCAGATGGCACAGAATCTAACTG,
[0024] ZmCRK10 Type B -R1:GCATAGGTGGAATCGTCGCAG;
[0025] (3) PCR amplification was performed using the DNA as a template;
[0026] (4) Electrophoresis: The amplification showed a target band of 746bp, indicating that the variety has strong disease resistance.
[0027] The principle of this invention:
[0028] This invention utilizes maize transformation technology to obtain maize ZmCRK10-T03 overexpression and CRISPR knockout materials. Pathogen inoculation experiments were conducted on transgenic and control materials. It was found that overexpression of ZmCRK10-T03 promoted maize resistance to small leaf spot and large leaf spot; mutation of ZmCRK10-T03 led to increased susceptibility to large leaf spot and gray leaf spot. This indicates that ZmCRK10-T03 positively regulates maize disease resistance. Related population resequencing revealed a large structural variation in the maize ZmCRK10 promoter region, approximately 121.7 kb in length (ZmCRK10...). Type A ) and 63.3kb (ZmCRK10 Type B The transposable of ZmCRK10 Type B The presence of ZmCRK10 significantly increases the expression of the T03 transcript. (The last part, "ZmCRK10," appears to be incomplete and unrelated to the preceding sentence. It has been left as is.) Type B The genotype of maize is more resistant to leaf spot, gray leaf spot and rust, and can be used as a molecular marker for maize disease resistance.
[0029] The beneficial effects of this invention are:
[0030] This invention utilizes the identification of disease resistance phenotypes in transgenic materials with overexpression and CRISPR knockout to discover the disease resistance-related gene ZmCRK10 in maize. This gene encodes a cysteine-rich receptor kinase involved in regulating plant disease resistance immunity. Overexpression of the transcript ZmCRK10-T03 promotes maize resistance to small leaf spot and large leaf spot; mutations in ZmCRK10-T03 lead to increased susceptibility to large leaf spot and gray leaf spot in maize. The presence of a 63.3 kb transposon structural variation in its promoter region significantly promotes maize resistance to large leaf spot, gray leaf spot, and rust, and can serve as a molecular marker for maize disease resistance, enabling the breeding of new disease-resistant maize varieties. Attached Figure Description
[0031] Figure 1 A schematic diagram illustrating the construction and identification of maize overexpression materials;
[0032] In the figure, a is a schematic diagram of the construction of the overexpression vector pZZ0153-ZmUBIp-ZmCRK10-T03-3HA.
[0033] Figure b shows the identification results of DNA insertion into the overexpression vector of the transgenic material.
[0034] c is a graph identifying the expression level of ZmCRK10 in transgenic materials (the expression level in T03-CK2 is set to 1).
[0035] d shows the genotype identification diagram of the CRISPR knockout material and a schematic diagram of the knockout site.
[0036] Figure 2 A schematic diagram of the disease-resistant phenotypes of ZmCRK10-T03 overexpression and CRISPR knockout materials;
[0037] In the figure, 'a' is a schematic diagram of the large spot phenotype of Setosphaeria turcica inoculated with CRISPR knockout material.
[0038] b is a score chart of gray spot disease lesions obtained by inoculating Cercospora zeae-maydis with CRISPR knockout material.
[0039] c is a schematic diagram of the small spot phenotype of Cochliobolus heterostrophus inoculated with ZmCRK10-T03 overexpressing material.
[0040] d is a schematic diagram of the large spot phenotype and fungal biomass of Setosphaeria turcica inoculated with ZmCRK10-T03 overexpression material.
[0041] Figure 3 Allelic variation analysis diagram for ZmCRK10;
[0042] In the figure, 'a' represents the structural variation of the ZmCRK10 promoter and the ZmCRK10 in the associated population. Type B Genotyping gel electrophoresis
[0043] b is ZmCRK10 Type B Association analysis diagram between genotype and ZmCRK10-T03 transcript abundance.
[0044] Figure 4 ZmCRK10 in the BC3F3 population Type B A diagram illustrating how natural variations affect maize's disease resistance;
[0045] In the figure, 'a' is a schematic diagram of the large spot phenotype in the BC3F3 population inoculated with Setosphaeria turcica.
[0046] b is a schematic diagram of the gray spot disease lesion index scores of the BC3F3 population vaccinated with Cercospora zeae-maydis.
[0047] Figure 5 This diagram illustrates the use of primers and kits to detect genotypes and disease resistance indicators in different maize varieties.
[0048] a is ZmCRK10 Type B Gel images for identifying maize varieties by genotype.
[0049] b is ZmCRK10 Type A Gel images for identifying maize varieties by genotype.
[0050] c is ZmCRK10 Type B Disease indicators of gray leaf spot (GLS) in maize varieties field-planted with Cercospora zeae-maydis and rust (SCR) inoculated with Puccinia polysora.
[0051] d is ZmCRK10 Type A Disease indicators of gray leaf spot (GLS) in field-planted maize varieties of Cercospora zeae-maydis and rust (SCR) inoculated with Puccinia polysora. Detailed Implementation
[0052] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.
[0053] Example 1: Construction of CRISPR knockout vector for maize ZmCRK10-T03
[0054] Based on the pCPB-ZmUBI-hspCas9 vector, the U6 promoter, gRNA, and sgRNA backbone fragments were obtained via overlap PCR. These fragments were then inserted into the pCPB-ZmUBI-hspCas9 vector via homologous recombination. The specific experimental steps are as follows:
[0055] 1. U6 promoter amplification
[0056] Primers were designed based on the U6 promoter sequence for PCR amplification. The vector inserts two target sites, therefore there are two U6 promoters. The primer sequences are as follows:
[0057] pU6-F1:GCACTGCACAAGCTGCTGTTTTTGTTAGCCCCAT CG,
[0058] pU6-F2:GTCGGTGCTTTTTTTAAGCTGCTGTTTTTGTTAGCCCCAT,
[0059] pU6-R:AATTCGGTGCTTGCGGCTC;
[0060] Gene PCR amplification was performed using Vazyme Phanta Max Super-Fidelity DNA polymerase to obtain the U6 promoter sequence. The reaction system was as follows (total volume 20 μL):
[0061] 2×Phanta Buffer 10μL dNTP 0.4μL pU6-F1 / F2 0.8μL pU6-R 0.8μL Phanta max 0.4μL Backbone 1.5μL <![CDATA[ddH2O]]> 6.9μL
[0062] The reaction program was as follows: 95℃ for 3 min; 95℃ for 15 s; 56℃ for 15 s; 72℃ for 30 s; 72℃ for 5 min; 20 cycles. The PCR product was used as template 1.
[0063] Backbone is a template plasmid containing both the U6 promoter sequence and the sgRNA sequence (from a publicly available paper online, DOI:10.1105 / tpc.19.00934).
[0064] 2. Amplification of gRNA-sgRNA
[0065] The primer sequences are as follows:
[0066] gRNA1-F: AGCCGCAAGCACCGAATTGAACGTGCTGTTGT CGGCATGTTTTAGAGCTAGAAATAG,
[0067] gRNA2-F: AGCCGCAAGCACCGAATTGATTGTACCCTTCGC TTCGCGTTTTAGAGCTAGAAATAG;
[0068] gRR1: GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTC G;
[0069] Gene PCR amplification was performed using Vazyme Phanta Max Super-Fidelity DNA polymerase to obtain gRNA sequences linked to the sgRNA backbone, i.e., gRNA-sgRNA. The reaction system is as follows (total volume 20 μL):
[0070] 2×Phanta Buffer 10μL dNTP 0.4μL pU6-F1 / F2 0.8μL gRR1 0.8μL Phanta max 0.4μL Backbone 1.5μL <![CDATA[ddH2O]]> 6.9μL
[0071] The reaction program was as follows: 95℃ for 3 min; 95℃ for 15 s; 56℃ for 15 s; 72℃ for 30 s; 72℃ for 5 min; 20 cycles. The PCR product was used as template 2.
[0072] 3. Overlap PCR to obtain pU6-gRNA-sgRNA
[0073] Gene overlap PCR amplification was performed using Vazyme Phanta Max Super-Fidelity DNA polymerase to obtain gRNA-sgRNA sequences containing the U6 promoter, namely pU6-gRNA1-sgRNA and pU6-gRNA2-sgRNA. The reaction system is as follows (total volume 30 μL):
[0074] 2×Phanta Buffer 15μL dNTP 0.6μL gRNA1-F / gRNA2-F 1.2μL gRR1 1.2μL Phanta max 0.6μL Template 1 0.2μL Template 2 0.2μL <![CDATA[ddH2O]]> 11μL
[0075] The reaction program was as follows: 95℃ for 3 min; 95℃ for 15 s; 60℃ for 15 s; 72℃ for 30 s; 72℃ for 5 min; 35 cycles.
[0076] 4. Linearization of the vector: The pCPB-ZmUBI-hspCas9 vector was linearized by digesting the restriction endonuclease HindIII.
[0077] 5. Detection and recovery of pU6-gRNA1-sgRNA and pU6-gRNA2-sgRNA and vector enzyme digestion products: PCR products and vector enzyme digestion products were detected by agarose gel electrophoresis, and the target fragment was recovered using the Omega Bio-tek Gel Extraction Kit;
[0078] 6. Recombination of Gel Recycling Products: Homologous recombination was performed using the Vazyme ClonExpress II One Step Cloning Kit. The reaction system is as follows:
[0079] Linearized carrier 200ng Insert fragment 24ng 5×CE II buffer 4μL Exnase II 2μL <![CDATA[ddH2O]]> to 20μL
[0080] Gently pipette and mix well. After a short centrifugation, collect the reaction solution at the bottom of the centrifuge tube. Incubate in a 37°C water bath for 30 minutes, then place on ice to cool to room temperature.
[0081] 7. Transformation of recombinant products: Transform DH5α competent cells with recombinant products, following the guidelines for molecular cloning experiments;
[0082] 8. Sequencing identification: Colony PCR, plasmid PCR, and sequencing analysis showed that an intermediate vector linked to gRNA1 was obtained;
[0083] 9. Repeat steps 6 to 8 to further ligate pU6-gRNA2-sgRNA into the intermediate vector to obtain the final vector, which is the CRISPR-ZmCRK10-T03 vector. The primers used for detection, including PCR and sequencing, are:
[0084] CAS9-F: AGATAAACTGCACTTCAAACAAGT,
[0085] CAS9-R: TCACGCCCTTTTAAATATCCGA.
[0086] Example 2 Construction of Maize ZmCRK10-T03 Overexpression Vector
[0087] Based on the expression vector pZZ0153-ZmUBIp-3HA, the cDNA fragment of ZmCRK10-T03 was inserted downstream of the UBI promoter and between the 3HA tag via homologous recombination, and expressed by the UBI promoter. Figure 1 Electrophoresis and sequencing analysis showed that the maize ZmCRK10-T03 overexpression vector, named pZZ0153-ZmUBIp-ZmCRK10-T03-3HA, was successfully obtained. The specific experimental steps are as follows:
[0088] 1. ZmCRK10-T03 gene amplification:
[0089] A pair of homologous recombination primers was designed based on the cDNA sequence of ZmCRK10-T03 for PCR amplification. The primer sequences are as follows:
[0090] ZmCRK10-T03-F0:GTCGACAAACGCACTAGTATCCCGGGA TGTTCACCTGCCGCTGTGC,
[0091] ZmCRK10-T03-R0: GGGTACATTTGGCGCGCCTTCCCGGGT CTAGGATACAGTTCACTGAGTGTA;
[0092] Gene amplification was performed using Vazyme Phanta Max Super-Fidelity DNA polymerase to obtain PCR products. Sequencing yielded the disease-resistant protein ZmCRK10-T03, whose amino acid sequence is shown in SEQ ID NO: 2. The reaction system was as follows (total volume 20 μL):
[0093] 2×Phanta Buffer 10μL dNTP 0.4μL ZmCRK10-T03-F0 0.8μL ZmCRK10-T03-R0 0.8μL Phanta max 0.4μL cDNA (maize B73) 1.5μL <![CDATA[ddH2O]]> 6.9μL
[0094] The reaction program was as follows: 95℃ for 3 min; 95℃ for 15 s; 58℃ for 30 s; 72℃ for 60 s; 72℃ for 5 min; 35 cycles.
[0095] 2. Linearization of vector preparation: The pZZ0153-ZmUBIp-3HA vector was linearized by digesting the restriction endonuclease XmaI.
[0096] 3. Detection and recovery of PCR products and vector enzyme digestion products: Agarose gel electrophoresis was used to detect PCR products and vector enzyme digestion products. The target fragment was recovered using the Omega Bio-tek Gel Extraction Kit;
[0097] 4. Recombination of Gel Recycling Products: Homologous recombination was performed using the Vazyme ClonExpress II One Step Cloning Kit; the reaction system is as follows:
[0098] Linearized carrier 200ng Insert fragment 120ng 5×CE II buffer 4μL Exnase II 2μL <![CDATA[ddH2O]]> to 20μL
[0099] Gently pipette and mix well. After a short centrifugation, collect the reaction solution at the bottom of the centrifuge tube. Incubate in a 37°C water bath for 30 minutes, then place on ice to cool to room temperature.
[0100] 5. Transformation of recombinant products: Transform the recombinant products into E. coli DH5α competent cells, following the guidelines for molecular cloning experiments.
[0101] 6. Sequencing Identification: Positive plasmids were selected for sequencing via colony PCR and plasmid PCR. The results showed correct sequencing, indicating successful acquisition of the maize ZmCRK10 overexpression vector pZZ0153-ZmUBIp-ZmCRK10-T03-3HA. PCR and sequencing primers are as follows:
[0102] Primer F: GCAGGTCGACAAACGCACTA,
[0103] Primer R: CGCCTCTTCCAGTGTCAATAAATC.
[0104] Example 3: Obtaining and Detecting CRISPR Knockout Transgenic Maize Lines of ZmCRK10-T03
[0105] The CRISPR knockout vector of maize ZmCRK10-T03 obtained in Example 1 was sent to Jiangsu Weimi Biotechnology Co., Ltd. for transformation. The transformation background was maize inbred line KN5585. T1 generation was obtained from T0 generation transgenic seeds obtained from the company. Genotyping of the T1 generation was performed, and homozygous plants with the ZmCRK10 gene sequence knocked out (i.e., zmcrk10-KO3 and zmcrk10-KO4 plants) were screened. Figure 1 d); The identification primers and reaction system are as follows:
[0106] Seq-F: GCCATCTGTAAAATGTGACAAAC,
[0107] Seq-R:TCTTAGCTGGAAAGAAATTTTGTTG.
[0108] The reaction system is as follows (total volume 20 μL):
[0109] DNA 100ng 2×Taq mix 10μL Seq-F 0.4μL Seq-R 0.4μL <![CDATA[ddH2O]]> to 20μL
[0110] The reaction program was as follows: 95℃ for 3 min; 95℃ for 30 s; 58℃ for 30 s; 72℃ for 45 s; 72℃ for 5 min; 35 cycles.
[0111] Example 4: Obtaining and Detecting ZmCRK10-T03 Overexpression Transgenic Maize Lines
[0112] The maize ZmCRK10 overexpression vector pZZ0153-ZmUBIp-ZmCRK10-T03-3HA obtained in Example 2 was sent to Jiangsu Weimi Biotechnology Co., Ltd. for transformation. The transformation background was maize inbred line B104. T0 generation transgenic seeds obtained from the company were used to cultivate T1 generation plants. T1 positive plants were identified by DNA detection of the overexpression vector insertion, and seeds were harvested and cultivated to obtain T2 generation plants. PCR detection was performed on the T2 generation plants to confirm that the target gene had not undergone genetic segregation or loss. Finally, two positive homozygous transgenic maize families containing stable ZmCRK10-T03 inheritance and corresponding negative segregation materials were obtained. The PCR detection primers were the same as primers F and R in Example 2.6.
[0113] ZmCRK10-T03 overexpressing maize material and negative isolates were planted separately. Maize leaves at three weeks of growth were collected, and RNA was extracted using the Trizol method. The extracted RNA was digested with DNase I and then reverse transcribed using Promega MLV reverse transcriptase. The extracted cDNA was used for RT-PCR detection. The maize Actin gene was used as a control.
[0114] The test results showed that the ZmCRK10-T03 gene was successfully transferred into maize. Figure 1 c).
[0115] The primers used in the detection process are as follows:
[0116] qZmCRK10-F: GGGACCTGAAGGCAAATAAC,
[0117] qZmCRK10-R:GTCCCAACAACTCTGCCTGT;
[0118] qZmActin-F:GCTGGATCTTGCTGGCCGTG,
[0119] qZmActin-R: AGGCGCCACGACCTTGATCT;
[0120] Example 5: Detection of disease resistance phenotype in ZmCRK10-T03 transgenic maize
[0121] Phenotypic analysis of large leaf spot in CRISPR knockout materials and background materials inoculated with Setosphaeria turcica at the 5-leaf stage in a greenhouse; and phenotypic analysis of gray leaf spot in field-planted Cercospora zeae-maydis. Gray leaf spot lesion index was scored, and the disease phenotype of ear-side leaves of maize plants was investigated. The leaf phenotypes were scored according to the rating method.
[0122] Phenotypic analysis of small leaf spot disease in ZmCRK10-T03 overexpression materials and control materials at the 5-leaf stage was performed in a greenhouse by inoculation with Cochliobolus heterostrophus; pheenotypic analysis of large leaf spot disease inoculated with Setosphaeria turcica was also performed to assess the pathogen infection status of the 5th leaf and evaluate the leaf disease status.
[0123] The results are as follows Figure 2 As shown, phenotypic analysis of disease resistance revealed that knocking out the T03 transcript of ZmCRK10 with CRISPR weakened the resistance of the knockout material to both large leaf spot and gray leaf spot; overexpression of the T03 transcript of ZmCRK10 improved the resistance of transgenic maize to both small leaf spot and large leaf spot. This indicates that the ZmCRK10-T03 transcript positively regulates maize disease resistance.
[0124] Example 6: Molecular marker for maize disease resistance ZmCRK10 Type B Filtering and association analysis
[0125] 1. ZmCRK10 in the associated population Type B Genotyping and association analysis of ZmCRK10-T03 transcript abundance
[0126] Analysis of the ZmCRK10 sequences of maize materials B73 and SK, whose sequencing sequences have been published, revealed a transposon of approximately 121.7 kb in the promoter region of B73, while another transposon of approximately 63.3 kb with significant sequence differences was found in the promoter region of SK. Primers were designed based on the sequences to identify the transposon insertion status in the ZmCRK10 promoter region of the associated population. Figure 3 a). Used to identify 63.3kb (ZmCRK10) Type B The primers for transposons are as follows:
[0127] ZmCRK10 Type B -F1:GGCAGATGGCACAGAATCTAACTG,
[0128] ZmCRK10 Type B -R1:GCATAGGTGGAATCGTCGCAG.
[0129] The PCR amplification system is as follows (total volume 20 μL):
[0130] DNA 100ng 2×Taq mix 10μL <![CDATA[ZmCRK10 Type B -F1]]> 0.4μL <![CDATA[ZmCRK10 Type B -R1]]> 0.4μL <![CDATA[ddH2O]]> to 20μL
[0131] The reaction program was as follows: 95℃ for 3 min; 95℃ for 30 s; 58℃ for 30 s; 72℃ for 45 s; 72℃ for 5 min; 35 cycles.
[0132] 2.ZmCRK10 Type B Genotype and associated population resistance and ZmCRK10 Type B Association analysis of transcript abundance
[0133] ZmCRK10 was identified by primer PCR as described in Example 6. Type B Genotype, used to distinguish it from another genotype.
[0134] Structural variations in promoter regions often have a significant impact on gene expression levels. Analysis of existing leaf transcriptome data from associated populations revealed that ZmCRK10... Type B In the genotype materials, the abundance of the T03 transcript in ZmCRK10 was significantly higher than that in another genotype ( Figure 3 b). Explanation of ZmCRK10 Type B Genotypes may enhance maize disease resistance by increasing the expression of the T03 transcript of ZmCRK10; therefore, the maize disease resistance molecular marker ZmCRK10 is obtained. Type B The nucleotide sequence is shown in SEQ ID NO: 3.
[0135] Example 7 ZmCRK10 in BC3F3 and NIL populations Type B Natural variation affects maize's disease resistance
[0136] Utilizing ZmCRK10 Type B Molecular markers of genotype ( Figure 3a) To investigate the disease resistance phenotype of the population, the parents were selected to construct the BC3F3 population. At the 5-leaf stage, the phenotype of large leaf spot disease inoculated with Setosphaeria turcica and the phenotype of gray leaf spot disease inoculated with Cercospora zeae-maydis were analyzed. The phenotype of lesion length on the ear-side leaves of maize plants was investigated. The leaf phenotype was scored according to the rating method to verify the variation site.
[0137] The results are as follows Figure 4 As shown, it has ZmCRK10 Type B The genotype of maize is more resistant to large leaf spot and gray leaf spot, and can be used as a molecular marker for maize disease resistance.
[0138] Example 8: Identification of different disease-resistant maize varieties using kit primers
[0139] 1. Kit and Instructions for Use
[0140] One kit includes the acquisition of the maize disease resistance molecular marker ZmCRK10. Type B The primer pair is as follows:
[0141] ZmCRK10 Type B -F1:GGCAGATGGCACAGAATCTAACTG,
[0142] ZmCRK10 Type B -R1:GCATAGGTGGAATCGTCGCAG.
[0143] The method for identifying maize varieties with excellent disease resistance using the above-mentioned kit includes the following steps:
[0144] (1) Extract DNA from the maize variety to be tested;
[0145] (2) Design the primer pairs as follows:
[0146] ZmCRK10 Type B -F1:GGCAGATGGCACAGAATCTAACTG;
[0147] ZmCRK10 Type B -R1:GCATAGGTGGAATCGTCGCAG.
[0148] (3) PCR amplification was performed using the DNA as a template;
[0149] (4) Electrophoresis: The amplification showed a target band of 746bp, indicating that the variety has strong disease resistance.
[0150] 2. Identifying different disease-resistant maize varieties using kits.
[0151] Verify ZmCRK10 Type B After allelic variations were used as molecular markers for maize disease resistance, ZmCRK10 was selected using a kit. Type B and ZmCRK10 Type A Different genotypes ( Figure 5 Resistance of maize varieties a and b) to gray leaf spot (GLS) inoculated with Cercospora zeae-maydis and rust (SCR) inoculated with Puccinia polysora was analyzed. Results showed that ZmCRK10... Type B The disease index of genotype maize varieties is lower than that of ZmCRK10. Type A Genotype maize varieties ( Figure 5 (c, d) This provides an effective reagent kit for the preliminary identification of disease-resistant maize varieties.
[0152] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of a disease resistance gene ZmCRK10 or a disease resistance protein ZmCRK10-T03 in improving the disease resistance of maize, characterized in that: The nucleotide sequence of the CDS of the disease resistance gene ZmCRK10 is shown in SEQ ID NO: 1; The amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO: 2; the disease-resistant gene ZmCRK1 encodes the disease-resistant protein ZmCRK10-T03; The disease resistance characteristics of corn refer to its resistance to small leaf spot and large leaf spot.
2. The application of a disease resistance gene ZmCRK10 or a disease resistance protein ZmCRK10-T03 in the breeding of new disease-resistant maize varieties, characterized in that: The nucleotide sequence of the CDS of the disease resistance gene ZmCRK10 is shown in SEQ ID NO: 1; The amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO: 2; The disease-resistant maize varieties mentioned are maize varieties resistant to small leaf spot and maize varieties resistant to large leaf spot.
Citation Information
Patent Citations
Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and / or agricultural characteristics
US20150167015A1