Application of the metal ion transport regulatory gene sco2508 in increasing actinolite production in Streptomyces cerevisiae
By knocking out or inhibiting the sco2508 gene in Streptomyces aquamarine, an engineered strain was constructed, which significantly increased the yield of actinolite, solving the problem of limited yield increase in existing technologies and promoting the industrial application of natural dyes.
Patent Information
- Application Number
- CN202411226120.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-03
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2044-09-03
AI Technical Summary
Existing technologies have limited effectiveness in modifying regulatory genes to increase actinol production, and the effects of other regulatory genes on actinol synthesis are unclear, which hinders the industrialization of actinol.
In Streptomyces aquamarine, the metal ion transport regulatory gene sco2508 was knocked out or inhibited. Gene knockout was performed using homologous recombination suicide plasmid vectors or CRISPRi technology was used to reduce the activity or expression level of sco2508, thereby constructing engineered strains to increase the production of actinol.
It significantly increased the yield of actinolite by 2.5 times, reduced industrial production costs, improved fermentation efficiency, and contributed to the industrialization of natural dyes.
Smart Images

Figure CN118995777B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the metal ion transport regulation gene sco2508 in increasing the production of actinolite in Streptomyces azureus. Background Technology
[0002] Actinochrocin is a type II polyketide antibiotic produced by *Streptomyces coelicolor*, exhibiting weak antibacterial activity. It is a natural pigment that appears blue-purple under alkaline conditions and red under acidic conditions. It can be used in the production of microbial-derived pigments, reducing environmental pollution in traditional pigment production processes and producing healthier natural pigments. Furthermore, actinochrocin possesses redox activity, influencing the redox cycle of the bacterial strain. This pigment also acts as a catalyst for in vitro oxidation reactions, catalyzing the production of hydrogen peroxide from L-ascorbic acid and L-cysteine.
[0003] Previous studies have explored how altering regulatory genes can influence actinolite production. For example, Lu et al. found that adding sulfate can affect the autotranscription of the global regulator AdpA, thus affecting actinolite synthesis. Zhu et al. found that the regulator orrA affects the expression of another global regulator, wblA, and inactivating orrA downregulates actinolite synthesis. Yang et al. found that overexpression of a novel HATPase family regulatory protein, SspH, can increase actinolite production. Liu et al. found that the deletion of sco3361, an Lrp / AsnC family regulatory protein, leads to a significant decrease in actinolite production.
[0004] sco2508 encodes a regulatory protein that controls metal uptake. On the *Streptomyces aquamarine* chromosome, the gene sco2505-sco2508 constitutes an operon, presumably involved in the transport of metal ions required for the strain's growth or metabolism. The relationship between sco2508 and actinolite production remains unclear.
[0005] Current research has explored methods to modify regulatory genes to increase actinol production; however, the effects of these modifications are limited. Furthermore, it remains unclear whether and how other regulatory genes can influence actinol synthesis. Therefore, providing a gene modification method to increase actinol production has significant application value for the industrialization of actinol. Summary of the Invention
[0006] To address the shortcomings of existing technologies, the present invention aims to provide the application of the metal ion transport regulatory gene sco2508 in enhancing the production of actinolite in Streptomyces coelicolor. This invention knocks out the metal ion transport regulatory gene sco2508 in Streptomyces coelicolor M145, obtaining a Streptomyces coelicolor mutant strain with the sco2508 knockout gene. The actinolite production of this mutant strain is significantly increased, which is of great significance for the industrialization of naturally derived dyes.
[0007] To achieve this objective, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides the application of the metal ion transport regulatory gene sco2508 in increasing the production of actinolite in Streptomyces azureus, wherein the nucleotide sequence of the metal ion transport regulatory gene sco2508 includes the one shown in SEQ ID NO:1.
[0009] Preferably, the application includes: knocking out or inhibiting the metal ion transport regulatory gene sco2508 in Streptomyces azureus to increase the production of actinolite in Streptomyces azureus.
[0010] sco2508 is a gene that regulates metal ion transport. Metal ions affect the biosynthesis of natural products by acting as cofactors for enzymes, regulators of metabolic pathways, and causing potential cytotoxicity. This invention found that knocking out or inhibiting the metal ion transport regulatory gene sco2508 in *Streptomyces cerevisiae* is beneficial for increasing the production of actinolite in *Streptomyces cerevisiae*.
[0011] Secondly, the present invention provides an engineered bacterium for producing actinol, wherein the engineered bacterium is obtained by knocking out or inhibiting the metal ion transport regulatory gene sco2508, using *Streptomyces aquamarine* as the starting strain; the nucleotide sequence of the metal ion transport regulatory gene sco2508 includes the one shown in SEQ ID NO:1.
[0012] Preferably, the knockout or inhibition of the metal ion transport regulatory gene sco2508 is achieved through any one of the following methods (1), (2), and (3):
[0013] (1) Insert, delete, or replace one or more bases in the gene encoding the target enzyme to inactivate or reduce the activity of the target enzyme.
[0014] (2) Replace the transcriptional or translational regulatory elements of the gene encoding the target enzyme with regulatory elements with lower activity;
[0015] (3) The target enzyme is inactivated or its activity is reduced by inhibiting the CRISPRi gene or by using antisense RNA technology.
[0016] Preferably, the knockout is performed by using a homologous recombination suicide plasmid vector to knock out the metal ion transport regulatory gene sco2508, thereby downregulating the function of the metal ion transport regulatory gene sco2508.
[0017] Preferably, the homologous recombination suicide plasmid vector includes: upstream and downstream homologous arm fragments of the metal ion transport regulation gene sco2508 and an resistance gene fragment.
[0018] Preferably, the resistance gene fragment is the resistance gene aac(3)IV fragment.
[0019] Preferably, the nucleotide sequences of the upstream and downstream homologous arm fragments of the metal ion transport regulatory gene sco2508 include those shown in SEQ ID NO:2 and SEQ ID NO:3.
[0020] Preferably, the nucleotide sequence of the resistance gene aac(3)IV fragment includes that shown in SEQ ID NO:4.
[0021] Preferably, the upstream and downstream homologous arm fragments of the metal ion transport regulation gene sco2508 and the resistance gene fragment are assembled into the suicide vector pKCLP2-gusA to obtain the homologous recombinant suicide plasmid vector.
[0022] Preferably, the nucleotide sequence of the suicide vector pKCLP2-gusA includes that shown in SEQ ID NO:5.
[0023] The upstream and downstream homologous arm sequences used in the knockout mutant strain constructed in this invention are shown in SEQ ID NO:2 and SEQ ID NO:3, the nucleotide sequence of the knockout vector pKCLP2-gusA is shown in SEQ ID NO:5, and the nucleotide sequence of the resistance gene aac(3)IV is shown in SEQ ID NO:4.
[0024] In this invention, the homologous arm sequence of the metal ion transport regulation gene sco2508 was amplified from Streptomycescoelicolor M145, and after being ligated into the knockout vector along with the resistance gene, it was transformed into the actinol-producing strain Streptomycescoelicolor M145 for gene knockout and product fermentation.
[0025] Specifically, the technical solution of the present invention includes: amplifying the upstream and downstream homologous arm fragments of the regulatory gene sco2508 using the genomic DNA of Streptomyces coelicolor M145 as a template, amplifying the resistance gene aac(3)IV fragment using the DNA of the universal plasmid pSET152 as a template, assembling the amplified fragment into the suicide vector pKCLP2-gusA using Gibson assembly, transforming the obtained recombinant vector into the Escherichia coli conjugation transfer strain ET12567 (pUZ8002), transforming the recombinant vector into Streptomyces coelicolor M145 using Streptomyces-Escherichia coli indirect transfer, screening positive clones by resistance verification and colony PCR verification, fermenting positive clones and control strains in shake flasks, and quantifying the production of actinol by absorbance method.
[0026] Thirdly, the present invention provides a homologous recombination suicide plasmid vector, wherein the nucleotide sequence of the homologous recombination suicide plasmid vector includes: upstream and downstream homologous arm fragments of the metal ion transport regulation gene sco2508 and an resistance gene fragment.
[0027] Preferably, the resistance gene fragment is the resistance gene aac(3)IV fragment.
[0028] Preferably, the nucleotide sequences of the upstream and downstream homologous arm fragments of the metal ion transport regulatory gene sco2508 include those shown in SEQ ID NO:2 and SEQ ID NO:3.
[0029] Preferably, the nucleotide sequence of the resistance gene aac(3)IV fragment includes that shown in SEQ ID NO:4.
[0030] Preferably, the upstream and downstream homologous arm fragments of the metal ion transport regulation gene sco2508 and the resistance gene fragment are assembled into the suicide vector pKCLP2-gusA to obtain the homologous recombinant suicide plasmid vector.
[0031] Preferably, the nucleotide sequence of the suicide vector pKCLP2-gusA includes that shown in SEQ ID NO:5.
[0032] Fourthly, the present invention provides the application of substances targeting the metal ion transport regulatory gene sco2508 and / or the metal ion transport regulatory protein (metal uptake) in the preparation of additives that enhance the production of actinolite in Streptomyces azureii, wherein the nucleotide sequence of the metal ion transport regulatory gene sco2508 includes the one shown in SEQ ID NO:1.
[0033] Preferably, the substance targeting the metal ion transport regulation gene sco2508 is an inhibitor that reduces the activity and / or expression level of the sco2508 gene.
[0034] Preferably, the inhibitor that reduces the activity and / or expression level of the sco2508 gene includes: a small molecule compound, or an interfering RNA vector expressing the sco2508 gene.
[0035] Preferably, the substance targeting the metal ion transport regulatory protein is an inhibitor that reduces the expression and function of the metal ion transport regulatory protein.
[0036] Preferably, the inhibitors that reduce the expression and function of metal ion transport regulatory proteins include: vectors for constructing sco2508 gene knockdown or knockout systems, or small molecule compounds.
[0037] Fifthly, the present invention provides an additive for increasing the production of actinolite in Streptomyces azureus, the additive comprising the substances described in the fourth aspect that target the metal ion transport regulatory gene sco2508 and / or the metal ion transport regulatory protein.
[0038] In a sixth aspect, the present invention provides the application of the engineered bacteria for producing actinol as described in the second aspect, the homologous recombinant suicide plasmid vector as described in the third aspect, or the additive for increasing the production of actinol in Streptomyces azureus as described in the fifth aspect in the preparation of actinol.
[0039] Compared with the prior art, the present invention has the following beneficial effects:
[0040] sco2508 is a gene that regulates metal ion transport. Metal ions affect the biosynthesis of natural products by acting as cofactors for enzymes, regulators of metabolic pathways, and causing potential cytotoxicity. This invention reports that knocking out the metal ion transport regulator sco2508 significantly increases the yield of actinolite by 2.5 times. This can reduce the industrial production cost of the natural pigment actinolite and improve fermentation efficiency. It is of great significance for the industrialization of naturally derived dyes in my country. Attached Figure Description
[0041] Figure 1 It is the spectrum of the SCO2508 knockout vector.
[0042] Figure 2 This is a graph showing the change in actinopyroxin production after the sco2508 gene was knocked out. Detailed Implementation
[0043] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.
[0044] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0045] The serial numbers in this invention are as follows:
[0046] SEQ ID NO:1 (sco2508 gene).
[0047] SEQ ID NO:2 (sco2508 upstream homologous arm sequence).
[0048] SEQ ID NO:3 (sco2508 downstream homologous arm sequence).
[0049] SEQ ID NO:4 (aac3(IV) resistance gene fragment).
[0050] SEQ ID NO:5 (pKCLP2-gusA vector sequence).
[0051] Example 1: Cloning of upstream and downstream homologous arms of sco2508 and the aac(3)IV fragment of the resistance gene.
[0052] Take 1 mL of Streptomyces coelicolor M145 bacterial culture medium and extract total genomic DNA from M145 using a bacterial genomic DNA extraction kit (Tiangen). Use primers L-FP (SEQ ID NO:6), L-RP (SEQ ID NO:7), R-FP (SEQ ID NO:8), R–RP (SEQ ID NO:9), apr-FP (SEQ ID NO:10), and APR-RP (SEQ ID NO:11). Amplify homologous arms and resistance gene fragments (approximately 2.0 kb, 2.0 kb, and 1.0 kb in size) using Phanta Max Super-Fidelity DNA Polymerase (Novizan). The amplification system is shown in Table 1.
[0053] Table 1
[0054] reagents Volume / μL 2×PCR Mix Buffer 25 dNTP 1 DNA polymerase 1 XM201 genomic DNA 1 FP 2 RP 2 50% DMSO 5 sterile water 13 total 50
[0055] PCR amplification conditions were as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 65℃ annealing for 30 s, 72℃ extension for 1 min / kb, 30 cycles; 72℃ extension for 10 min. The correctness of the bands was detected by agarose gel electrophoresis.
[0056] L-FP (SEQ ID NO: 6): gtgccaagcttgggctgcagcgtcaccaccgtcttctacg.
[0057] L-RP (SEQ ID NO:7): gagttttcgttccactgagcgtctagatggattcctcctcacgtcttc.
[0058] R-FP (SEQ ID NO: 8): cgctgatgatatgctgacgctctagagccggtggggccggggct.
[0059] R–RP (SEQ ID NO:9): acatgattacgaattcgatatcgaattgggccggtgttccgtcgagacc.
[0060] apr-FP (SEQ ID NO: 10): tctagacgctcagtggaacgaaaactc.
[0061] APR-RP (SEQ ID NO: 11): tctagagcgtcagcatatcatcagcg.
[0062] Example 2: Gibson assembly of homologous arm fragment, resistance fragment, and vector pKCLP2-gusA
[0063] The Streptomyces expression vector pKCLP2-gusA was digested with PstI and EcoRV enzymes and then processed via EZNA. The Omega Extraction Kit was used to recover linearized pKCLP2-gusA, homologous arms, and PCR fragments of the resistance gene. Gibson was used... The NEB (Necrocloning Kit) is used to assemble vectors and fragments. First, prepare the Gibson AssemblyMaster Mix. Prepare the Gibson system according to the proportions shown in Table 2.
[0064] Table 2
[0065] reagents Volume / μL Gibson reagents 6 Linearized pKCLP2-gusA 1 Upstream homology arm 1 Downstream homology arm 1 resistance gene 1 total 10
[0066] The above system was placed at 50°C for 50 minutes and then immediately transferred to ice.
[0067] Example 3: Transformation of Gibson Assembly Products and Screening of Positive Clones
[0068] E. coli DH5α competent cells stored at -80℃ were thawed on ice, and 10 μL of assembly product was added to each tube. The tubes were then incubated on ice for 10 min. Afterward, they were transferred to a 42℃ water bath for 90 s for heat shock. They were then placed back on ice for 90 s. 500 μL of LB medium was added to each tube, and the tubes were incubated at 37℃ in a shaker for 30 min for recovery. Finally, the tubes were spread onto LB solid medium supplemented with apramycin and hygromycin, and incubated upside down at 37℃ for 12 hours.
[0069] After single colonies grew, eight single colonies were selected and placed in LB liquid medium supplemented with apramycin and hygromycin, and cultured at 37°C for 6-8 hours. Positive clones capable of amplifying the 1.4kb fragment were then screened using Vazyme, 2×Rapid Taq Master Mix (Novizan), with primers FP: ttcatcctgctgagcctgc (SEQ ID NO:12) and RP: catccccaacgaggagcttc (SEQ ID NO:13). The preparation method of the PCR system is shown in Table 3.
[0070] Table 3
[0071] reagents Volume / μL PCR Mix 10 50% DMSO 2 forward primer 1 reverse primer 1 bacterial solution 1 <![CDATA[ddH2O]]> 5 total 20
[0072] PCR amplification conditions were as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 65℃ annealing for 30 s, 72℃ extension for 2 min, 30 cycles; 72℃ extension for 10 min. The correctness of the bands was detected by agarose gel electrophoresis.
[0073] Figure 1 This is the map of the sco2508 knockout vector. The left arm is the upstream homologous arm sequence of the sco2508 gene, and the right arm is the downstream homologous arm sequence. aac3(IV) is the APR resistance gene fragment. The homologous arm and the APR resistance gene are joined to the PstI and EcoRV sites of pKCLP2gusA via Gibson assembly.
[0074] Example 4: The recombinant vector was transformed into Escherichia coli conjugation transfer strain ET12567 (pUZ8002).
[0075] E. coli ET12567 (pUZ8002) competent cells stored at -80℃ were thawed on ice. 5 μL of the constructed recombinant vector was added to each tube, and the tubes were incubated on ice for 10 min. Then, they were transferred to a 42℃ water bath for 90 s heat shock. Afterward, they were placed back on ice for 90 s. 500 μL of LB medium was added to each tube, and the tubes were incubated at 37℃ in a shaker for 30 min. Finally, the tubes were spread onto LB solid medium containing chloramphenicol, kanamycin, apramycin, and hygromycin, and incubated upside down at 37℃ for 12 hours.
[0076] After single clones have grown, 8 single clones are selected and placed in LB liquid medium supplemented with chloramphenicol, kanamycin, apramycin and hygromycin, and cultured at 37°C for 6-8 hours. Then, positive clones that can amplify the 1.4kb fragment are screened by Vazyme, 2×Rapid Taq Master Mix (Novizan) using primers FP: ttcatcctgctgagcctgc, (SEQ ID NO:12), RP: catccccaacgaggagcttc, (SEQ ID NO:13).
[0077] Example 5: Indirect and Transferred Transmission of Streptomyces to Escherichia coli
[0078] E. coli ET12567 / pUZ8002 containing recombinant plasmids was activated on LB agar plates containing kanamycin, chloramphenicol, and apramycin. After overnight culture at 37°C, single colonies were picked and transferred to 5 mL of LB (containing the above antibiotics at a dilution of 1:1000), cultured at 37°C, and centrifuged to collect the bacterial cells after 20 h. The cells were washed twice with antibiotic-free LB and resuspended in 500 μL of LB.
[0079] The S. coelicolor M145 strain was plated on solid SFM plates for activation and incubated at 30°C for 7 days. Spores were collected using a cotton swab into 500 μL of 2×YT solution.
[0080] The mycelium resuspended in LB solution was thoroughly mixed with E. coli at a 1:1 ratio and evenly spread onto a substrate containing 10 mM Mg. 2+ SFM plates were incubated upside down at 30°C. After 16 hours, the plates were covered with sterile water containing 2 mg of nalidixic acid and 2 mg of apramycin. The plates were then dried and incubated upside down at 30°C. Conjugates appeared after 3-7 days.
[0081] Example 6: Screening for positive clones
[0082] The conjugates were streaked onto SFM plates containing nalidixinone acid and apramycin. After single colonies grew, they were picked and cultured in TSBY medium containing apramycin. Two days later, PCR verification was performed using this bacterial culture, an ET strain transformed with recombinant plasmid as a positive control, and the wild-type S. coelicolor M145 genome as a negative control. Positive clones that could amplify the 3.5kb fragment were screened using Vazyme, 2×Rapid TaqMaster Mix (Novizan), and primers FP: ttcatcctgctgagcctgc (SEQ ID NO:12), RP: catccccaacgaggagcttc (SEQ ID NO:13). The preparation method of the PCR verification system is shown in Table 3.
[0083] PCR amplification conditions were as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 65℃ annealing for 30 s, 72℃ extension for 2 min, 30 cycles; 72℃ extension for 10 min. The correctness of the bands was detected by agarose gel electrophoresis.
[0084] Example 7: Fermentation of Actinopyroxin
[0085] The *S. coelicolor* M145-derived strain was plated on SFM solid medium and incubated at 30°C for 2 days. During fermentation, approximately 1 cm of the culture was picked up... 2 The agar blocks were inoculated into seed culture shake flasks with a volume of 25 mL / 250 mL and cultured on a rotary shaker at 30℃ and 220 rpm for 48 hours. Then, 10% was inoculated into the shake flask fermentation medium, with a volume of 50 mL / 250 mL, and cultured at 30℃ and 220 rpm for 5 days.
[0086] The seed culture medium formula (g / L) is: tryptone broth 30 g, yeast extract 5 g, sucrose 10 g. The fermentation culture medium formula (g / L) is: yeast extract 4 g, malt extract 10 g, glucose 4 g, pH 7.0-7.5.
[0087] Example 8: Detection and Quantification of Actinoporosis
[0088] After fermentation, 500 μL of fermentation product was taken and 500 μL of 2 mol / L KOH was added. The mixture was then sonicated for 30 min. After centrifugation at 12000 rpm for 1 min, the product was transferred to A... 640 nm The absorbance was measured.
[0089] Figure 2This graph shows the change in actinol production after knocking out the sco2508 gene. The control strain is the wild-type S. coelicolor M145, and the sco2508 knockout strain is the mutant strain obtained by knocking out the sco2508 gene from S. coelicolor M145. The graph shows that knocking out sco2508 increased actinol production by 2.5 times.
[0090] In summary, this invention knocks out the metal ion transport regulatory gene sco2508 in Streptomyces coelicolor M145, constructing a mutant strain with the sco2508 gene knocked out. The mutant strain shows a significant increase in actinomycin production, which can save on the industrial production cost of the natural pigment actinomycin and improve fermentation efficiency. This is of great significance for the industrialization of dyes from natural sources in my country.
[0091] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.
Claims
1. The application of knocking out the metal ion transport regulatory gene sco2508 in *Streptomyces cerevisiae* in increasing the production of actinolite in *Streptomyces cerevisiae*, characterized in that... The nucleotide sequence of the metal ion transport regulatory gene sco2508 is shown in SEQ ID NO:
1.
2. An engineered bacterium for producing actinol, characterized in that, The engineered bacteria were obtained by knocking out the metal ion transport regulation gene sco2508 using a homologous recombination suicide plasmid vector, starting with Streptomyces cerevisiae M145. The nucleotide sequence of the metal ion transport regulation gene sco2508 is shown in SEQ ID NO:
1. The homologous recombination suicide plasmid vector includes: upstream and downstream homologous arm fragments of the metal ion transport regulation gene sco2508 and a resistance gene fragment; The resistance gene fragment is the resistance gene aac(3)IV fragment; the nucleotide sequence of the resistance gene aac(3)IV fragment is shown in SEQ ID NO:4; The nucleotide sequences of the upstream and downstream homologous arm fragments of the metal ion transport regulatory gene sco2508 are shown in SEQ ID NO:2 and SEQ ID NO:
3.
3. The engineered bacteria for producing actinol according to claim 2, characterized in that, The upstream and downstream homologous arm fragments of the metal ion transport regulation gene sco2508 and the resistance gene fragment were assembled into the suicide vector pKCLP2-gusA to obtain the homologous recombinant suicide plasmid vector.
4. The engineered bacteria for producing actinol according to claim 3, characterized in that, The nucleotide sequence of the suicide vector pKCLP2-gusA is shown in SEQ ID NO:
5.
5. The use of the engineered bacteria for producing actinol according to any one of claims 2-4 in the preparation of actinol.
Citation Information
Patent Citations
Stress, signal and transcriptional regulation genes participating in regulation of ACT (actinorhodin) yield in streptomyces
CN109504690A