A linker composition and small RNA library and construction method thereof

Abstract

The invention discloses a linker composition and a small RNA library and a construction method thereof, and relates to the field of biological sequencing. The linker composition comprises a 3' linker and a 5' linker, wherein the 3' linker and the 5' linker respectively have a palindromic structure and both ends have protruding random bases, and the 5' linker adopts a composite design of DNA and RNA. This new structure enables the 3' linker and the 5' linker to be simultaneously connected to a target nucleic acid, effectively shortening the reaction time of library construction, requiring only 30 minutes to complete the library connection reaction, and reducing the risk of RNA degradation; in addition, this linker structure can effectively avoid linker self-connection, thereby improving the purity of the constructed library, and applying it to the construction of a small RNA library can obtain a small RNA library with high purity and high yield based on an ultra-trace sample.

Description

Technical Field

[0001] The present invention relates to the field of biological sequencing, and in particular to a linker composition and a small RNA library and a construction method thereof. Background Art

[0002] Small RNA is a large class of regulatory molecules in organisms, including micro RNA, siRNA, piRNA, snRNA, snoRNA and rsRNA, which play an important regulatory role in organisms. In recent years, some studies have successfully used the spectrum of small RNA as a marker for the diagnosis of specific diseases. In the future, the detection of small RNA will be widely used in the early diagnosis, typing and personalized detection and treatment of diseases. Common small RNA quantitative detection technologies include deep sequencing technology, chip technology and qRT-PCR technology. The latter two require the synthesis of specific probes, so they can only detect small RNAs of known types. High-throughput sequencing technology has been widely used in the field of small RNA research because of its high throughput, high sensitivity, no need for any prior sequence information and secondary structure information, and the ability to discover new small RNA molecules. The main method for constructing a library for small RNA deep sequencing is the two-step adapter ligation reverse transcription method. This method is suitable for the construction of any RNA deep sequencing library suitable for ligation reactions, including interrupted long transcript RNA, such as small RNA sequencing, CLIP sequencing, RIP sequencing, GRO sequencing, etc.

[0003] The steps for constructing a library of existing small RNA or RNA fragments first require connecting a 3' adapter sequence to the 3' end of the small RNA, and then connecting a 5' adapter sequence to the 5' end of the small RNA or RNA fragment. This part of the product can be used to obtain a library for deep sequencing after reverse transcription and PCR amplification. During the ligation reaction, since small RNA fragments usually have only 16 to 32 nucleotides, conventional methods are prone to self-ligation of small RNAs, and ligation reactions will occur between excessive 5' adapters and 3' adapters, producing useless by-products. For small RNA or RNA fragments with very low starting amounts, the by-products generated by the connection between the 5' and 3' adapters account for the vast majority, which seriously hinders the subsequent PCR amplification of the library.

[0004] Existing methods for constructing libraries of small RNA or RNA fragments find it difficult to detect small RNA in trace samples (less than 100 ng of total RNA or 1 ng of small RNA), and there are technical difficulties such as low efficiency of micro-ligation, long reaction time and connector contamination. There are also problems such as complex processes, low stability and high costs.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The object of the present invention is to provide a linker composition and a small RNA library and a construction method thereof.

[0007] The present invention is achieved in that:

[0008] In a first aspect, an embodiment of the present invention provides a linker composition, which includes a 3' linker and a 5' linker;

[0009] The structure of the 5' linker includes a first random sequence, a first sequence, a second sequence and a third sequence connected in sequence; the first sequence and the third sequence are reverse complementary sequences to each other and can complement each other to form a palindrome structure; the third sequence includes a DNA base part and an RNA base part connected to each other, and the RNA base part is located at the 3' end of the third sequence and has a length of ≥2nt;

[0010] The structure of the 3' linker includes a fourth sequence, a fifth sequence, a sixth sequence and a second random sequence connected in sequence; the fourth sequence and the sixth sequence are reverse complementary sequences to each other and can complement each other to form a palindrome structure.

[0011] In a second aspect, an embodiment of the present invention provides a kit, comprising: the linker composition described in the above embodiment.

[0012] In a third aspect, an embodiment of the present invention provides a method for constructing a small RNA library, which comprises: using the linker composition described in the above embodiment.

[0013] In a fourth aspect, an embodiment of the present invention provides a small RNA library, which includes: a small RNA library constructed by the construction method described in the above embodiment.

[0014] In a fifth aspect, embodiments of the present invention provide the use of the small RNA library as described in the preceding embodiments in nucleic acid sequencing for purposes other than disease diagnosis or treatment.

[0015] The present invention has the following beneficial effects:

[0016] The present invention designs a novel 3' adapter and 5' adapter for sequencing library, wherein the 3' adapter and the 5' adapter respectively have a palindromic structure, and both ends have protruding random bases, and the 5' adapter adopts a composite design of DNA and RNA, and this new structure can enable the 3' adapter and the 5' adapter to be simultaneously connected to the target nucleic acid, significantly shortening the reaction time of library construction, and only requiring 30 minutes to complete the adapter connection reaction, thereby reducing the risk of RNA degradation; this structure can also effectively avoid adapter self-connection, thereby improving the purity of the library, and is applied to the construction of a small RNA library, thereby obtaining a small RNA library with high purity and high yield based on an ultra-trace sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 A schematic diagram of the library construction process provided by an embodiment of the present invention;

[0019] Figure 2 The qseq quality control results of the library constructed in Example 1;

[0020] Figure 3 Schematic diagram of the joint structure of Scheme C in Example 2;

[0021] Figure 4 Comparison of library concentration results constructed by Schemes A, B, and C in Example 2;

[0022] Figure 5 Comparison of library concentration results for linker construction in Scheme C and Example 1;

[0023] Figure 6 Fragment analysis of a library constructed using the linker composition of Scheme C in Example 2 on 1 ng of sample. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0025] In one aspect, an embodiment of the present invention provides a linker composition, comprising: a 3' linker and a 5' linker;

[0026] The 5' linker is used to connect to the 5' end of the target sequence, and the structure of the 5' linker includes a first random sequence, a first sequence, a second sequence and a third sequence connected in sequence; the first sequence and the third sequence are reverse complementary sequences to each other and can complement each other to form a palindrome structure; the third sequence includes a DNA base part and an RNA base part connected to each other, and the RNA base part is located at the 3' end of the third sequence and has a length of ≥2nt;

[0027] The 3' linker is used to connect to the 3' end of the target sequence. The structure of the 3' linker includes a fourth sequence, a fifth sequence, a sixth sequence and a second random sequence connected in sequence. The fourth sequence and the sixth sequence are reverse complementary sequences to each other and can complement each other to form a palindrome structure.

[0028] The 5' linker provided in the embodiment of the present invention adopts RNA and RNA mixed sequence structure design, which realizes the simultaneous rapid connection of small RNA with 3' linker and 5' linker, greatly saves reaction time, reduces the risk of RNA degradation, and improves the construction success rate; secondly, the 5' linker and the 3' linker are designed with palindromic structures, which reduces the probability of non-specific self-connection of the linker, ensuring efficient connection of trace samples (≤100ng total RNA or 1ng small RNA); in addition, the 5' linker and the 3' linker respectively have random sequences protruding from the 5' end and the 3' end, so that the linker and most target fragments can be accurately complementary and paired, thereby achieving the purpose of linker connection.

[0029] In some embodiments, the 3' linker is a DNA molecule, and in the 5' linker, except for the RNA base portion, the remaining sequence is DNA.

[0030] In some embodiments, the length of the RNA base portion can be any one of 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, and 19 nt, or a range between any two of them, preferably 2 to 6 nt.

[0031] In some embodiments, the first random sequence is located at the 5' end of the 5' adapter sequence; the second random sequence is located at the 3' end of the 3' adapter sequence. Under this limited range, the 5' adapter and the 3' adapter are designed with the same chain protrusion, which avoids the possibility of random sequence self-complementary connection of the adapter. Even if they are randomly complementary, since the 5' end is adjacent to the 5' end and the 3' end is adjacent to the 3' end, the adapter self-connection is avoided.

[0032] In some embodiments, the 5' end of the first random sequence is dephosphorylated or has a blocking modification, and the 3' end of the second random sequence has a blocking modification. The protruding random sequence ends of the 5' adapter and the 3' adapter are respectively dephosphorylated and / or blocked, further reducing the possibility of adapter self-ligation.

[0033] In some embodiments, the 5' end of the 3' linker has a phosphorylation modification.

[0034] In some embodiments, the blocking modification includes: any one of dideoxy modification (ddC modification), reverse dT modification, spacer modification (C3 spacer modification, C6 spacer modification), MGB modification and phosphorylation modification.

[0035] In some embodiments, the length of the first random sequence is 1 to 20 nt, specifically any one of 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 nt or a range between any two, preferably 5 to 7 nt. Too short will affect the connection efficiency, and too long will increase nonspecificity.

[0036] In some embodiments, the length of the first sequence is 3 to 20 nt, specifically any one of 3, 4, 6, 8, 10, 12, 14, 16, 18, 20 nt or a range between any two of them, preferably 7 to 9 nt, which will definitely affect the structural stability of the linker palindrome sequence, and too long will produce too many redundant sequences.

[0037] In some embodiments, the length of the second sequence is 6 to 30 nt, specifically any one of 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 nt or a range between any two, preferably 23 to 25 nt, and the optimal experimental steps are selected according to the adapted sequencing platform.

[0038] In some embodiments, the length of the third sequence is 3 to 20 nt. The length of the third sequence is the same as the length of the first sequence.

[0039] In some embodiments, the length of the fourth sequence is 3 to 20 nt, specifically any one of 3, 4, 6, 8, 10, 12, 14, 16, 18, 20 nt or any range between two thereof, preferably 7 to 9 nt, too short will affect the structural stability of the linker palindrome sequence, too long will produce too many redundant sequences.

[0040] In some embodiments, the length of the fifth sequence is 6 to 40 nt, specifically any one of 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 40 nt or a range between any two, preferably 33 to 35 nt, and the optimal experimental steps are selected according to the adapted sequencing platform.

[0041] In some embodiments, the length of the sixth sequence is 3 to 20 nt. The length of the fourth sequence is the same as the length of the sixth sequence.

[0042] In some embodiments, the length of the second random sequence is 1 to 20 nt, specifically any one of 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 nt or a range between any two, preferably 5 to 7 nt. Too short will affect the connection efficiency, and too long will increase nonspecificity.

[0043] It should be noted that the present invention has no special limitation on the specific sequence of the joint composition, as long as it meets the limitations of the structural features described in any of the above embodiments, the corresponding technical effects can be achieved. The specific joint sequence can be designed and matched according to different sequencing platforms and equipment. On the other hand, an embodiment of the present invention also provides a kit, which includes: the joint composition described in any of the above embodiments.

[0044] The linker composition provided in the embodiment of the present invention is used in combination with RNA double-stranded ligase (eg, T4 RNA ligaseII wild-type double-stranded ligase) to achieve one-time connection of RNA double-ended linkers, thereby reducing the experimental time and improving the connection efficiency.

[0045] In some embodiments, the kit further comprises: RNA double-strand ligase. The RNA double-strand ligase is specifically T4 RNA ligase II wild-type double-strand ligase.

[0046] In some embodiments, the kit further comprises: any one or more combinations of an adaptor ligation buffer, a reverse transcription primer, a reverse transcription buffer, a PCR buffer, and a PCR primer.

[0047] This application has no special restrictions on "connector connection buffer, reverse transcription primer, reverse transcription buffer, PCR buffer and PCR primer", and they can be configured and obtained using existing commercially available products or based on conventional technical knowledge of existing RNA sequencing libraries.

[0048] In some embodiments, the reverse transcription primer is complementary to a partial region of the 3' adapter sequence and specifically hybridizes. The partial region can be the fifth sequence of the 3' adapter or a portion thereof. The length of the reverse transcription primer and the complementary length of the 3' adapter can be 10-30 nt, specifically any one of 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 nt or a range between any two.

[0049] On the other hand, an embodiment of the present invention further provides a method for constructing a small RNA library, which comprises: using the linker composition described in any of the above embodiments.

[0050] In some embodiments, the construction method further comprises:

[0051] The adapter composition, RNA double-strand ligase and the sample to be tested are mixed, and adapter ligation is performed to obtain an adapter-ligated product;

[0052] Reverse transcription is performed on the product after the adapter is connected to obtain a reverse transcription product;

[0053] The reverse transcription product is PCR-amplified to obtain a library. Figure 1 .

[0054] In some embodiments, the conditions for the joint connection include: 20-42°C, 5-40 min. The temperature can be any one of 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42°C or any two thereof; the time can be any one of 5, 10, 15, 20, 25, 30, 35, 40 min or any two thereof; preferably 36-38°C, 25-35 min.

[0055] In some embodiments, the amount of the 5' linker or 3' linker in the linker composition added to the reaction system may be 1-20 pmol, specifically any one of 1, 5, 10, 15, 20 pmol or any two thereof, preferably 4-6 pmol.

[0056] In some embodiments, the reverse transcription comprises: mixing the product after connecting the adapter, the reverse transcription buffer, and the reverse transcription primer, and incubating at a constant temperature; the conditions of the constant temperature incubation include: 30-48°C, 10-40min. The temperature can be any one of 30, 32, 34, 36, 37, 38, 40, 42, 44, 46, 48°C or a range between any two thereof; the time can be any one of 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 37, 38, 40min or a range between any two thereof; preferably 36-38°C, 25-35°C.

[0057] In some embodiments, the PCR reaction procedure includes: denaturation at 98°C for 2 min; 98°C for 15 s, 60°C for 30 s, and 72°C for 30 s; the process is cycled for 15 to 18 cycles; and reaction at 72°C for 5 min.

[0058] On the other hand, an embodiment of the present invention further provides a small RNA library, which includes: a small RNA library constructed by the construction method described in any of the above embodiments.

[0059] In some embodiments, the small RNA includes any one or more of micro RNA (miRNA), siRNA, piRNA, snRNA, snoRNA and rsRNA.

[0060] In some embodiments, the length of the small RNA is 16 to 32 bp.

[0061] On the other hand, the present invention also provides the use of the small RNA library described in any of the above embodiments in nucleic acid sequencing for purposes other than disease diagnosis or treatment. The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0062] Example 1

[0063] A method for constructing a small RNA library comprises the following steps.

[0064] 1. Small RNA extraction products for library construction

[0065] First, quantification was performed using Qubit 4.0 and Qubit microRNA assay kit. For small RNAs in library construction, 10 pg-20 ng can be used as the starting amount. In this example, 1 ng was used as the starting amount.

[0066] 2. Design library adapters and adapter ligation

[0067] 5' adapter: 5'-NNNNNNNAAGTCGGATTGTCTTCCTAAGACCGCTTGGCCTCCGAC r U r U r -3'; NNNNNN is the first random sequence, AAGTCGGA is the first sequence, TTGTCTTCCTAAGACCGCTTGGCC is the second sequence, TCCGAC r U r U r is the third sequence, TCCGA is the DNA base part in the third sequence, C r U r U r The 5' linker is based on the sequence shown in SEQ ID NO: 1, with the 5' end dephosphorylated.

[0068] 3' linker: 5'-Pho-AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGTCCGACTTNNNNNN-ddC-3'; wherein AAGTCGGA is the fourth sequence, TCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG is the fifth sequence, TCCGACTT is the sixth sequence, and NNNNNN is the second random sequence. The 3' linker is based on the sequence shown in SEQ ID NO: 2, with phosphorylation at the 5' end and dideoxy modification at the 3' end.

[0069] Small RNA adapter ligation

[0070] The small RNA product was mixed with the ligation buffer and incubated at 70°C for 2 min. The designed 5' adapter and 3' adapter were then added to the reaction system (the input amount of the 5' adapter and the 3' adapter was 5 pmol each), and the reaction was incubated at a constant temperature of 37°C for 30 min.

[0071] 3. Reverse transcription reaction:

[0072] After purifying the product connected to the adapter in step 2, add reverse transcription buffer and reverse transcription primer, mix well, and incubate at a constant temperature of 42° C. for 30 min.

[0073] The reverse transcription primer sequences are as follows:

[0074] 5'-Pho-CTCTCAGTACGTCAGCAGTTNNNNNNNNNNCAACTCCTTGGCTCACAGAAC-3'; (the reverse transcription primer is obtained by phosphorylation modification at the 5' end of the sequence of SEQ ID NO: 3).

[0075] 4. PCR Amplification

[0076] Take the reverse transcription product, add PCRmix and PCR primers, mix well and place on a gradient PCR instrument for reaction. The reaction program is as follows: denaturation at 98℃ for 2 min; 98℃, 15s, 60℃, 30s, 72℃, 30s, this process is cycled for 15 to 18 cycles; then react at 72℃ for 5min.

[0077] PCR primers are as follows.

[0078] Forward sequence (SEQ ID NO:4):

[0079] 5'-GCATGGCGACCTTATCAGNNNNNNNNNTTGTCTTCCTAAGACCGCTTGG-3';

[0080] Reverse sequence (obtained by phosphorylation modification at the 5' end of the sequence shown in SEQ ID NO:5):

[0081] 5'-Pho-CTCTCAGTACGTCAGCAGTTNNNNNNNNNNCAACTCCTTGGCTCACAGAAC-3'.

[0082] 5. Obtain the library

[0083] The PCR product was purified by magnetic beads to obtain pure library products. The qseq quality control results were as follows: Figure 2 As shown, it was in line with the design expectations, and the remaining products were used for subsequent sequencing.

[0084] Example 2

[0085] According to the small RNA library construction method provided in Example 1, three schemes (A, B and C) were set up, and the three schemes respectively provided a linker composition, which was different from the linker composition of Example 1 in that:

[0086] The RNA bases in the 5' linker of Scheme A were partially replaced with DNA bases;

[0087] The 3' linker of Scheme B lacks the second random sequence, and the 5' linker lacks the first random sequence;

[0088] The 3' linker and 5' linker of Scheme C do not have a palindromic structure, but a Y structure (see Figure 3 ). Among them, the 5' linker sequence contains two parts of sequence:

[0089] Y5-1: 5'-NNNNNNNAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA-3' (SEQ ID NO: 6);

[0090] Y5-2: 5'-CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT-3' (SEQ ID NO: 7).

[0091] The 3' linker also consists of two parts:

[0092] Y3-1: 5'-Pho-AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA-3' (having phosphorylation modification at the 5' end of the sequence shown in SEQ ID NO: 8);

[0093] Y3-2: 5′-CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTTNNNNNN-ddC-3′ (having ddC modification at the 3′ end of the sequence shown in SEQ ID NO: 9).

[0094] According to the experimental process of Example 1, based on the linker compositions of Example 1 and Schemes A, B, and C, the small RNA extraction products with 1 ng, 2 ng, and 5 ng of human plasma samples were tested for library construction. The verification results showed that the design of the missing DNA and RNA composite structure (Scheme A) and the linker missing with protruding terminal random sequences (Scheme B) could not successfully build a library when the small RNA input amount was 5 ng. Figure 4 As shown; the double-stranded linker design lacking the self-palindromic spacer sequence, such as the conventional Y-type linker (Scheme C), can be successfully constructed, but the concentration of the constructed library is significantly lower than the concentration of the library in Example 1 of the present application (see Figure 5), and scheme C will produce a large number of non-specific connections between adapters and products when a small amount of sample is put into library construction. Figure 6 shown.

[0095] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A joint composition, characterized in that It includes: 3' linker and 5' linker; The structure of the 5' linker includes a first random sequence, a first sequence, a second sequence and a third sequence connected in sequence; the first sequence and the third sequence are reverse complementary sequences to each other and can complement each other to form a palindrome structure; the third sequence includes a DNA base part and an RNA base part connected to each other, and the RNA base part is located at the 3' end of the third sequence and has a length of ≥2nt; The structure of the 3' linker includes a fourth sequence, a fifth sequence, a sixth sequence and a second random sequence connected in sequence; the fourth sequence and the sixth sequence are reverse complementary sequences to each other and can complement each other to form a palindrome structure; The 3' linker is a DNA molecule, and in the 5' linker, except for the RNA base part, the remaining sequence is DNA; The first random sequence is located at the 5' end of the 5' linker sequence; The second random sequence is located at the 3' end of the 3' linker sequence; The 5' end of the first random sequence is dephosphorylated or has a blocking modification; The 3' end of the second random sequence has a blocking modification; The 5' end of the 3' linker is phosphorylated.

2. The joint composition according to claim 1, characterized in that The length of the RNA base portion is 2 to 6 nt.

3. The joint composition according to claim 1, characterized in that The length of the first sequence is 3 to 20 nt; The length of the second sequence is 6 to 30 nt; The length of the third sequence is 3 to 20 nt; The length of the fourth sequence is 3 to 20 nt; The length of the fifth sequence is 6 to 40 nt; The length of the sixth sequence is 3 to 20 nt; The length of the first random sequence is 1 to 20 nt; The length of the second random sequence is 1 to 20 nt.

4. A kit, characterized in that: It includes: The joint composition according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that The kit also includes: RNA double-strand ligase; The RNA double-stranded ligase includes T4 RNA ligase II.

6. A method for constructing a small RNA library, characterized in that: It includes: The method is carried out using the joint composition according to any one of claims 1 to 3.

7. The method for constructing a small RNA library according to claim 6, characterized in that: The construction method also includes: The adapter composition, RNA double-strand ligase and the sample to be tested are mixed, and adapter ligation is performed to obtain an adapter-ligated product; Reverse transcription is performed on the product after the adapter is connected to obtain a reverse transcription product; The reverse transcription product is amplified by PCR to obtain a library.

8. A small RNA library, characterized in that It includes: Obtained by the construction method described in claim 6 or 7.

9. Use of the small RNA library as claimed in claim 8 in nucleic acid sequencing for purposes other than disease diagnosis or treatment.

Images