OsEIL1 gene of rice and application thereof

Abstract

The application discloses a rice OsEIL1 gene RNAi expression vector and application thereof. The RNAi expression vector of the rice OsEIL1 gene is expressed in rice, and the RNAi expression vector can inhibit the expression amount of the OsEIL1 gene in the rice root, that is, specifically inhibit the expression of the OsEIL1 gene in the rice root, thereby improving the nitrogen fertilizer utilization efficiency and yield of the rice. The RNAi expression vector of the rice OsEIL1 gene is expressed in rice, so that the expression amount of the OsEIL1 gene in the rice root is reduced, thereby improving the nitrogen fertilizer utilization efficiency and yield of the rice. Test results prove that, compared with wild-type rice with normal expression of the OsEIL1 gene, transgenic rice containing the RNAi expression vector has significantly increased aboveground biomass, grain length, 1000-grain weight and nitrate reductase activity under low-nitrogen and high-nitrogen conditions. Meanwhile, compared with wild-type rice with normal expression of the OsEIL1 gene, the transgenic rice containing the RNAi expression vector has more increased yield per plant under low-nitrogen conditions.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to an RNAi expression vector of a rice OsEIL1 gene and application thereof. BACKGROUND

[0002] The use of chemical fertilizers is one of the important prerequisites for the rapid development of modern agriculture. Nitrogen is the most demanding mineral nutrient element for plants and is also a key factor restricting crop yield, so nitrogen fertilizer has become the largest fertilizer variety in the world in terms of production and use. However, since the middle of the last century, with the long-term overuse of chemical fertilizers, their yield-increasing effect has become less and less obvious, and has caused serious damage to the environment such as soil, water and air, becoming a major challenge to the sustainable development of agriculture. Improving the nitrogen utilization efficiency of crops and cultivating new crop varieties with reduced fertilizer but not reduced yield are the fundamental way to solve this problem.

[0003] Rice needs to be planted in paddy fields, and the nitrogen fertilizer utilization efficiency of paddy fields is lower than that of upland fields due to a large amount of leaching and runoff, and water pollution is more difficult to control. Therefore, in order to ensure the absorption of nitrogen fertilizer by rice, the amount of nitrogen fertilizer used during rice planting needs to be increased.

[0004] With the increase in the amount of chemical fertilizers, the occurrence of plant diseases and insect pests in rice has become more and more serious, leading to a sharp increase in the amount of pesticides used; at the same time, excessive fertilization also causes a decrease in rice quality. Therefore, it is imperative to cultivate new varieties of nitrogen-efficient rice and achieve reduced fertilizer and increased efficiency. SUMMARY

[0005] The present application provides an RNAi expression vector of a rice OsEIL1 gene to reduce the expression amount of the OsEIL1 gene in the roots of rice, thereby improving the nitrogen utilization efficiency of rice and the yield of rice.

[0006] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0007] The RNAi expression vector of the rice OsEIL1 gene comprises an OsEIL1 gene, and the RNAi expression vector can inhibit the expression amount of the OsEIL1 gene in the roots of rice.

[0008] Further, the sequence of the OsEIL1 gene is shown in SEQ ID NO. 1.

[0009] Further, the amino acid sequence of the OsEIL1 protein is shown in SEQ ID NO. 2.

[0010] Further, it further comprises a promoter, which enables the RNAi expression vector of the OsEIL1 gene to be expressed in rice.

[0011] Further, the promoter is a promoter of a rice OsPIN2 gene, and a sequence of the promoter is shown as SEQ ID NO. 4.

[0012] Further, the RNAi sequence of the RNAi expression vector is shown as SEQ ID NO. 3.

[0013] Further, the RNAi expression vector is a hairpin structure containing an OsEIL1 gene.

[0014] The application provides an application of the RNAi expression vector of the rice OsEIL1 gene in improving nitrogen utilization efficiency of rice, and the RNAi expression vector of the rice OsEIL1 gene is expressed in rice, so that the expression amount of the OsEIL1 gene in the root of rice is reduced, and the nitrogen utilization efficiency of rice is improved.

[0015] The application provides an application of the RNAi expression vector of the rice OsEIL1 gene in improving yield of rice, and the RNAi expression vector of the rice OsEIL1 gene is expressed in rice, so that the expression amount of the OsEIL1 gene in the root of rice is reduced, and the yield of rice is improved.

[0016] Compared with the prior art, the application has the beneficial effects that the RNAi expression vector of the rice OsEIL1 gene is expressed in rice, so that the expression amount of the OsEIL1 gene in the root of rice is reduced, that is, the expression of the OsEIL1 gene in the root of rice is specifically inhibited, and the nitrogen utilization efficiency and yield of rice are improved. The test results prove that compared with wild-type rice with normal expression of the OsEIL1 gene, the transgenic rice containing the RNAi expression vector has significantly increased aboveground biomass, grain length, thousand-grain weight and nitrate reductase activity under low-nitrogen and high-nitrogen conditions. Meanwhile, compared with wild-type rice with normal expression of the OsEIL1 gene, the transgenic rice containing the RNAi expression vector has more increased yield per plant under low-nitrogen conditions. BRIEF DESCRIPTION OF DRAWINGS

[0017] The drawings incorporated in the specification and forming a part thereof illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the application.

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows, and obviously, other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0019] In the drawings:

[0020] Figure 1Figure of OsEIL1 gene RNAi expression vector;

[0021] Figure 2 Figure of plasmid map of OsEIL1 gene RNAi expression vector;

[0022] Figure 3 Molecular detection of OsEIL1 gene expression in transgenic rice containing OsEIL1 gene RNAi expression vector;

[0023] Figure 4 Aboveground biomass of transgenic plants and wild type materials in high nitrogen (HN) and low nitrogen (LN) fields;

[0024] Figure 5 Grain size of transgenic plants and wild type materials in high nitrogen (HN) and low nitrogen (LN) fields;

[0025] Figure 6 Thousand-grain weight of transgenic plants and wild type materials in high nitrogen (HN) and low nitrogen (LN) fields;

[0026] Figure 7 Yield per plant of transgenic plants and wild type materials in high nitrogen (HN) and low nitrogen (LN) fields;

[0027] Figure 8 Nitrate reductase activity detection of transgenic plants and wild type materials in high nitrogen (HN) and low nitrogen (LN) fields. DETAILED DESCRIPTION

[0028] The following examples are intended to illustrate but not limit the present application. Modifications or substitutions of the method, steps or conditions of the present application, without departing from the spirit and scope of the present application, are all within the scope of the present application. If not specifically indicated, all experimental materials, reagents and instruments used in the examples of the present application are commercially available. If not specifically indicated, all technical means used in the examples of the present application are conventional means known to those skilled in the art.

[0029] The application provides a method for obtaining a transgenic rice, comprising the following steps:

[0030] (1) Extraction of genomic DNA

[0031] Rice seeds were sowed after 2 days of germination at 37℃, and after one week of growth, leaves of about 3 cm were cut and placed in 2 mL centrifuge tubes with steel balls, and were broken by a cell crusher for about 1 min to ensure the leaves were broken. 400 μL of 2% CTAB extraction solution was added to the centrifuge tube, and after mixing, the tube was placed in an oven at 65℃ for about 20 min, and the tube was mixed several times to ensure uniform heating. In a fume hood, 350 μL of chloroform was added, and after vortex mixing, the tube was allowed to stand for 2 min, and obvious layering was observed. After centrifugation at 12,000 rpm for 10 min, 300 μL of supernatant was gently aspirated and placed in a new 1.5 mL centrifuge tube, 300 μL of isopropanol was added, and the tube was mixed gently to observe the appearance of white filamentous material, which was DNA. After being placed at -20℃ for 10 min, the tube was centrifuged at room temperature for 10 min, and the supernatant was discarded. The white precipitate was washed with 1 mL of 70% ethanol, and after centrifugation at 12,000 rpm for 1 min, the supernatant was discarded. The ethanol precipitate was blown dry in a clean bench, and 200 μL of sterile water was added to dissolve the precipitate. Thus, high-purity genomic DNA was obtained, which was used for subsequent amplification of fragments.

[0032] (2) Obtain the OsEIL1 gene fragment with the predicted target site

[0033] Target prediction was performed using https: / / rnaidesigner.thermofisher.com / rnaiexpress / . See Figure 2 , and the primer was designed to amplify a 301 bp small fragment containing the predicted target site. In the design of the primer, the nucleotide sequences of the enzyme cutting sites BamHI and SalI were added to the 5' ends of the upper and lower strands, respectively, and protection bases were added; the primer sequences are as follows:

[0034] EIL1-BamHI-F: cgcGGATccCCCGCATAGCGACTATGGATACG

[0035] EIL1-SalI-R: acgcGTCGACGTTGACTGCATTAGGCCTCTCCAT.

[0036] KOD enzyme was used for amplification, and the PCR program was as follows: 94℃ for 2 min for pre-denaturation, 98℃ for 10 s for denaturation, and 68℃ for 2 min for annealing and extension. The obtained PCR product was small, and electrophoresis detection was performed using a 2% agarose gel. After electrophoresis, the target band was recovered under a UV gel cutter, and the product was purified using a gel recovery kit. The gel recovery product was ligated to the cloning vector P-easyblunt for sequencing to confirm whether the fragment had point mutations.

[0037] The first intron of GA20 oxidase of potato (gtacggaccgtactactctattcgtttcaatatatttatttgtttcagctgactgcaagattcaaaaatttctttattattttaa attttgtgtcactcaaaaccagataaacaatttgatatagaggcactatatatatacatattctcgattatatatgtaaatgagttaacctttttttccacttaaattatatag) was used as a linker to construct the intermediate vector linker-pUCC RNAi containing appropriate restriction sites.

[0038] (3) Obtaining the hairpin fragment of the RNAi expression vector

[0039] The intermediate vector linker-pUCC RNAi and the plasmid with the predicted target site of EIL1 described above were digested with restriction endonuclease BamHI and Sail, and the enzyme digestion system was 50 μL (including 5 μL cutsmart buffer, 3 μL enzyme, 3 μg target vector). After enzyme digestion at 37°C for two hours, agarose gel electrophoresis detection and gel recovery were also performed, and T4 ligase was used to connect the two fragments to form EIL1-linker. The connection system was (including 1 μL T4 DNA ligase buffer, enzyme, fragment) 16° connection overnight, and the connection product was transformed into E. coli competent DH5a.

[0040] The specific steps are as follows: after the commercial DH5a was thawed on ice, the connection product was added, and after 40 s of heat shock at 42°C, it was quickly placed on ice for 5 min, 500 μL of antibiotic-free LB was added, and after recovery at 37°C for 30 min, it was coated on a solid culture medium with ampicillin resistance. After single colonies grew, ampicillin-resistant liquid medium was used for shaking culture, and after shaking culture at 37°C overnight, plasmid extraction was performed, and after obtaining a sufficient amount of plasmid, double digestion was performed again, and the restriction endonuclease was selected as XhoI and BglII. Since XhoI and Sail are homologous enzymes, and BglII and BamHI are homologous enzymes, the EIL1 obtained by the previous enzyme digestion is connected to the other end of the linker in reverse, so that a special fragment EIL1-linker-EIL1 that can form a hairpin structure is obtained. The special fragment is digested with Sail and PstI and connected into the binary transformation vector pCambia2300, and at this time the promoter of EIL1 is 35S, please refer to Figure 1 .

[0041] (4) Construction of the promoter-driven vector of OsPIN2

[0042] The 2999bp upstream of the OsPIN2 gene was selected as the promoter sequence to be cloned, and the genomic DNA was used as the template. The appropriate primers were designed for amplification. The primer sequences are as follows:

[0043] F: tgaccatgattacgaattccaaatcagctgcgaaacga

[0044] R: agaggatccccgggtacccgcgccggcgacggtggcgg

[0045] The KOD enzyme was also used for amplification, and the PCR program was as follows: 94℃ for 2min for pre-denaturation, 98℃ for 10s for denaturation, and 68℃ for 4min for annealing and extension. The obtained PCR product was detected by electrophoresis on a 1% agarose gel, and after electrophoresis, the target band was recovered under ultraviolet gel cutting instrument, and the product was purified by gel recovery kit.

[0046] The above obtained 35s promoter vector was digested with restriction endonuclease EcoR1 and KpnI for double digestion, and the linearized vector was recovered by agarose gel electrophoresis and connected with the amplified OsPIN2 promoter for homologous recombination. The connection system was 5μL (2.5μL basic mix, 1.5μL linearized vector, 0.5μL promoter), and the reaction was carried out at 50℃ for 15min, and then transformed into E. coli competent cells. After screening on the kanamycin-containing resistance plate, a single colony was selected for shaking bacteria to obtain plasmid, and then sequencing was performed to identify whether the promoter was mutated. The plasmid with correct sequencing was transformed into EHA105 by heat shock method to form the OsEIL1 gene RNAi expression vector as shown in Figure 1 .

[0047] The specific steps are as follows: after the -80 stored EHA105 was thawed on ice, 5μL plasmid was added, and then it was quickly frozen in liquid nitrogen and melted in a 37℃ water bath pot. After complete melting, it was again quickly frozen in liquid nitrogen, and this was repeated three times. Then 500μL of antibiotic-free LB was added, and it was incubated at 28℃ for 2-3 hours on a shaker. Then it was plated on a kanamycin and rifampicin resistant solid medium, and it was placed in a 28℃ incubator for 2 days.

[0048] (5) Obtaining of transgenic plants

[0049] The specific preparation of transgenic plants is as follows:

[0050] 5.1) Agrobacterium-mediated rice transformation

[0051] Callus preparation: The rice seeds were peeled and put into a triangular bottle. First, they were washed with 70% alcohol for 0.5-1 minute and then the alcohol was poured out. Then, the seeds were washed with 5% sodium hypochlorite for 30 minutes. After washing, the seeds were washed with sterilized water for more than 5 times to remove the extra water, and then were sowed on NB0 medium and cultured in dark at 25°C for 10 days.

[0052] Callus subculture: After 10 days of dark culture, the buds and seeds were removed. The callus was inoculated on NB0 and cultured for 20-30 days.

[0053] Agrobacterium preparation: The Agrobacterium stock solution was coated on LB solid plate with (Rif, Kana, Strep) and cultured at 28°C for 2.5 days.

[0054] Co-culture: 40 ml of AAM solution was poured into a 50 ml centrifuge tube, 40 μl of acetosyringone (100 mM) was added, and 1 / 4 small spoonful area of bacteria was scraped from the plate and suspended in the AAM solution to ensure that the bacteria solution was completely suspended and uniform. The cultured callus (light yellow hard round callus) was immersed in it for 15-30 minutes and gently shaken, and then the callus was taken out and placed on NA medium. It was cultured in dark at 25°C for 2-3 days.

[0055] Resistance screening: The callus tissue after co-culture was washed with sterilized water for several times, and then cefotaxime was added and washed for 30 minutes. After pouring out the water, the callus tissue was poured on filter paper, the excess water was absorbed, and then placed on S medium and cultured in dark at 25°C for 20-30 days.

[0056] Differentiation: The resistant callus tissue was selected and placed on P medium and cultured in dark at 25°C for 20 days. After the callus turned white, it was subcultured on R medium and cultured in light at 28°C for about 7 days to germinate.

[0057] Seedling culture: The green sprouts obtained above were moved to 1 / 2MS medium and cultured in light at 28°C for two weeks and then transplanted.

[0058] Transgenic seedling transplantation: The test tube seedlings in good growth state were selected, the sealing film was opened, and an appropriate amount of sterile water was added. The culture room was placed in light for about 7 days, and then the agar was washed off and transplanted to the greenhouse for growth.

[0059] 5.2) T0 generation plant resistance gene detection

[0060] The transgenic seedlings in the field were grown for about three weeks, and then the resistance gene NPTII was detected. The specific method was the same as the extraction of genomic DNA described above. After extraction, the transgenic positive was identified by PCR. The primer sequence was:

[0061] F: tccggccgcttgggtggagag

[0062] R: ctggcgcgagcccctgatgct

[0063] PCR program is 95℃ 2min pre-denaturation, 95℃ denaturation 10s, 58℃ annealing 30s, 72℃ extension 10s, 28 cycles, the obtained PCR product is detected by agarose gel electrophoresis, if there is a band, it is transgenic positive.

[0064] 5.3) T1 generation plant expression detection

[0065] After the T0 generation harvested seeds are placed in an oven at 42℃ for about 1 week to break dormancy and then sown, this is the T1 generation transgenic seedlings. The roots of the T1 generation seedlings are sampled and some water is absorbed with absorbent paper, and then frozen in liquid nitrogen and ground. The whole operation is kept at low temperature and the centrifugation step during operation is performed with a 4℃, 12000g low temperature centrifuge.

[0066] After grinding, 1 mL of TRIzol (Invitrogen) is quickly added, and the liquid is mixed evenly with a vortex oscillator. It is left to stand at room temperature for 5 minutes and then centrifuged. The next steps are similar to the CTAB method for extracting DNA, but note that RNAase-free centrifuge tubes, gun tips, freshly opened chloroform, isopropanol and anhydrous ethanol are used during the operation. Finally, the RNA precipitate is dissolved with 50 μL of DEPC water. The dissolved RNA is detected for quality, and whether there are two clear bands is detected by nucleic acid electrophoresis. If not, it means that the RNA has been degraded and needs to be extracted again. If the bands are clear, the next step is to use a reverse transcription kit to obtain the root cDNA of the transgenic material, which is then detected by fluorescent quantitative PCR to obtain the expression level of the OsEIL1 gene in the root of the transgenic material. Plants with reduced expression are selected for transplanting and breeding.

[0067] As shown in Figure 3 , the roots of four T1 generation seedlings (named R1, R2, R3 and R4, respectively) and the roots of wild type rice ZH11 (Zhonghua 11) are selected for OsEIL1 gene expression content testing. The testing method is as shown above. It can be seen that the expression content of the OsEIL1 gene in the roots of the transgenic rice is less than that of the OsEIL1 gene in the roots of the wild type rice ZH11 (Zhonghua 11). This shows that the RNAi expression vector of the OsEIL1 gene is transferred to the body of the rice, which inhibits the expression of the OsEIL1 gene in the roots of the rice, i.e. reduces the expression of the OsEIL1 gene in the roots of the rice.

[0068] This demonstrates that by following the steps described above—extracting genomic DNA, obtaining the OsEIL1 gene fragment with the predicted target, obtaining the hairpin structure fragment of the RNAi expression vector, and constructing the OsPIN2 promoter-driven vector—an RNAi expression vector for the rice OsEIL1 gene can be obtained, with the promoter being the promoter of the rice OsPIN2 gene.

[0069] Transgenic insertion of the above-mentioned rice OsEIL1 gene RNAi expression vector into rice seeds can reduce the expression level of the OsEIL1 gene in rice roots.

[0070] 5.4) Screening of T2 generation plants for resistance to determine stable genetic lines

[0071] After harvesting seeds from individual T1 generation plants, they were placed in a 42℃ oven for approximately one week to break dormancy. The seeds were then sown on a sieve for resistance screening. At least 30 seedlings were screened, and the antibiotic used was cannabinoids at a concentration of 50 mg / L.

[0072] The specific operation is as follows: After sowing the seeds on a sieve, germinate them in the dark for 2 days. After the seeds germinate, lower the water level to below the sieve and cultivate them in the dark for 1 day. Then add antibiotics and cultivate them in the dark for 3 days. Finally, cultivate them in the light for 7 days and observe the phenotype. Resistant seedlings show better growth and are green in color, while non-resistant seedlings show poor growth and are white.

[0073] After screening, the fully resistant strain numbers were recorded, and the transgenic rice was numbered R1, R2, R3 and R4 respectively. The wild-type rice Zhonghua 11 was named ZH11. The transgenic rice and wild-type rice were sown in high-nitrogen fields and low-nitrogen fields at the Nanfan Base in Lingshui County, Hainan Province, respectively, for phenotypic observation and statistics.

[0074] like Figure 4 As shown, *** indicates that the significance level of the statistical data is less than 0.001, and the nitrogen content in the high-nitrogen field is 300 kg / ha. -1 The nitrogen content in low-nitrogen fields is 50 kg ha. -1 In both high-nitrogen and low-nitrogen fields, the aboveground biomass of transgenic rice varieties R1, R2, R3, and R4 was significantly increased compared to ZH11.

[0075] like Figure 5 As shown, *** indicates a significance level of less than 0.001, ** indicates a significance level of less than 0.01, and * indicates a significance level of less than 0.05. The nitrogen content in the high-nitrogen field is 300 kg ha. -1 The nitrogen content in low-nitrogen fields is 50 kg ha. -1In high nitrogen field, the grain length of transgenic rice R1, R2, R3 and R4 was significantly increased compared with ZH11, while the grain width and grain thickness of transgenic rice R1, R2, R3 and R4 were similar to ZH11.

[0076] Referring to the table Figure 5 In low nitrogen field, the grain length of transgenic rice R1, R2, R3 and R4 was significantly increased compared with ZH11, while the grain width and grain thickness of transgenic rice R1, R2, R3 and R4 were similar to ZH11.

[0077] As shown in the table Figure 6 , *** indicates that the statistical data is significant at less than 0.001, * indicates that the statistical data is significant at less than 0.05, the nitrogen content in high nitrogen field is 300 Kg ha -1 , and the nitrogen content in low nitrogen field is 50 Kg ha -1 In high nitrogen field and low nitrogen field, the thousand-grain weight of transgenic rice R1, R2, R3 and R4 was significantly increased compared with ZH11.

[0078] As shown in the table Figure 7 , *** indicates that the statistical data is significant at less than 0.001, ** indicates that the statistical data is significant at less than 0.01, and * indicates that the statistical data is significant at less than 0.05, the nitrogen content in high nitrogen field is 300 Kg ha -1 , and the nitrogen content in low nitrogen field is 50 Kg ha -1 In high nitrogen field, the yield per plant of transgenic rice R1, R2, R3 and R4 was increased in some cases, but also flat, indicating that the inhibition of expression of OsEIL1 gene had no obvious effect on the yield per plant of rice in high nitrogen field.

[0079] Referring to the table Figure 7 In low nitrogen field, the yield per plant of transgenic rice R1, R2, R3 and R4 was significantly increased compared with ZH11.

[0080] As shown in the table Figure 8 , *** indicates that the statistical data is significant at less than 0.001, ** indicates that the statistical data is significant at less than 0.01, and * indicates that the statistical data is significant at less than 0.05, the nitrogen content in high nitrogen field is 2 mM, and the nitrogen content in low nitrogen field is 0.2 mM. In high nitrogen field, the nitrate reductase activity of transgenic rice R1, R2, R3 and R4 was significantly increased compared with ZH11.

[0081] Referring to the table Figure 8 In low nitrogen field, the nitrate reductase activity of transgenic rice R1, R2, R3 and R4 was partially significantly increased and partially slightly increased compared with ZH11.

[0082] In summary, the RNAi expression vector of the rice OsEIL1 gene in the present application can reduce the expression amount of the OsEIL1 gene in the rice roots, i.e., specifically inhibit the expression of the OsEIL1 gene in the rice roots, thereby improving the nitrogen utilization efficiency and yield of the rice. The test results prove that, compared with the wild-type rice with normal expression of the OsEIL1 gene, the transgenic rice containing the RNAi expression vector has significantly increased aboveground biomass, thousand-grain weight and nitrate reductase activity under both low-nitrogen and high-nitrogen conditions. Meanwhile, compared with the wild-type rice with normal expression of the OsEIL1 gene, the transgenic rice containing the RNAi expression vector has significantly increased yield per plant under low-nitrogen conditions.

[0083] The core of the present application is that the OsEIL1 gene is specifically silenced in the rice roots, i.e., the expression amount of the OsEIL1 gene in the rice roots is reduced, while the OsEIL1 gene in the aboveground part of the rice is not specially treated, so that the normal growth and development of the rice can be ensured, and the purpose of improving the nitrogen utilization efficiency and yield of the rice can also be achieved.

[0084] It can be understood that the above examples only express the preferred embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as a limitation on the patent scope of the present application; it should be noted that, for ordinary skilled persons in the art, the above technical features can be freely combined without departing from the concept of the present application, and several modifications and improvements can also be made, which all belong to the protection scope of the present application; therefore, any equivalent transformation and modification within the scope of the claims of the present application shall belong to the scope of the claims of the present application.

Claims

1. Application of an RNAi expression vector of rice OsEIL1 gene in improving nitrogen use efficiency of rice, characterized in that, The RNAi expression vector can inhibit the expression amount of the OsEIL1 gene in the rice roots; the RNAi sequence of the RNAi expression vector is shown as SEQ ID NO. 3; the RNAi expression vector comprises a hairpin structure of the OsEIL1 gene; and the RNAi expression vector further comprises a promoter, wherein the promoter is a promoter of a rice OsPIN2 gene, and the sequence of the promoter is shown as SEQ ID NO.

4.

2. The use of the RNAi expression vector of the rice OsEIL1 gene in improving the yield of rice in low nitrogen field, characterized in that, The RNAi expression vector can inhibit the expression amount of the OsEIL1 gene in the rice roots; the RNAi sequence of the RNAi expression vector is shown as SEQ ID NO. 3; the RNAi expression vector comprises a hairpin structure of the OsEIL1 gene; the RNAi expression vector further comprises a promoter, wherein the promoter is a promoter of a rice OsPIN2 gene, and the sequence of the promoter is shown as SEQ ID NO. 4; the nitrogen content of the low-nitrogen field is 50Kg / ha -1 ; and the yield of the rice is improved by improving the above-ground biomass, the thousand-grain weight and / or the yield per plant of the rice.

3. Use according to claim 1 or 2, characterized in that, The sequence of the OsEIL1 gene is shown as SEQ ID NO.

1.

4. Use according to claim 1 or 2, characterized in that, The amino acid sequence of the protein encoded by the OsEIL1 gene is shown as SEQ ID NO. 2.

Images