A Bupleurum bHLH transcription factor BcbHLH1 gene and its application

Abstract

The present invention provides a Bupleurum bHLH transcription factor BcbHLH1 gene and its application. The nucleotide sequence of the BcbHLH1 gene is shown as SEQ ID NO:1. Through exogenous hormone activation experiments, the present invention first discovered the key transcription factor BcbHLH1 whose expression pattern is consistent with the accumulation trend of saikosaponins in Bupleurum. Through experiments such as full-length cloning, subcellular localization, tissue expression characteristics, and transcriptional self-activation, the expression pattern of BcbHLH1, which is closely related to saikosaponin metabolism in the bHLH family, was analyzed; by transient overexpression in leaves, the biological function of BcbHLH1 in promoting saikosaponin synthesis was verified, and the regulatory mechanism was analyzed.

Description

Technical Field

[0001] The present invention relates to the technical field of biological genetic engineering, and particularly relates to a Bupleurum bHLH transcription factor BcbHLH1 gene and its application. Background Art

[0002] Bupleuri Radix is a commonly used bulk medicinal material, and its main pharmacodynamic components are pentacyclic triterpenoid saikosaponins (SSs). SSs are important indicators for evaluating the quality of Bupleuri Radix medicinal materials and have extensive medicinal value, but their content in Bupleuri Radix is low, and they are affected by factors such as genetic background, tissues and organs, growth stages, planting environments, and origins. Moreover, due to the complex structure of saikosaponins, it is difficult to synthesize them chemically, making it difficult to meet the growing market demand. Molecular breeding and metabolic engineering provide the possibility for its large-scale production, but the research on the metabolic regulation mechanism of SSs is still blank, and a large number of key enzymes and transcriptional regulatory genes involved in the synthesis have not been discovered, seriously restricting the development of Bupleuri Radix genetic engineering and metabolic engineering.

[0003] Research shows that the synthesis and release of plant secondary metabolites have spatial specificity (tissues and organs) and temporal specificity (developmental stages), and are affected by environmental factors and exogenous elicitors. Transcription factors such as bHLH, MYB, WRKY, bZIP, and AP2 / ERF play important regulatory roles in the biosynthesis of terpenoid secondary metabolites, determining the spatial and temporal expression and the specificity and efficiency of inducible expression of synthase genes. Using the spatial and temporal expression differences and stress response characteristics of secondary metabolites to identify key transcription factors that regulate secondary metabolites is the current strategy for analyzing the regulation mechanism of secondary metabolites.

[0004] There are significant differences in the content and composition of SSs in different growth stages and tissues and organs of Bupleuri Radix, and there are also differences in the expression levels of enzyme genes related to SSs synthesis. The accumulation of SSs has spatial and temporal specificity and is affected by the environment and exogenous elicitors. Therefore, exploring more transcription factors and related enzyme genes involved in SSs synthesis is of great significance for analyzing the SSs metabolic regulation network, biosynthesis pathway, and realizing molecular breeding of Bupleuri Radix. Summary of the Invention

[0005] In order to further explore transcription factors and related enzyme genes involved in SSs synthesis, the present invention provides a Bupleurum bHLH transcription factor BcbHLH1 gene and its application.

[0006] To achieve the above technical objectives, the technical solution adopted in this application is as follows:

[0007] In the first aspect, the present invention provides a Bupleurum bHLH transcription factor BcbHLH1 gene, whose nucleotide sequence is shown in SEQ ID NO: 1.

[0008] In the second aspect, the present invention provides a protein encoded by the BcbHLH1 gene described in the first aspect, whose amino acid sequence is shown in SEQ ID NO: 2.

[0009] In the third aspect, the present invention provides an expression vector containing the Bupleurum bHLH transcription factor BcbHLH1 gene described in the first aspect.

[0010] In the fourth aspect, the present invention provides a recombinant host cell containing the BcbHLH1 gene described in the first aspect or the expression vector described in the third aspect.

[0011] Preferably, the cell is selected from: bacteria, fungal cells, insect cells, mammalian cells or plant cells.

[0012] In the fifth aspect, the present invention provides the application of the BcbHLH1 gene described in the first aspect, the protein described in the second aspect, the expression vector described in the third aspect, or the recombinant host cell described in the fourth aspect in promoting the synthesis of saikosaponins in Bupleurum leaves.

[0013] Preferably, the BcbHLH1 gene described in the first aspect, the protein described in the second aspect, the expression vector described in the third aspect, or the recombinant host cell described in the fourth aspect promotes the synthesis of saikosaponins in Bupleurum leaves by transiently transforming Bupleurum leaves.

[0014] In the sixth aspect, the present invention provides a Bupleurum leaf transient transformation reagent, which includes an infiltration solution containing the BcbHLH1 gene described in the first aspect, the expression vector described in the third aspect, or the recombinant host cell described in the fourth aspect.

[0015] In the seventh aspect, the present invention provides a construction method of the Bupleurum leaf transient transformation reagent containing a recombinant host cell described in the sixth aspect, including the following steps:

[0016] Step 1: Extract total RNA from Bupleurum and reverse transcribe it into cDNA as a PCR template. Obtain an amplification product by PCR method, purify the amplification product and ligate it to the pNC-Cam1304-SubN vector to obtain the recombinant plasmid BcbHLH1-pNC-Cam1304-Sub;

[0017] Step 2: Using the recombinant plasmid BcbHLH1-pNC-Cam1304-Sub as a template, pEAQ-HT-DEST1 as a vector, and the restriction enzyme sites being SalI and XhoI, construct the BcbHLH1-OE overexpression recombinant plasmid.

[0018] Step 3: Transform the BcbHLH1-OE overexpression recombinant plasmid into competent Agrobacterium tumefaciens cells to obtain positive monoclonal strains.

[0019] Step 4: Add the bacterial solution of the positive monoclonal strain to a liquid LB medium containing kanamycin and rifampicin for culture. After the culture is completed, centrifuge to discard the supernatant, and resuspend the bacterial cells with an MES solution containing acetosyringone and MgCl2 to obtain an infection solution, which is the transient transformation reagent.

[0020] Preferably, in Step 1, the primer sequences used in the PCR method are as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0021] Preferably, in the liquid LB medium, the final concentrations of kanamycin and rifampicin are 50 μg / mL respectively.

[0022] Preferably, in the MES solution, the final concentrations of acetosyringone and MgCl2 are 0.2 mM and 10 mM respectively.

[0023] In the eighth aspect, the present invention provides the application of the transient transformation reagent described in the sixth aspect in transiently transforming Bupleurum chinense leaves to synthesize saikosaponins.

[0024] In the ninth aspect, the present invention provides a method for synthesizing saikosaponins by transiently transforming Bupleurum chinense leaves, including: injecting the transient transfection reagent obtained by the construction method described in the eighth aspect into the lower epidermis of Bupleurum chinense, and then culturing the injected Bupleurum chinense plants.

[0025] Preferably, the method for culturing the injected Bupleurum chinense plants is: at 25°C, place the injected Bupleurum chinense plants in the dark for 12 hours, and then culture them in a cycle of 12 hours of light culture and 12 hours of dark culture for 2 - 4 days.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] (1) Through exogenous hormone activation experiments, the present invention has first discovered the key transcription factor BcbHLH1 whose expression pattern is consistent with the accumulation trend of saikosaponins. Through full-length cloning, subcellular localization, tissue expression characteristics, transcriptional self-activation and other experiments, the expression pattern of BcbHLH1, which is closely related to saikosaponin metabolism in the bHLH family, is analyzed; the biological function of BcbHLH1 in promoting the synthesis of saikosaponins is verified by leaf transient overexpression, and the regulatory mechanism is analyzed.

[0028] (2) The transient transformation system of Bupleurum leaves established in the present invention provides a faster and more efficient experimental method for verifying functional genes related to the synthesis of saikosaponins in Bupleurum, which has important guiding significance for analyzing the metabolic regulation network and biosynthesis pathway of saikosaponins, and provides a theoretical basis for realizing the industrial extraction of saikosaponins through metabolic engineering technology and breeding excellent varieties of Bupleurum through genetic engineering technology, and has wide application value. Description of the Drawings

[0029] The drawings described herein are used to provide a further understanding of the present invention, form a part of the present invention, and the schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0030] Figure 1 It shows the content change of SSs in the roots of Bupleurum under the treatment of exogenous MeJA hormone in Example 1 of the present invention.

[0031] Figure 2 It shows the expression of BcbHLH1 gene in the roots of Bupleurum under the treatment of exogenous MeJA hormone in Example 1 of the present invention.

[0032] Figure 3 It shows the content change of SSs in the roots of Bupleurum under the treatment of exogenous GA hormone in Example 1 of the present invention.

[0033] Figure 4 It shows the expression of BcbHLH1 gene in the roots of Bupleurum under the treatment of exogenous GA hormone in Example 1 of the present invention.

[0034] Figure 5 It shows the PCR electrophoresis result of BcbHLH1 gene in Example 2 of the present invention, where M: Maker 2000.

[0035] Figure 6 It shows the result of tissue-specific expression analysis of BcbHLH1 gene in Example 3 of the present invention.

[0036] Figure 7 It shows the result of subcellular localization of BcbHLH1 gene in Example 4 of the present invention.

[0037] Figure 8 It shows the result of transcriptional self-activation analysis of BcbHLH1 gene in Example 5 of the present invention.

[0038] Figure 9This is for detecting the expression of the kanamycin gene in the transiently transformed leaves in Example 6 of the present invention. Among them, a, the leaves of Bupleurum chinense after 2 days, 3 days, and 4 days of transient expression of the empty vector (EV) and BcbHLH1-OE; lanes 1-9 are the PCR products of the kanamycin gene in the leaves transformed with the empty vector (EV) for 2 days, 3 days, and 4 days (3 biological replicates for each treatment); lane 10 is Maker 2000; lanes 11-19 are the PCR products of the kanamycin gene in the leaves transformed with BcbHLH1-OE for 2 days, 3 days, and 4 days (3 biological replicates for each treatment); b, the PCR products of the kanamycin gene in the wild-type WT Bupleurum chinense leaves, lane 1 is Maker2000; lanes 2-4 are the PCR products of the kanamycin gene in the wild-type WT Bupleurum chinense leaves (3 biological replicates).

[0039] Figure 10 This is the expression level of BcbHLH1 in the wild-type, empty vector, and transgenic Bupleurum chinense leaves in Example 6 of the present invention.

[0040] Figure 11 This is the differential gene expression profile of the SSs synthesis pathway in the BcbHLH1-overexpressing Bupleurum chinense leaves in Example 6 of the present invention.

[0041] Figure 12 This is the qRT-PCR expression verification of the differential genes in the SSs synthesis pathway in the BcbHLH1-overexpressing Bupleurum chinense leaves in Example 6 of the present invention.

[0042] Figure 13 This is the analysis result of the SSs content in the BcbHLH1-overexpressing Bupleurum chinense leaves and the empty vector control group in Example 6 of the present invention. Detailed implementation manners

[0043] The following further describes the present invention with reference to the accompanying drawings and specific embodiments for better understanding of the present invention. For those not specified in the embodiments, the techniques or conditions are carried out according to those described in the literature in the field or according to the product instructions. For the reagents or instruments not specified for the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0044] For the molecular biology experimental methods not specifically described in the following embodiments, they are all carried out according to the specific methods listed in "Molecular Cloning: A Laboratory Manual" (Third Edition) by J. Sambrook, or according to the kits and product instructions.

[0045] The Bupleurum chinense materials used in the following embodiments are from the Longshan Farm of Southwest University of Science and Technology, and the public can obtain them from the Laboratory of Biomedical Innovation and Utilization of Southwest University of Science and Technology.

[0046] Example 1

[0047] In this example, the BcbHLH1 gene of Bupleurum chinense was mined as follows:

[0048] The experimental material was the Bupleurum chinense variety Chuanbeichai 1 (CBC1), which was cultured in a greenhouse at 25±1°C at Southwest University of Science and Technology in Mianyang, Sichuan Province, China, with 14 hours of daily light and conventional fertilizer and water management. Two-month-old Bupleurum chinense seedlings of the same size were selected and externally applied with methyl jasmonate (MeJA) and abscisic acid (ABA) to analyze whether the expression pattern of BcbHLH1 was consistent with the accumulation trend of saikosaponins (SSs) under stress conditions.

[0049] Online software primer 3plus (https: / / www.primer3plus.com / ) was used to design qRT-PCR primers according to the CDS region sequence of the BcbHLH1 gene, as shown in Table 1.

[0050] Table 1 qRT-PCR primer sequences

[0051]

[0052] In the greenhouse, the Bupleurum chinense seedlings were thoroughly irrigated with aqueous solutions of 100 μM MeJA and 100 μM GA, respectively. The treatment time gradient was 0, 0.5, 2, 4, 8 h. After the treatment was completed, the roots of the Bupleurum chinense were immediately rinsed with water, frozen with liquid nitrogen, and stored in a -80°C refrigerator for subsequent RNA extraction and qRT-PCR gene expression analysis.

[0053] RNA extraction and qRT-PCR gene expression analysis: First, a polysaccharide polyphenol total RNA extraction kit (TIANGEN) was used to extract RNA from the above samples according to the instructions, and it was reverse transcribed using the EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransStart) kit to obtain cDNA, which was used as the qRT-PCR template. The Green qPCR SuperMix kit (TransStart) was used for qRT-PCR gene expression analysis. The reaction system was: Green qPCR SuperMix 5 μl, template cDNA 1 μl, upstream and downstream primers 0.4 μl each, ddH2O 3.6 μl. The reaction program was: pre-denaturation at 94°C for 30 s; denaturation at 94°C for 5 s, annealing at 55°C for 15 s, extension at 72°C for 10 s, for a total of 40 cycles. Each sample was subjected to 3 technical replicates. The 2-ΔΔCt method was used to analyze the data using the Cq value, calculate the relative gene expression, and the GraphPad 8.0 prism was used for one-way analysis of variance (One-way ANOVA) to analyze the significance and plot the graph. -ΔΔCt method to analyze the data, calculate the relative gene expression, and use GraphPad 8.0 prism for one-way analysis of variance (One-way ANOVA) to analyze the significance and plot the graph.

[0054] After treating the Bupleurum seedlings in the same way for 72 h, they were washed and placed in a -80 °C refrigerator for the determination of SSs content. The method is as follows:

[0055] (1) Preparation of sample solution: Accurately weigh 100 mg of freeze-dried Bupleurum root samples, add 1.5 ml of 80% methanol solution containing 0.1% formic acid as the extraction solution, ultrasonicate at 60 °C for 15 min; centrifuge at 4 °C and 12000 rpm for 5 min, and aspirate the supernatant into a clean evaporating dish; add 1.5 ml of the extraction solution to the centrifuge tube again, repeat the above extraction steps, combine the obtained extraction solutions after extracting three times, evaporate to dryness in a water bath at 60 °C, redissolve with 2 ml of methanol, filter the solution with a 0.22 μM organic filter membrane, and store it in a sample bottle.

[0056] (2) Preparation of standard solution: Use a methanol solution to prepare a stock solution of saikosaponin standard reference substance with a mass concentration of 2.0 mg / mL. Take appropriate amounts of each standard stock solution respectively to prepare standard working curves with concentrations of 0.1 μg / ml, 0.5 μg / ml, 1 μg / ml, 3 μg / ml, 5 μg / ml, 7 μg / ml, and 10 μg / ml for each saikosaponin.

[0057] (3) Chromatographic conditions: Kinetex 2.6 μm C18 chromatographic column (4.6 mm × 150 mm, 2.6 μm); column temperature: 30 °C, injection volume: 0.5 μL; mobile phase: 0.01% formic acid water (A) - acetonitrile (B); gradient elution mode is shown in Table 2.

[0058] (4) Mass spectrometry conditions: Use a 6600 TOF MS mass spectrometer; electrospray ionization source (ESI); MRM mode; positive ion scan; Curtain Gas (gas curtain gas): N2, 60 psi, Collision Gas (collision gas): N2, 60 psi, IonSprayVoltage (ion spray voltage): 5500 V, Temperature (temperature): 500 °C, Ion Source Gas 1 (ion source gas): N2, Ion Source Gas 2 (ion source gas): N2, scanning range m / z: 100 - 1200.

[0059] Table 2 Gradient elution conditions

[0060]

[0061] Taking the root samples of Bupleurum seedlings at the seedling stage without treatment, that is, the samples at 0 h of the same treatment as the CK, the results are as follows Figures 1 to 4As shown in the figure, after exogenous MeJA treatment of Bupleurum chinense seedlings at the seedling stage, it can promote the increase in the total content of saikosaponins in the roots of Bupleurum chinense. Among them, the relative contents of SSa, SSd, and SSe are significantly different from those of the control group (P<0.05). GA treatment of Bupleurum chinense seedlings at the seedling stage can extremely significantly increase the contents of SSa, SSb2, SSd, and SSe in the roots of Bupleurum chinense (P<0.01). Both hormones can extremely significantly up-regulate the expression level of BcbHLH1 (P<0.001). This indicates that the expression pattern of BcbHLH1 under stress is consistent with the accumulation trend of SSs, and it may adapt to environmental stress by regulating the synthesis of saikosaponins.

[0062] Example 2

[0063] This example provides a method for obtaining the BcbHLH1 gene of Bupleurum chinense, which is as follows:

[0064] Total RNA was extracted from the roots of CBC1 and reverse transcribed into cDNA, which was used as a PCR template. The method was the same as in Example 1. According to the DNA sequence of BcbHLH1 in the Bupleurum chinense genome, full-length primers for the target transcription factor were designed. The design method was the same as in Example 1, and adapter primers were added to the 5' ends of the upstream and downstream primers of the target gene according to the requirements of the seamless cloning kit. The primer information is shown in Table 3. Using the primers in Table 3, a fragment containing 1466 bp of nucleotide sequence was amplified by PCR (the electrophoresis results are as Figure 5 shown). The PCR amplification reaction system was: Primer STAR Max Primer 25 μl, template cDNA 2 μl, 0.5 μl each of upstream and downstream primers, and 22 μl of ddH2O. The amplification program was: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 5 s, for a total of 34 cycles; extension at 72°C for 5 min.

[0065] After the PCR amplification product was recovered and purified, it was ligated to the pNC-Cam1304-SubN vector, and transformed into Escherichia coli T1 competent cells for sequencing. Sequencing showed that the obtained fragment matched the BcbHLH1 gene in the genome of Bupleurum chinense var. chinense. This fragment has the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing (Table 4). The amino acid sequence encoded by the BcbHLH1 gene is shown in SEQ ID NO: 2 (Table 4).

[0066] Table 3 Primer sequences

[0067]

[0068] Table 4 Sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2

[0069]

[0070]

[0071] Example 3

[0072] This example provides the tissue-specific expression of the BcbHLH1 gene of Bupleurum chinense, which is as follows:

[0073] Total RNA was extracted from the root, stem, and leaf tissues of four genotypes of Bupleurum chinense, CBC1, CBC3, FS, and CC2. After reverse transcription into cDNA, it was used as a template, and the expression of the BcbHLH1 gene in different genotypes of Bupleurum chinense and different tissues was analyzed by qRT-PCR using the specific primers shown in Table 1. The method was the same as in Example 1, and the results are as Figure 6 shown. The relative expression level of BcbHLH1 was the highest in the roots of the CC2 genotype, followed by FS and CBC1, and the lowest in the roots of the CBC3 genotype. In the stems, the expression levels from high to low were FS, CBC3, CC2, and CBC1; in the leaves, the relative expression levels from high to low were FS, CBC1, CC2, and CBC3. Generally speaking, there were significant differences in the expression levels of BcbHLH1 in the roots (Root), stems (Stem), and leaves (Leaf) of different genotypes, but it was highly specifically expressed in the roots of each genotype. This reflects the differences in the growth, development, and metabolic regulation of Bupleurum chinense of different genotypes, suggesting that BcbHLH1 may be an important factor regulating the synthesis of SSs in the roots.

[0074] Example 4

[0075] This example provides the subcellular localization of the BcbHLH1 gene of Bupleurum chinense, which is as follows:

[0076] The successfully sequenced Escherichia coli bacterial solution in Example 2 was amplified and shaken in a liquid LB medium containing 50 μg / ml kanamycin resistance at 200 rpm and 37 °C overnight, and the plasmid was extracted. The obtained recombinant plasmid BcbHLH1-pNC-Cam1304-SubN was transformed into the Agrobacterium tumefaciens competent GV3101 (psoup). The positive single colony was added to 30 ml of a liquid LB medium containing 50 μg / ml kanamycin and rifampicin, and cultured at 200 rpm and 28 °C until OD 600 = 0.6, and the color of the bacterial solution was like orange juice. The bacterial solution was centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in 10 ml of an MES solution containing 0.2 mM acetosyringone and 10 mM MgCl2. This step was repeated three times to resuspend the bacterial solution, and the obtained resuspended solution was the infiltration solution. The OD of the resuspended solution 600When adjusted to 0.2, it meets the requirements for infecting tobacco, and it is left standing at room temperature in the dark for 3 h. The infection solutions containing BcbHLH1-pNC-Cam1304-SubN and pNC-Cam1304-SubN (empty vector) respectively are injected into the back of tobacco leaves at 5 - 6 weeks old using a sterile syringe. The infected tobacco is treated in the dark at 25 °C for 12 h, and then cultured in a cycle of 12 h of light / 12 h of darkness. After 3 days, the infected tobacco leaves are harvested for observation under a confocal microscope.

[0077] The experimental results are as Figure 7 shown, and green fluorescence exists in the cell membrane and nucleus, indicating that the BcbHLH1 gene belongs to nuclear localization and membrane localization.

[0078] Example 5

[0079] This example provides the transcriptional self-activation verification of the Bupleurum chinense DC. BcbHLH1 gene, specifically as follows:

[0080] The restriction enzyme cleavage sites of the CDS sequence of BcbHLH1 and the vector pGBKT7 (BD) are analyzed. The restriction enzyme cleavage sites NdeI and SalI are selected at the multiple cloning site of the BD vector, and the upstream and downstream primers of the BcbHLH1 gene are designed with homologous arms added at the 5' end. The design method is the same as that in Example 1, and the primers are shown in Table 5.

[0081] Table 5 Transcriptional self-activation primer sequences

[0082]

[0083] Note: The underlined part is the homologous arm sequence.

[0084] Using the recombinant plasmid BcbHLH1-pNC-Cam1304-SubN as a template, the target fragment is cloned. The vector BD is double digested with the enzymes NdeI and SalI, and the recovered linearized vector fragment and the target fragment are ligated to construct the BcbHLH1-BD expression vector. After identification by colony PCR and sequencing of positive clones, if the results are correctly aligned, it indicates that the vector construction is completed.

[0085] Using the yeast one-hybrid technique, the yeast AH109 transformed with the recombinant plasmid BcbHLH1-BD and the empty plasmid BD is spread on the SD / -Trp solid medium and cultured at 30 °C for 2 - 3 days. After the yeast grows colonies, single colonies are selected and diluted 10 times, 100 times, and 1000 times in 1 ml of sterile water respectively. 10 μl of the diluted bacterial solutions are respectively pipetted and spotted on the SD / -Trp+X-α-gal, SD / -Trp / -His+X-α-gal, and SD / -Trp / -Ade+X-α-gal media, and cultured upside down in a 30 °C constant temperature incubator for 3 days. Observe the growth status of the yeast and take pictures for record.

[0086] The results are as Figure 8 shown. Yeasts containing the negative control BD and the BcbHLH1-BD plasmid can both survive on the SD / -Trp+X-α-gal solid medium, but the yeast colonies containing the BD plasmid are white; and the yeasts containing the BcbHLH1-BD recombinant plasmid can survive on both the SD / -His+X-α-gal and SD / -Ade+X-α-gal media, and the colonies are blue. The above results indicate that BcbHLH1 has transcriptional self-activation activity and can activate the expression of the reporter genes Trp, His, and MEL1 (yeast galactosidase) in yeast AH109.

[0087] Example 6

[0088] This example provides the regulation analysis of the overexpression of the BcbHLH1 gene on saikosaponin biosynthesis, which is as follows:

[0089] 6.1 Obtaining and identification of overexpressed BcbHLH1 transgenic leaves

[0090] Using BcbHLH-pNC-Cam1304-SubN as the template and pEAQ-HT-DEST1 as the vector, with the restriction enzyme sites of SalI and XhoI, the BcbHLH1-OE overexpression recombinant plasmid was constructed. The method was the same as in Example 5, and the primers are shown in Table 6.

[0091] Table 6 Primer sequences of the overexpression vector

[0092]

[0093] Note: The underlined part is the homologous arm sequence.

[0094] The BcbHLH1-OE recombinant plasmid and the empty vector (EV) expression vector were respectively transformed into the competent Agrobacterium tumefaciens GV3101. The method was the same as in Example 4, and the positive monoclonal strains were verified by colony PCR and sequencing.

[0095] The verified Agrobacterium liquid was prepared into an infection solution according to the method in Example 4. Before use, the OD 600 of the infection solution was adjusted to 0.2, and it was left standing in the dark at room temperature for 3 h.

[0096] The test material was Bupleurum chinense CBC1, and the planting method was the same as that in Example 1. Bupleurum leaves about 1.5 cm × 10 cm in size were selected, and the prepared infection solutions containing BcbHLH1-OE and empty vector EV were respectively injected into the lower epidermis of Bupleurum using a syringe, so that the bacterial solution covered the whole leaf. Every 20 leaves were taken as a group, and the experiment was repeated 3 times. The treated Bupleurum plants were continuously cultured in the greenhouse under the same conditions as the tobacco plants used for subcellular localization in Example 4, and the Bupleurum leaves were harvested on the 2nd, 3rd, and 4th days after treatment. The RNA of CBC1 and wild-type WT Bupleurum leaves transformed with BcbHLH1-OE and EV for 2 days, 3 days, and 4 days was respectively extracted and reverse-transcribed into cDNA using the same method as in Example 1. Using the cDNA as a template, the kanamycin gene (the only resistance screening marker gene of the pEAQ-HT-DEST1 vector) was verified by PCR amplification. The primer sequences were (F: GCCGGTATAAAGGGACCACC; R: TGTCATACCACTTGTCCGCC), and the method was the same as in Example 2.

[0097] The PCR results were as Figure 9 shown. In the Bupleurum leaf samples transformed with BcbHLH1-OE and empty vector EV, a 580-bp kanamycin resistance gene fragment was successfully cloned, while this fragment was not detected in the untransformed WT Bupleurum leaf samples. This result indicates that the agrobacterium-mediated transient transformation method can effectively overexpress the desired target gene in Bupleurum leaves.

[0098] 6.2 Real-time fluorescence quantitative verification of the target gene in the transgenic leaves overexpressing BcbHLH1

[0099] Using the cDNA obtained in 6.1 as a template, the expression level of the target gene in the transgenic Bupleurum leaves was detected by qRT-PCR. The method and primers were the same as in Example 1.

[0100] As Figure 10As shown in the figure, within the 2nd, 3rd, and 4th days of the Agrobacterium-mediated transient transformation treatment, the expression level of BcbHLH1 in the overexpressing Bupleurum leaves was significantly higher than that in the wild-type and the leaves transformed with only the empty vector. Especially on the 3rd day, the expression level of BcbHLH1 in the overexpressing leaves reached its peak, which was 38.55 times that of the wild-type leaves and 6.09 times that of the leaves transformed with the empty vector. In addition, there were also significant differences in the expression level of BcbHLH1 between the empty vector-transformed Bupleurum leaves and the wild-type leaves. It is speculated that this may be due to the mechanical damage caused by the Agrobacterium-mediated transient transformation treatment to the Bupleurum leaves, triggering the protective and repair responses of the leaves. Given that BcbHLHs have extensive regulatory roles in Bupleurum, including responses to various stresses, therefore, the expression level of BcbHLH1 showed a specific upward trend, but its expression level was still significantly lower than that in the leaves overexpressing BcbHLH1.

[0101] 6.3 Transcriptome analysis of transgenic leaves overexpressing BcbHLH1

[0102] Extract RNA (TIANGEN) from the transgenic Bupleurum leaves overexpressing BcbHLH1 in 6.1, and send the samples to NovoGene Bioinformatics Technology Co., Ltd. (Beijing) for RNA sequencing. Through transcriptome sequencing, gene modules with strong correlations with saikosaponins were screened, and enzyme gene families related to the MVA and MEP pathways were selected, including ACAT (acetyl-CoA acetyltransferase), HMGS (hydroxymethylglutaryl-CoA synthase), HMGR (3-hydroxy-3-methylglutaryl-CoA reductase), MK (mevalonate kinase), PMK (phosphomevalonate kinase), MVD (mevalonate pyrophosphate decarboxylase), DXS (1-deoxy-d-xylulose-5-phosphate synthase), DXR (1-deoxy-d-xylulose-5-phosphate reductoisomerase), CMS (2-c-methyl-d-erythritol 2,4-cyclodiphosphate synthase), CMK (4-diphosphocytidyl-2-c-methyl-d-erythritol kinase), HDS (4-hydroxy-3-methyl-2-en-1-yl diphosphate synthase), MCS (2-c-methyl-d-erythritol 2,4-cyclodiphosphate synthase), GGPS (geranylgeranyl diphosphate synthase), FPS (farnesyl diphosphate synthase), IDS (4-hydroxy-3-methyl-2-enyl diphosphate reductase), IDI (isopentenyl diphosphate isomerase), SS (squalene synthase), squalene epoxidase, as well as β-AS (β-amyrin synthase) that catalyzes the formation of the saikosaponin skeleton, and CYP (cytochrome P450) and UGT (UDP-glycosyltransferase) genes that modify the triterpenoid saponin skeleton. And the expression of these genes in the transgenic leaves overexpressing BcbHLH1 was investigated respectively.

[0103] AsFigure 11 As shown in the figure, 24 genes in the SSs synthesis pathway showed differential expression patterns in the BcbHLH1-overexpressing Bupleurum leaves. Among them, the expression levels of 15 genes were significantly up-regulated, including the key rate-limiting enzymes in the triterpenoid saponin synthesis pathway, such as BcHMGR14457, BcDXS35791, BcDXS35790, BcBAS10820, BcBAS32099, etc. This result indicates that overexpression of BcbHLH1 in leaves can significantly promote the expression of key enzyme genes in the Bupleurum saponin synthesis pathway.

[0104] 6.4 Expression analysis of key enzyme genes for Bupleurum saponin synthesis in BcbHLH1-overexpressing transgenic leaves

[0105] Using the cDNA obtained in 6.1 as a template, the expression levels of 8 differentially expressed genes obtained by transcriptome sequencing of transgenic Bupleurum leaves were randomly selected for detection to verify the accuracy of the transcriptome data and to re-verify the effect of BcbHLH1 on the expression of key genes in the Bupleurum saponin synthesis pathway. The qRT-PCR method was the same as in Example 1, and the primers are shown in Table 7.

[0106] Table 7 Real-time fluorescence quantitative primers

[0107]

[0108]

[0109] The results of real-time fluorescence quantification are as Figure 12 shown. The qRT-PCR results were highly consistent with the transcriptome data in terms of the expression trend, indicating that the qRT-PCR results supported the results of the transcriptome data of BcbHLH1-overexpressing leaves.

[0110] 6.5 Analysis of Bupleurum saponin content in BcbHLH1-overexpressing transgenic leaves

[0111] The method for detecting Bupleurum saponin content was the same as in Example 1, and the samples were BcbHLH1-overexpressing transgenic Bupleurum leaves in 6.1.

[0112] The results are as Figure 13As shown, the contents of SSa, SSb2, SSb4, SSc, and SSd in the leaves of BcbHLH1-overexpressing Bupleurum chinense were extremely significantly increased compared with the empty vector control group (P < 0.01), reaching 145.32, 42.56, 15.27, 23.50, 50.52, and 27.15 μg / g respectively, which were 2.16, 2.19, 2.07, 1.87, and 1.69 times that of the empty vector control group. The content of SSf was significantly down-regulated by 41% compared with the empty vector control group (P < 0.001), while the content of SSk showed no significant change. Generally speaking, the total content of the seven detectable saponins in the leaves of BcbHLH1-overexpressing Bupleurum chinense was 1.67 times that of the control group. Combining the results of Example 6, it can be shown that overexpressing BcbHLH1 in the leaves can significantly promote the expression of key enzyme genes in the Bupleurum saponin synthesis pathway, thereby significantly increasing the content of SSs in the leaves.

[0113] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A Bupleurum bHLH transcription factor BcbHLH1 gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the BcbHLH1 gene according to claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID NO:

2.

3. An expression vector containing the BcbHLH1 gene of Bupleurum chinense bHLH transcription factor described in claim 1.

4. A recombinant host cell containing the BcbHLH1 gene described in claim 1 or the expression vector described in claim 3.

5. Use of the BcbHLH1 gene described in claim 1, or the protein described in claim 2, or the expression vector described in claim 3, or the recombinant host cell described in claim 4 in promoting the synthesis of saikosaponins in Bupleurum chinense leaves.

6. The application according to claim 5, characterized in that The BcbHLH1 gene described in claim 1, or the protein described in claim 2, or the expression vector described in claim 3, or the recombinant host cell described in claim 4 promotes the synthesis of saikosaponins in Bupleurum chinense leaves through transient transformation of Bupleurum chinense leaves.

7. A transient transformation reagent for Bupleurum leaves, characterized in that, It includes an infection solution, and the infection solution contains the BcbHLH1 gene described in claim 1, or the expression vector described in claim 3, or the recombinant host cell described in claim 4.

8. The construction method of the transient transformation reagent for Bupleurum leaves according to claim 7, characterized in that, It includes the following steps: Step 1, extract total RNA from Bupleurum chinense and reverse transcribe it into cDNA as a PCR template. Obtain an amplification product by PCR method. After purifying the amplification product, ligate it to the pNC-Cam1304-SubN vector to obtain the recombinant plasmid BcbHLH1-pNC-Cam1304-Sub; Step 2, using the recombinant plasmid BcbHLH1-pNC-Cam1304-Sub as a template, pEAQ-HT-DEST1 as a vector, and the restriction enzyme sites being SalI and XhoI, construct the BcbHLH1-OE overexpression recombinant plasmid; Step 3, transform the BcbHLH1-OE overexpression recombinant plasmid into Agrobacterium tumefaciens competent cells to obtain positive monoclonal strains; Step 4, add the bacterial solution of the positive monoclonal strain to a liquid LB medium containing kanamycin and rifampicin for culture. After the culture is completed, centrifuge to discard the supernatant, and resuspend the cells with an MES solution containing acetosyringone and MgCl2 to obtain an infection solution, which is the transient transformation reagent; In the said Step 1, the primer sequences used in the PCR method are shown in SEQ ID NO: 5 and SEQ ID NO: 6; In the said liquid LB medium, the final concentrations of kanamycin and rifampicin are 50 μg / mL respectively; In the said MES solution, the final concentrations of acetosyringone and MgCl2 are 0.2 mM and 10 mM respectively.

9. Use of the transient transformation reagent described in claim 7 in transiently transforming Bupleurum chinense leaves to synthesize saikosaponins.

10. A method for synthesizing saikosaponin by transient transformation of Bupleurum leaves, characterized in that, It includes: Inject the transient transfection reagent obtained by the construction method described in claim 8 into the lower epidermis of Bupleurum chinense, and then culture the injected Bupleurum chinense plants; the method for culturing the injected Bupleurum chinense plants is: at 25 °C, place the injected Bupleurum chinense plants in the dark for 12 hours, and then culture them in a cycle of 12 hours of light culture and 12 hours of dark culture for 2 - 4 days.

Images