A hypoxanthine producing strain and its construction method and application

Abstract

The present invention provides a hypoxanthine production strain and a construction method and application thereof, wherein the strain overexpresses <h2 style=";text-align:left;direction:ltr">glnA The gene encoding glutamine synthetase and <h2 style=";text-align:left;direction:ltr"> aspC Gene encoding aspartate aminotransferase, <h2 style=";text-align:left;direction:ltr"> thrA The natural promoter of the gene was replaced by P BBa_J23109 ; then <h2 style=";text-align:left;direction:ltr"> pgi The natural promoter of the gene was replaced by P BBa_J23105 , knocking out the gene encoding 6-phosphogluconate dehydratase <h2 style=";text-align:left;direction:ltr"> edd ; Finally, the output system of hypoxanthine was strengthened and the <h2 style=";text-align:left;direction:ltr"> nepI Finally, a high-yield hypoxanthine engineering strain with a clear genetic background and stable fermentation process was obtained, which could achieve a hypoxanthine yield of 32.8 g / L in a 5L fermenter within 48 hours.

Description

Technical Field

[0001] The invention relates to the field of compound biotechnology production, in particular to a hypoxanthine production strain and a construction method and application thereof. Background Art

[0002] The scientific name of hypoxanthine is Hypoxanthine. Its common molecular formula is C5H4N4O, and its molecular weight is 136.11. It is a compound composed of C 44.12%, H 2.96%, N 41.16%, and O 11.75%.

[0003] Hypoxanthine is a very important biological purine base, which is widely distributed in the human body. It can participate in regulating some important physiological functions in the human body, has pharmacological activities such as lowering blood pressure, relieving asthma, and treating gout. It can also be used to treat diseases such as leukopenia and thrombocytopenia caused by various reasons, and is widely used in medical treatment. The 6-hydroxyl activity of hypoxanthine is very high, and its derivatives (such as 6-mercaptopurine) are used as anticancer drugs and plant growth regulators. In addition, purine compounds can be used as inducers of interferon release, ligands of adrenocorticotropic hormone receptors, and antagonists of adenosine receptor agonists. It can also be used to treat diseases such as leukopenia and thrombocytopenia caused by various reasons; at the same time, hypoxanthine is also an important intermediate for the synthesis of anti-malignant tumor drugs 6-mercaptopurine and thiopurine.

[0004] In recent years, the demand for hypoxanthine at home and abroad has reached 500-1000 tons / year, and is accompanied by a trend of continuous growth, while the current domestic production capacity is less than half of the demand. At present, hypoxanthine is mainly obtained by inosine hydrolysis, which has a high production cost and a market price of about 130,000 yuan per ton. The microbial fermentation method is low-cost, so the development of a high-yield hypoxanthine production strain has very important application value. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a hypoxanthine producing strain.

[0006] Another technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned hypoxanthine-producing strain.

[0007] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned hypoxanthine producing strain.

[0008] In order to solve the above technical problems, the technical solution of the present invention is:

[0009] A hypoxanthine production strain, which is a strain E. coli- Hxz18 is an artificially modified gene with a specific genotype. E. coliW3110 (Escherichia coli W3110): Starting strain E.coli- Hxz12 was upregulated in the genome of the strain E. coli- Hxz12 glnA and aspC The transcription level of the gene was downregulated in the strain E. coli- Hxz12 thrA and pgi The transcription level of the gene is missing edd Gene, introduced Escherichia coli K-12 MG1655 (Escherichia coli K-12 MG1655, purchased from Jiangsu Tianjingsha Gene Diagnostic Technology Co., Ltd.) nepI Gene (transporter).

[0010] The above starting strains E. coli- The patent number of Hxz12 is CN202311064459.3 (a genetically engineered bacterium producing hypoxanthine and its construction method and application) strain in the embodiment E.coli- Hxz12.

[0011] Preferably, the above hypoxanthine producing strain is yeel The glnA gene was integrated into the yeep locus and regulated by the trc promoter; the aspC gene was integrated into the yeep locus and regulated by the lac promoter; the natural promoter of the thrA gene was replaced by P BBa_J23109 ; Replace the natural promoter of the pgi gene with P BBa_J23105 ;Integrate the nepI gene at the ilvg site and regulate it with the trc promoter.

[0012] Preferably, in the above hypoxanthine producing strain, the nucleotide sequence of the lac promoter is shown in the sequence listing SEQ ID NO.1, the nucleotide sequence of the trc promoter is shown in the sequence listing SEQ ID NO.2, and the P BBa_J23109 The nucleotide sequence of the promoter is shown in the sequence table SEQ ID NO.3. BBa_J23105 The nucleotide sequence of the promoter is shown in the sequence table SEQ ID NO.4. glnA The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.5. aspC The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.6. thrA The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.7. pgi The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.8. edd The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.9,nepI The nucleotide sequence of the gene is shown in the sequence listing SEQ ID NO.10.

[0013] The method for constructing the genetically engineered bacteria for producing hypoxanthine is as follows: E. coli- Hxz12 was used as the starting strain and gene editing was performed using metabolic engineering. The specific steps are as follows:

[0014] (1) Strengthening the supply of precursors: E.coli- Hxz12 was the starting strain. glnA Gene integration into the genome yeel pseudogene site and use the trc promoter to enhance expression; aspC Gene overexpression to genome eep pseudogene site and use the lac promoter to enhance expression; thrA The natural promoter of the gene was replaced by P BBa_J23109 ;

[0015] (2) Weakening the branch pathway of the pentose phosphate pathway: knocking out the gene in the genome edd Gene, will pgi The natural promoter of the gene was replaced by P BBa_J23105 ;

[0016] (3) Modification of hypoxanthine export system: Escherichia coli K-12 MG1655 source nepI Gene integration into the genome ilvg The trc promoter is used to enhance expression.

[0017] The application of the above hypoxanthine producing strain in the fermentation production of hypoxanthine.

[0018] Preferably, the application of the above hypoxanthine production strain uses a mechanically stirred fermenter to ferment and produce hypoxanthine, and the specific steps are as follows:

[0019] (1) Seed activation: Spread the bacteria evenly on the activated slant, culture at 37°C for 13 h, and transfer to a new slant to continue culture for 11 h;

[0020] (2) Seed culture: Inoculate the bacterial suspension into the seed culture medium, pH 6.8, constant temperature at 35°C, dissolved oxygen at 40%-60%, and culture for 14 hours;

[0021] (3) Fermentation culture: Wait for the seed bacteria volume OD 600When the temperature reaches 20-25, the fermentation medium is inoculated with 20% of the inoculum to start fermentation. During the fermentation process, the pH value is controlled at 7.0, the temperature is 37°C, and the dissolved oxygen is 40%-60%. When the glucose in the medium is consumed, 80% of the glucose solution is added to maintain the glucose concentration in the fermentation medium below 1 g / L.

[0022] Preferably, in the application of the above-mentioned hypoxanthine-producing strain, the slant culture medium used in the seed activation is: 4 g / L glucose, 4 g / L peptone, 8 g / L yeast extract powder, 3 g / L sodium chloride, 4 g / L potassium dihydrogen phosphate, 2 g / L anhydrous magnesium sulfate, 20% agar powder (volume percentage), and the rest water, pH 7.0.

[0023] Preferably, in the application of the above hypoxanthine producing strain, the seed culture medium used in the seed culture is: 25 g / L glucose, 6 g / L yeast extract powder, 3 g / L peptone, 5 g / L ammonium sulfate, 3 g / L potassium dihydrogen phosphate, 0.5 g / L anhydrous magnesium sulfate, 40 mg / L ferrous sulfate heptahydrate, 20 mg / L manganese sulfate monohydrate, V H 0.5 mg / L, V B1 1 mg / L, guanine 0.5 g / L, and the rest water; sterilize in a high pressure steam cooker at 115°C for 25 min.

[0024] Preferably, in the application of the above hypoxanthine production strain, the fermentation medium used in the fermentation culture is: 30 g / L glucose, 6 g / L yeast extract powder, 4 g / L peptone, 3 g / L ammonium sulfate, 3 g / L potassium dihydrogen phosphate, 2 g / L anhydrous magnesium sulfate, 40 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, V H 1mg / L,V B1 2 mg / L, guanine 1 g / L, and the rest water; sterilize in a high pressure steam cooker at 115℃ for 25 min.

[0025] The above culture media can be prepared using standard methods.

[0026] Beneficial effects:

[0027] The above hypoxanthine producing strain, in the strain E.coli-Hxz12 On the basis of the continuous strain transformation, the obtained strains strengthened E.coli-Hxz12 The precursor supply module of the glutamine synthetase was strengthened to increase the supply of the precursor glutamine; the supply of the precursor aspartate was increased by strengthening the expression of aspartate aminotransferase and weakening the key enzyme aspartate kinase in the aspartate branch pathway; the branch pathway of the pentose phosphate pathway was weakened, the glucose phosphoisomerase was weakened, and the gene encoding 6-phosphogluconate dehydratase was knocked out.edd genes, which direct more metabolic flux into the pentose phosphate pathway; by introducing Escherichia coli The hypoxanthine efflux protein gene from K-12 MG1655 enables hypoxanthine to be exported to the extracellular space more smoothly, making the strain have efficient hypoxanthine export ability. E. coli- Hxz18 It has a clear genetic background, a stable fermentation process, can produce high levels of hypoxanthine, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Hypoxanthine producing strain E. coli-Hxz18 Illustration of the construction method.

[0029] Figure 2 Hypoxanthine producing strain E. coli-Hxz18 Fermentation process diagram. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0031] The percentage sign "%" involved in the embodiments, unless otherwise specified, refers to mass percentage. The percentage of a solution refers to the number of grams of a solute contained in 100 mL. The percentage between liquids refers to the volume ratio of the solution at 25°C.

[0032] The corresponding promoters and genes in the examples are shown in the sequence table. The primers used in the construction of the strains involved are shown in Table 1.

[0033] Table 1 Primers involved in strain construction

[0034] Primer Sequence number Sequence pGRB--s SEQ ID NO.11 AGTCCTAGGTATAATACTAGTAACACAGCAATACGGTACGCGTTTTAGAGCTAGAA pGRB--a SEQ ID NO.12 TTCTAGCTCTAAAACGCGTACCGTATTGCTGTGTTACTAGTATTATACCTAGGACT - SEQ ID NO.13 TTCATCGGGACGAGTGGAGA -trc-2 SEQ ID NO.14 GAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACCATAGCATCGCCAATCTGA -s SEQ ID NO.15 GGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGCAAAGTACACTAGAGAAGA -a SEQ ID NO.16 GACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTAATACTGAGACATATACTGTTCGCGTTCCCA - SEQ ID NO.17 GAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATACCCAAAGGTGAAGATAAAGCC - SEQ ID NO.18 CATTCCCTCTACAGAACTAGCCCT pGRB--s SEQ ID NO.19 AGTCCTAGGTATAATACTAGTAAAACGGAGCCCTGCCATGTTTTAGAGCTAGAA pGRB--a SEQ ID NO.20 TTCTAGCTCTAAAACATGGCAGGGCTCCGTTTTACTATTTATACCTAGGACT - SEQ ID NO.21 GGTCAGGAGGTAACTTATCAGCG -lac-2 SEQ ID NO.22 GTATCCGCTCAATTCCACAACATACGAGCCGGAAGCATAAAGTGTAAATAGTGAGTCGTATTAATGGC -s SEQ ID NO.23 GTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGTTTGAGAACATTACCGCCG -a SEQ ID NO.24 CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACAGCACTGCCACAATCGC - SEQ ID NO.25 GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGAACTGGATTTTCTTCTGAACCTGTCG - SEQ ID NO.26 ACGATGTCAGCAGCCAGCA pGRB--s SEQ ID NO.27 AGTCCTAGGTATACTAGTATCACCATTACCAGGTAAGTTTTAGAGCTAGAA pGRB--a SEQ ID NO.28 TTCTAGCTCTAAAACTTACCTGTGGTAATGGTGATACTAGTATTATACCTAGGACT SEQ ID NO.29 TGTGTGGATTAAAAAAAGAGTGTCTGATAGCAG <![CDATA[ thrA- 2(P BBa_J23109 )]]> SEQ ID NO.30 GCTAGCACAGTCCCTAGGACTGAGCTAGCTGTAAAGCCTATATTGGTTAAAGTATTTAGTGACCTAAGTCAAT SEQ ID NO.31 GCTAGCACAGTCCCTAGGACTGAGCTAGCTGTAAAGCCTATATTGGTTAAAGTATTTAGTGACCTAAGTCAAT SEQ ID NO.32 CCGTCAAAAGTTCGGCAAAAATACG pGRB--s SEQ ID NO.33 AGTCCTAGGTATACTAGTTAAATGCTTCACTGCGCTAAGTTTTAGAGCTAGAA pGRB--a SEQ ID NO.34 TTCTAGCTCTAAAACTTAGCGCAGTGAAGCATTTAACTAGTATTATACCTAGGACT SEQ ID NO.35 AGGGTGAGCGGGGCGGTT <![CDATA[ pgi- 2(P BBa_J23105 )]]> SEQ ID NO.36 TGCTAGCATAGTACCTAGGACTGAGCTAGCCGTAAAGGAAGATTGTAGCGCCAGTC SEQ ID NO.37 CAGTCCTAGGTACTATGCTAGCAGGAAACAGACCATGAAAAACATCAATCCAAC SEQ ID NO.38 GATCGTCGAAGGTTGCGGAGAACTTAG pGRB--s SEQ ID NO.39 AGTCCTAGGTATAATACTAGTTACTGCCAACACCAACCAGAGTTTTAGAGCTAGAA pGRB--a SEQ ID NO.40 TTCTAGCTCTAAAACGGGAATATCCAGCGCCTGACACTAGTATTATACCTAGGACT SEQ ID NO.41 TTACCGGTAACATGATCTTGCGC SEQ ID NO.42 CACCGGTCCAATAATACACCAAGCGCAACATGCTTTTCAAAGAGGC SEQ ID NO.43 GCCTCTTTGAAAAGCATGTTGCGCTTGGTGTATTATTGGACCGGTG SEQ ID NO.44 TCAGTTCGGAAACAGTGCTGATC pGRB--s SEQ ID NO.45 AGTCCTAGGTATAATACTAGTTATCGGCACTGACGCATTTCGTTTTAGAGCTAGAA pGRB--a SEQ ID NO.46 TTCTAGCTCTAAAACGAAATGCGTCAGTGCCGATAACTAGTATTATACCTAGGACT - SEQ ID NO.47 ACCGAGGAGCAGACAATGAATAA SEQ ID NO.48 CCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAGGTGATGGCAACAACAGGGATGGA -s SEQ ID NO.49 ATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCGTGGATAAGACGTTCACG -a SEQ ID NO.50 CAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTCAGGATTTCTTCATTTTCACC - SEQ ID NO.51 GGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCTATCTACGCGCCGTTGTTGT - SEQ ID NO.52 CACATTCATCATGAAAGAGCCGTCAC

[0035] The gene editing method used in the following gene manipulation is referred to in the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genomeediting. Metabolic Engineering, 2015, 31: 13-21.). The professional terms involved in the present invention can be explained in the article unless otherwise noted. "Knockout" as referred to in the present invention refers to the inactivation of the target gene, and "introduction" refers to the insertion of the exogenous gene into the genome of the engineered bacteria after connecting it to the promoter and terminator.

[0036] Example 1

[0037] like Figure 1 As shown, the specific process of constructing the hypoxanthine production strain is as follows:

[0038] 1. Genes glnA Integration of yeel ::P trc - glnA Integration of

[0039] Using E. coli W3110 as template, primers yeel -1 and yeel -trc-2, yeel -3 and yeel -4; glnA -s and glnA -a PCR amplification to obtain the upper homology arm yeel -trc-UP, lower homology arm yeel -DW and intermediate destination fragments glnA , using the recovered upstream and downstream homology arms and the intermediate target fragment as templates, and using primers yeel -1 and yeel -4 Obtain the target fragment P required for integration by overlapping PCR trc - glnA , then, primer pGRB- yeel -s and pGRB- yeel The DNA fragment obtained by annealing was ligated with the plasmid pGRB (see the above reference) to construct pGRB- yeel Finally, the purified P trc - glnA Integration fragment and plasmid pGRB- yeel At the same time, electroporation E. coli -Hxz12 / pRed-Cas9 competent cells, and then yeel -1 and yeel -4 is the identification primer to screen positive transformants and finally obtain the strain E. coli -Hxz13.

[0040] 2. Integration of the gene aspC ( yeep ::P lac - aspC Integration of

[0041] Using E. coli W3110 as template, primers yeep -1 and yeep -lac-2, yeep -3 and yeep -4; aspC -s and aspC -a PCR amplification to obtain the upper homology arm yeep-lac-UP, lower homology arm yeep -DW and intermediate destination fragments aspC , using the recovered upstream and downstream homology arms and the intermediate target fragment as templates, and using primers yeep -1 and yeep -4 Obtain the target fragment P required for integration by overlapping PCR lac - aspC , then, primer pGRB- yeep -s and pGRB- yeep -a annealed DNA fragment was connected with plasmid pGRB to construct pGRB- yeep Finally, the purified P lac - aspC Integration fragment and plasmid pGRB- yeep At the same time, electroporation E. coli -Hxz13 / pRed-Cas9 competent cells, and then yeep -1 and yeep -4 is the identification primer to screen positive transformants and finally obtain the strain E. coli -Hxz14.

[0042] 3. Genes thrA Weakening (P BBa_J23109 - thrA )

[0043] pGRB- thrA -s, pGRB- thrA -a is a primer to construct pGRB- thrA Then, thrA -1, thrA -2(P BBa_J23109 )and thrA -3, thrA -4 as primers, and the genome of Escherichia coli W3110 as template to obtain the upstream homology arm thrA -up, downstream homology arm thrA -dn; then obtain the fusion fragment P BBa_J23109 - thrA Finally, pGRB- thrA Plasmid with overlapping fragment P BBa_J23109 - thrA Electrotransfer E. coli -Hxz14 in electroporated competent cells; thrA -ups, thrA -dn-a is the identification primer, screen the positive transformants and obtain the strain E. coli -Hxz15.

[0044] 4. Genes pgi Weakening (PBBa_J23105 - pgi )

[0045] pGRB- pgi -s, pGRB- pgi -a is a primer to construct pGRB- pgi Then pgi -1. pgi -2(P BBa_J23105 ), pgi -3. pgi -4 as primers, and the genome of Escherichia coli W3110 as template to obtain the upstream homology arm pgi -up, downstream homology arm pgi -dn; then obtain the fusion fragment P BBa_J23105 - pgi Finally, pGRB- pgi Plasmid with overlapping fragment P BBa_J23105 - pgi Electrotransfer E. coli -Hxz15 in electroporated competent cells; pgi -ups, pgi -dn-a is the identification primer, screen the positive transformants and obtain the strain E. coli -Hxz16.

[0046] 5. Genes edd Knockout

[0047] Using the E. coli W3110 genome as template, primers edd -1 and edd -2, edd -3 and edd -4 were PCR amplified to obtain the upstream homology arms edd -UP and downstream homology arms edd -DW, using the recovered upstream and downstream homology arms as templates, with primers edd -1 and edd -4 Overlap PCR to obtain knockout gene edd The required patch fragment Δ edd Then, primer pGRB- edd -s and pGRB- edd -a annealed DNA fragment was connected with plasmid pGRB to construct pGRB- edd Finally, pGRB- edd Plasmid with overlapping fragment Δ edd Electrotransfer E. coli -Hxz16 / pRed-Cas9 in electroporated competent cells; edd -1 and edd-4 is the identification primer, screen the positive transformants and obtain the strain E. coli -Hxz17.

[0048] 6. Genes nepI Integration of ilvg ::P trc - nepI Integration of

[0049] by Escherichia coli K-12 MG1655 genome was used as template and primers ilvg -1 and ilvg -trc-2, ilvg -3 and ilvg -4; nepI -s and nepI -a PCR amplification to obtain the upper homology arm ilvg -trc-UP, lower homology arm ilvg -DW and intermediate destination fragments nepI , using the recovered upstream and downstream homology arms and the intermediate target fragment as templates, and using primers ilvg -1 and ilvg -4 Obtain the target fragment P required for integration by overlapping PCR trc - nepI , then, primer pGRB- ilvg -s and pGRB- ilvg -a annealed DNA fragment was connected with plasmid pGRB to construct pGRB- ilvg Finally, the purified P trc - nepI Integration fragment and plasmid pGRB- ilvg At the same time, it was transformed into E. coli-Hxz17 / pRed-Cas9 competent cells by electroporation, and then ilvg -1 and ilvg -4 is the identification primer to screen positive transformants and finally obtain the strain E. coli -Hxz18.

[0050] Example 2

[0051] Using the hypoxanthine production strain described in Example 1 E. coli -Hxz18 was fermented in a 5 L mechanically stirred fermenter to produce hypoxanthine.

[0052] 1. Culture medium

[0053] 1.1 Slant culture medium

[0054] Glucose 4 g / L, peptone 4 g / L, yeast extract powder 8 g / L, sodium chloride 3 g / L, potassium dihydrogen phosphate 4 g / L, anhydrous magnesium sulfate 2 g / L, agar powder 20% (volume percentage), the rest is water, pH 7.0, dispense into test tubes (10 ml / tube), and sterilize in a high pressure steam cooker at 115℃ for 25 min.

[0055] 1.2 Seed culture medium

[0056] Glucose 25 g / L, yeast extract 6 g / L, peptone 3 g / L, ammonium sulfate 5 g / L, potassium dihydrogen phosphate 3 g / L, anhydrous magnesium sulfate 0.5 g / L, ferrous sulfate heptahydrate 40 mg / L, manganese sulfate monohydrate 20 mg / L, V H 0.5 mg / L, V B1 1 mg / L, guanine 0.5 g / L, and the rest water; sterilize in a high pressure steam cooker at 115℃ for 25 min.

[0057] 1.3 Fermentation medium

[0058] Glucose 30g / L, yeast extract 6 g / L, peptone 4 g / L, ammonium sulfate 3 g / L, potassium dihydrogen phosphate 3 g / L, anhydrous magnesium sulfate 2g / L, ferrous sulfate heptahydrate 40 mg / L, manganese sulfate monohydrate 10 mg / L, V H 1mg / L,V B1 2 mg / L, guanine 1 g / L, and the rest water; sterilize in a high pressure steam cooker at 115℃ for 25 min.

[0059] 2. Cultivation Methods

[0060] 2.1 Slant activation culture

[0061] Take the bacteria from the preservation tube, spread it evenly on the activated slant, culture it at 37℃ for 13 hours, transfer it to a new slant and continue to culture it for 11 hours;

[0062] 2.2 Seed culture

[0063] Take an appropriate amount of sterile water in a slant test tube, inoculate the bacterial suspension into the seed culture medium, stabilize the pH at about 6.8, keep the temperature constant at 35°C, and keep the dissolved oxygen at 40%-60%, and culture for 14 hours;

[0064] 2.3 Fermentation culture

[0065] Waiting for the seed cell volume OD 600To 20-25, add fresh fermentation medium according to 20% inoculation amount, start fermentation, control pH to be stable at about 7.0, temperature to be maintained at 37℃, dissolved oxygen to be between 40%-60% during fermentation; when glucose in the medium is consumed, add 80% glucose solution to maintain glucose concentration in fermentation medium below 1 g / L; fermentation cycle is 48 h.

[0066] like Figure 2 As shown, the production of hypoxanthine reached 32.8 g / L after 48 h of fermentation in a 5L fermenter.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. Improvements and modifications such as strain transformation carried out by technicians in this technical field based on the method of the present invention or on the basis of the method are deemed to be within the scope of protection of the present invention.

Claims

1. A hypoxanthine producing strain, characterized in that: In the starting strain E.coli- Hxz12 was upregulated in the genome of the strain E. coli- Hxz12 gLn and aspC The transcription level of the gene was downregulated in the strain E. coli- Hxz12 thrA and pgi The transcription level of the gene is missing edd Gene, introduced Escherichia coli K-12 MG1655 source nepI Genes obtained, specifically: yeel The glnA gene was integrated into the yeep locus and regulated by the trc promoter; the aspC gene was integrated into the yeep locus and regulated by the lac promoter; the natural promoter of the thrA gene was replaced by P BBa_J23109 ; Replace the natural promoter of the pgi gene with P BBa_J23105 ; Integrate the nepI gene at the ilvg site and regulate it with the trc promoter; wherein the nucleotide sequence of the lac promoter is shown in the sequence listing SEQ ID NO.1, the nucleotide sequence of the trc promoter is shown in the sequence listing SEQ ID NO.2, and the P BBa_J23109 The nucleotide sequence of the promoter is shown in the sequence table SEQ ID NO.

3. BBa_J23105 The nucleotide sequence of the promoter is shown in the sequence table SEQ ID NO.

4. gL The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.

5. aspC The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.

6. thrA The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.

7. pgi The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.

8. edd The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO.9, nepI The nucleotide sequence of the gene is shown in the sequence listing SEQ ID NO.

10.

2. The method for constructing a genetically engineered bacterium for producing hypoxanthine according to claim 1, characterized in that: by E. coli- Hxz12 is used as the starting strain, and the specific steps are as follows: (1) Strengthening the supply of precursors: E.coli- Hxz12 was the starting strain. gL Gene integration into the genome yeel pseudogene locus and use the trc promoter to enhance expression; Will aspC Gene overexpression to genome eep pseudogene site and use the lac promoter to enhance expression; thrA The natural promoter of the gene was replaced by P BBa_J23109 ; (2) Weakening the branch pathway of the pentose phosphate pathway: knocking out the gene in the genome edd Gene, will pgi The natural promoter of the gene was replaced by P BBa_J23105 ; (3) Modification of hypoxanthine export system: Escherichia coli K-12 MG1655 source nepI Gene integration into the genome ilvg The trc promoter is used to enhance expression.

3. Use of the hypoxanthine producing strain according to claim 1 in the fermentation production of hypoxanthine.

4. The use of the hypoxanthine producing strain according to claim 3, characterized in that: The specific steps for producing hypoxanthine using a fermentation tank are as follows: (1) Seed activation: Spread the bacteria evenly on the activated slant, culture at 37°C for 13 h, and transfer to a new slant to continue culture for 11 h; (2) Seed culture: Inoculate the bacterial suspension into the seed culture medium, pH 6.8, constant temperature at 35°C, dissolved oxygen at 40%-60%, and culture for 14 hours; (3) Fermentation culture: Wait for the seed bacteria volume OD 600 When the temperature reaches 20-25, the fermentation medium is inoculated with 20% of the inoculum to start fermentation. During the fermentation process, the pH value is controlled at 7.0, the temperature is 37°C, and the dissolved oxygen is 40%-60%. When the glucose in the medium is consumed, 80% of the glucose solution is added to maintain the glucose concentration in the fermentation medium below 1 g / L.

5. The use of the hypoxanthine producing strain according to claim 4, characterized in that: The slant culture medium used in seed activation is: glucose 4 g / L, peptone 4 g / L, yeast extract powder 8 g / L, sodium chloride 3 g / L, potassium dihydrogen phosphate 4 g / L, anhydrous magnesium sulfate 2 g / L, agar powder 20%, and the rest is water.

6. The use of the hypoxanthine producing strain according to claim 4, characterized in that: The seed culture medium used in the seed culture was: glucose 25 g / L, yeast extract powder 6 g / L, peptone 3 g / L, ammonium sulfate 5 g / L, potassium dihydrogen phosphate 3 g / L, anhydrous magnesium sulfate 0.5 g / L, ferrous sulfate heptahydrate 40 mg / L, manganese sulfate monohydrate 20 mg / L, V H 0.5 mg / L, V B1 1 mg / L, guanine 0.5 g / L, and the rest is water.

7. The use of the hypoxanthine producing strain according to claim 4, characterized in that: The fermentation medium used in the fermentation culture was: glucose 30 g / L, yeast extract 6 g / L, peptone 4 g / L, ammonium sulfate 3 g / L, potassium dihydrogen phosphate 3 g / L, anhydrous magnesium sulfate 2 g / L, ferrous sulfate heptahydrate 40 mg / L, manganese sulfate monohydrate 10 mg / L, V H 1mg / L,V B1 2 mg / L, guanine 1 g / L, and the rest is water.

Images