A SNP molecular marker related to chicken body weight traits and application thereof

Abstract

The application discloses a SNP molecular marker related to a chicken weight trait and application thereof, and particularly relates to a SNP site related to the weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks, wherein the SNP site chr1:170522957 is located on the upstream of SETDB2 and in the intron region of CAB39L; the weight of individuals of a chicken crossbreeding population at multiple weeks is determined and recorded; 1242 chickens are sequenced by using resequencing technology; whole genome correlation analysis is carried out; a SNP site affecting different weeks is obtained; the SNP frequency of the SNP site in other low-weight chicken species and high-weight chicken species in resequencing is counted; it is found that the SNP site has significant difference in the low-weight chicken species and the high-weight chicken species; T is the dominant allele in the high-weight chicken, and C is the dominant allele in the low-weight chicken; in the population with low weight, the weight of the breeding population can be improved by selecting individuals with the T allele of the site.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to SNP molecular markers related to chicken weight traits and their applications, specifically to SNP molecular markers related to chicken weight at two weeks, four weeks, six weeks, eight weeks, ten weeks, and twelve weeks of age and their applications. Background Technology

[0002] Chicken is one of the main meat varieties in China, characterized by high protein, low fat, and low cholesterol. In recent years, my country's chicken production has continued to grow, and improving muscle yield and chicken quality has been a long-term focus for breeding scientists. Classical breeding methods have made significant contributions to the improvement of agricultural animal production traits. With the continuous advancement of genomics work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding based on specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select chickens for genetic potential, accelerating the breeding process.

[0003] SNPs (Single Nucleotide Polymorphisms) are one of the most common forms of genetic variation in genetics. SNPs are characterized by their large quantity, high frequency, and low mutation rate, playing a crucial role in genetic research and molecular selection breeding. However, current molecular breeding practices for broiler chickens still lack molecular markers with clearly defined functions and significant effects. Therefore, identifying high-efficacy, accurate molecular markers is a current research focus. If we can find SNP molecular markers associated with target traits in chickens and ultimately elucidate the molecular mechanisms underlying these sites, it will greatly promote genetic improvement in chickens and bring breakthrough progress to the field of poultry breeding. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide SNP molecular markers related to chicken weight traits and their applications. Using resequencing technology, 1242 individuals from a hybrid chicken population with weight records at different ages were sequenced. GWAS analysis revealed a SNP locus significantly associated with weight at multiple weeks of age (2, 4, 6, 8, 10, and 12). This SNP is rs317047802 (chr1:170522957) located in genome version GRCg6a 104. This SNP molecular marker exhibits polymorphisms of C and T, including three genotypes: CC, TT, and CT. The frequency of this SNP was statistically analyzed in other low-weight and high-weight chicken breeds during resequencing, revealing significant differences between the two breeds. T was the dominant allele in high-weight chickens, while C was the dominant allele in low-weight chickens. In lower-weight populations, selecting individuals with the T allele can increase chicken weight.

[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0006] A SNP molecular marker associated with chicken weight traits.

[0007] The SNP molecular marker is located at chr1:170522957 in GRCg6a 104 of the genome, and the alleles of the SNP locus are T and C; it includes three genotypes: TT, TC and CC.

[0008] The economic traits are the body weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks, and twelve weeks of age.

[0009] In high-weight chickens, T is the dominant allele, while in low-weight chickens, C is the dominant allele.

[0010] Preferred,

[0011] The SNP molecular marker is located at base 101 of the nucleotide sequence shown in SEQ ID NO.1. SEQ ID NO.1 (chr1: 170522857-170523057)

[0012] aagcacaactgtaaccacaggctttcaggactgttaattcatcccagtcacccaaaatcagagaacatagctttaggcctgat

[0013] gtctcagtgtaatgtaacgtaagtgggttgtggcacaggaaagacaactcatgctccttgacttcacccagcactatctaaca

[0014] cttaaatcagtcctttattaggttcacacaac

[0015] The application of the above-mentioned SNP molecular markers in chicken weight traits.

[0016] The above application includes the following steps:

[0017] (1) Detect the genotype of the sample chickens at the SNP locus;

[0018] (2) Select T / T genotype sample chickens for breeding superior strains.

[0019] Preferred,

[0020] Step (1) can be performed by direct sequencing, or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it. For example, primers can be designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID NO.1, and then the alleles at that site can be detected.

[0021] The specific steps for amplification are as follows: Blood tissue samples from the hybridization population are collected and DNA is extracted using the total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA is then analyzed using a spectrophotometer to determine its OD value (OD). 260 / OD 280 and OD 260 / OD 230 The ratio was used to determine the concentration and purity of DNA, and agarose gel electrophoresis was used to detect DNA integrity. Using the genome of the hybrid population samples as a template, primers were designed using Oligo7 software, and sequence amplification was performed using Novizan 2×Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to detect the fragment size of the product.

[0022] Primer pairs containing the SNP site fragment of claim 1 are used to amplify the primer pairs, the sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0023] The primer pair sequences are:

[0024] F:AAGCACAACTGTAACCACA(SEQ ID NO.2)

[0025] R:GTTGTGTGAACCTAGTAAT(SEQ ID NO.3)

[0026] The application of the aforementioned SNP molecular markers in marker-assisted selection breeding,

[0027] Chickens with the genotype T / T were selected for breeding.

[0028] The beneficial effects of this invention are:

[0029] This invention provides a SNP molecular marker associated with the weight of chickens at multiple weeks of age and its application. Genotyping was performed on the SNP locus chr1:170522957 in 1242 chickens. SNP frequency analysis of this locus was conducted in low-weight and high-weight chicken breeds, revealing that T is the dominant allele in high-weight chickens and C is the dominant allele in low-weight chickens. In a low-weight population, selecting individuals with the T allele can increase the overall weight of the population. This locus, as an SNP molecular marker, can be applied to the breeding of superior chicken breeds, enabling early, rapid, low-cost, and effective prediction of weight, showing broad application prospects in chicken breed improvement and potentially yielding excellent economic value. Attached Figure Description

[0030] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0031] Figure 1A Manhattan plot of GWAS results for two-week-old infants. Figure 1B Manhattan plot of GWAS results for four-week-old infants. Figure 1C Manhattan plot of GWAS results for six-week-old infants. Figure 1D Manhattan plot of GWAS results for 8-week-old infants. Figure 1E Manhattan plot of GWAS results for 10-week-old infants. Figure 1F Manhattan plot of GWAS results for 12-week-old infants. Detailed Implementation

[0032] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0033] This invention provides a SNP molecular marker related to chicken weight traits and its application. The SNP molecular marker is located upstream of SETDB2 and in the CAB39L intron region, with chr1:170522957 of the genome GRCg6a 104. The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1. The alleles of the SNP site are C and T. The economic traits are the weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks, and twelve weeks of age. T is the dominant allele in high-weight chickens, and C is the dominant allele in low-weight chickens. In a low-weight population, the weight of chickens can be increased by selecting individuals with allele T.

[0034] Example 1: Genome-wide association analysis of body weight at different ages in chickens

[0035] 1. Test materials

[0036] Using individuals from a hybrid chicken population as the research subject, the body weight of 1242 chicken individuals was measured at two, four, six, eight, ten, and twelve weeks of age. The measurements were conducted strictly in accordance with the internal regulations of the chicken farm.

[0037] 2. Test Methods

[0038] 2.1 Phenotypic determination

[0039] When the chickens reach the corresponding age, each chicken is placed on a weighing device and waited for it to remain relatively calm and balanced. The displayed weight value is then recorded, along with its sex.

[0040] 2.2 Chicken whole-genome SNP genotyping method based on resequencing technology

[0041] Sequencing data were aligned to the GRCg6a 104 reference genome using GTX Align, and SNP loci were detected using Basevar. The genotype probability of all individuals was estimated using STITCH. For SNP loci obtained through genotyping, they were filtered based on MAF < 0.05, locus call rate < 0.95, and info score < 0.4, retaining a total of 7,901,521 high-quality SNPs.

[0042] 2.3 Genome-wide association analysis

[0043] Genome-wide association analysis was performed on the body weight phenotypes of 1242 chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks, and twelve weeks of age using fastGWA.

[0044] 2.4 SNP loci significantly associated with body weight trait

[0045] Detection of significant loci at the genomic level: significant loci are identified based on FDR < 0.05.

[0046] 3. Results and Analysis

[0047] This invention uses 1242 chickens from a hybrid population as subjects. Using resequencing technology, 7,901,521 SNPs were obtained and GWAS analysis was performed on the weight of chickens at different ages. A SNP (chr1: 170522957) that was significantly associated with the weight of chickens at different ages was identified, as shown in Figure 1.

[0048] Example 2: Frequency distribution of SNP (chr1: 170522957) in different chicken breeds

[0049] 1. Test materials

[0050] Low-weight chicken breeds: Bearded chicken (n=15), Beijing oil chicken (n=25), Camellia chicken (n=30), Daweishan miniature chicken (n=33), Silkie chicken (n=57) and Tibetan chicken (n=154).

[0051] High-weight chicken breeds: Lingnan yellow-feathered broiler (n=15), white-feathered broiler (n=20), Kebao chicken (n=33) and recessive white-feathered chicken (n=112).

[0052] 2. Test Methods

[0053] 2.1 Data Collection

[0054] The whole-genome resequencing data from the above six low-weight chicken breeds and four high-weight chicken breeds were downloaded from the NCBI SRA database (https: / / ncbi.nlm.nih.gov / sra).

[0055] 2.2 SNP typing using GATK

[0056] The gVCF was constructed based on the GRCg6a 104 reference genome using the gtx wgs command on the GTX server. Then, the gtx gi and gtx joint commands were used to perform joint variant detection on all gVCF samples and obtain genotype VCF files.

[0057] 2.3 SNP Filtration and Quality Control

[0058] After the combined variant detection was completed, SNPs were extracted using the SelectVariants tool in the GATK software package. Subsequently, the whole genome resequencing data were quality controlled using the VariantFiltration tool in the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. After the above quality control, a total of 44,272,587 resequencing SNPs were obtained.

[0059] 2.4 Calculation of allele frequencies of chr1:170522957 in different chicken breeds

[0060] The allele frequencies of chr1:170522957 in different chicken breeds were calculated using vcftools--freq2.

[0061] 3. Results and Analysis

[0062] The SNP frequency distribution of SNP (chr1: 170522957) in different low-weight and high-weight chicken breeds is shown in Table 1. Significant differences exist between the two breeds. T is the dominant allele in high-weight chickens, while C is the dominant allele in low-weight chickens.

[0063] Table 1. SNP frequency (chr1: 170522957) in different low-weight and high-weight chicken breeds.

[0064]

[0065]

[0066] Analysis revealed a SNP molecular marker associated with chicken weight traits. In a low-weight population, breeding individuals with the T / T allele could increase the weight of the breeding population.

[0067] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0068] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of an SNP molecular marker in detecting chicken weight traits, characterized in that, The SNP molecular marker is located at chr1:170522957 bp in the GRCg6a genome, and the alleles of the SNP site are T and C; it includes three genotypes: TT, TC and CC. The weight traits were measured at two weeks of age, four weeks of age, six weeks of age, eight weeks of age, ten weeks of age, and twelve weeks of age.

2. The application according to claim 1, characterized in that, Includes the following steps: (1) Detect the genotype of the sample chickens at the SNP locus; (2) Select T / T genotype sample chickens for breeding superior strains.

3. The application according to claim 2, characterized in that, Step (1) can be performed by direct sequencing or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it.

Images