RPA primer pair, probe and kit for detecting yellow catfish and detection method

Abstract

The present invention belongs to the field of detection technology, and specifically relates to an RPA primer pair, a probe and a kit and a detection method for detecting yellow catfish. RPA Real-time fluorescence RPA The primer pair comprises an upstream primer and a downstream primer; wherein the nucleotide sequence of the upstream primer is: 5'‑TCGTCGTGGCATGCCAGCTAAGCCTA GGAAGTG‑3' ; The nucleotide sequence of the downstream primer is: 5'‑ CGTATTTGCCATCATAGGAGCCTTCGTACACTG‑3' The primers of the present invention can specifically identify the Pelteobagrus fulvidraco DNA in the amplification reaction system, and have no cross reaction with the DNA of other similar species. At the same time, the primers of the present invention have high sensitivity. The real-time fluorescence RPA can complete the detection within 20 minutes, and the minimum detection limit can reach 102 copies / reaction. The lateral flow RPA test strip can achieve the same effect within 10 minutes, thereby realizing the accurate and rapid differentiation and identification of Pelteobagrus fulvidraco from Pelteobagrus vachelli, Pelteobagrus longibaris and other species on site.

Description

Technical Field

[0001] The invention belongs to the technical field of detection, and in particular relates to an RPA primer pair, a probe and a kit and a detection method for detecting yellow catfish. Background Art

[0002] Yellow catfish (Tachysurus fulvidraco) is an important and valuable small economic fish in my country's rivers and lakes. It is widely distributed in my country's freshwater bodies, and its distribution is more concentrated in the middle and lower reaches of the Yangtze River. Yellow catfish belongs to the order Siluriformes, family Catfish, genus Catfish in taxonomy. It has the characteristics of long body, large and flat head, no scales, and well-developed hard spines on both dorsal and pectoral fins. Its meat is tender and has an excellent taste, and is deeply favored by consumers. In order to protect the wild germplasm resources of the Yangtze River, including yellow catfish, it is crucial to develop technical methods that can quickly and accurately identify Yangtze River fish species on site.

[0003] The morphological identification method is simple, but biological traits are easily affected by the environment and are not very stable during genetic expression. When faced with incomplete morphological structural characteristics or similar fish species, significant difficulties may be encountered, or even inability to accurately identify. There are five species in the genus Pelteobagrus: common yellow catfish (P.fulvidraco), long-bearded yellow catfish (P.eupogon), vachelli yellow catfish (P.vachelli), shiny yellow catfish (Peltobagrus nitidus) and intermediate yellow catfish (P.intermedius). The first four species are widely distributed in the Yangtze River system. In addition, when handling aquatic products and processing aquatic products, morphological methods are no longer applicable, and species can only be determined through molecular detection technologies such as DNA.

[0004] However, although DNA technology is accurate, it has extremely high requirements on personnel, equipment, experimental environment and other hardware and software, and the detection time is relatively long, which cannot meet the requirements of real-time rapid detection on site. Therefore, how to provide a molecular detection technology that can quickly and accurately identify yellow catfish on site is a technical problem that urgently needs to be solved in this field.

[0005] It should be noted that the above information disclosed in this background technology section is only used to understand the background technology of the present application concept, and therefore, the above description is not considered to constitute information of the prior art. Summary of the invention

[0006] The embodiments of the present disclosure at least provide an RPA primer pair, a probe, a kit and a detection method for detecting yellow catfish.

[0007] In a first aspect, the present disclosure provides a method for detecting yellow catfish. RPA Primer pair, the RPA Real-time fluorescence RPAThe primer pair comprises an upstream primer and a downstream primer; wherein the nucleotide sequence of the upstream primer is:

[0008] 5'- TCGTCGTGGCATGCCAGCTAAGCCTAGGAAGTG -3' ;

[0009] The nucleotide sequence of the downstream primer is:

[0010] 5'- CGTATTTGCCATCATAGGAGCCTTCGTACACTG -3' .

[0011] In a second aspect, the present disclosure also provides a method for detecting yellow catfish. RPA Primer probes, including those described above RPA Primer pairs and real-time fluorescence RPA Primer probe; the real-time fluorescence RPA The modified nucleotide sequence of the primer probe is:

[0012] CCAAAGTGGATTTTTGTTCAGGTGTCATGTA [Fluorophore -dT]A[THF ][Fluorescence quenching group -dT ] ATAGCCCGTAAATAG / iSpC3 / .

[0013] In a third aspect, the present disclosure also provides a method for detecting yellow catfish. RPA Primer pair, the RPA Primer pairs are in test strip format RPA The primer pair comprises an upstream primer and a downstream primer; wherein the nucleotide sequence of the upstream primer is:

[0014] 5'- TCGTCGTGGCATGCCAGCTAAGCCTAGGAAGTG -3' ;

[0015] The nucleotide sequence of the downstream primer is:

[0016] 5'Biotin-CTTCCACTACGTCTTATCAATGGGGGCCGTAT -3' .

[0017] In a fourth aspect, the present disclosure also provides a method for detecting yellow catfish. RPA Primer probes, including those described above RPA Primer pairs and test strip types RPA Primer probe; the test strip type RPA The modified nucleotide sequence of the primer probe is:

[0018] 5' [Fluorophore -dT ]- TGTATAGCCCGTAAATAGGGGGAATCAGTGT[THF]ACGAAGGCTCCTATG- 3'C3 Spacer .

[0019] In an optional embodiment, the fluorescent group -dT include FAM-dT, HEX-dT, TET-dT, Cyanine dye-dT, ROX-dT and Texas Red-dT Any one of .

[0020] In an optional embodiment, the fluorescence quenching group -dT include BHQ-dT, Iowa Black-dT and BBQ-dT Any one of .

[0021] In an optional embodiment, the RPA The modified nucleotide sequence of the primer probe is:

[0022] CCAAAGTGGATTTTTGTTCAGGTGTCATGTA / i6FAMdT / T / idSp / / iBHQ1dT / ATAGCCCGTAAATAG / iSpC3 / .

[0023] In an optional embodiment, the RPA The modified nucleotide sequence of the primer probe is:

[0024] 5'FAM-TGTATAGCCCGTAAATAGGGGGAATCAGTGT[THF]ACGAAGGCTCCTATG-3'C3 Spacer .

[0025] In a fifth aspect, the present disclosure also provides a method for detecting yellow catfish. RPA Kit, comprising: RPA Reagent; RPA The reagents include the above-mentioned detection of yellow catfish RPA Primer pairs; and / or the detection of yellow catfish as described above RPA Primer probe.

[0026] In a sixth aspect, the present disclosure also provides a method for detecting yellow catfish, comprising the following steps: step S1, extracting nucleic acid to obtain a sample to be tested; step S2, using the above-described method for detecting yellow catfish to the sample to be tested; RPA The kit performs an amplification reaction and analyzes the reaction products.

[0027] The beneficial effects of the present invention are that the RPA primer pair, probe and kit for detecting yellow catfish and the primers of the detection method can specifically identify yellow catfish DNA in the amplification reaction system, and have no cross reaction with DNA of other similar species, and at the same time have high sensitivity, and the real-time fluorescence RPA can complete the detection within 20 minutes, and the minimum detection limit can reach 10² copies / reaction, and the lateral flow RPA test strip type can achieve the same effect within 10 minutes, thereby realizing the accurate and rapid differentiation and identification of yellow catfish and species such as yellow catfish, yellow catfish with long whiskers, etc. on site.

[0028] Other features and advantages of the present invention will be described in the following description, and partly become apparent from the description, or understood by practicing the present invention. The purpose and other advantages of the present invention are realized and obtained by the structures particularly pointed out in the description, claims and drawings.

[0029] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, preferred embodiments are given below and described in detail with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 A real-time fluorescence RPA reaction amplification curve diagram under different temperature conditions provided in the embodiment of the present disclosure, in which A is 37°C, B is 39°C, and C is 41°C;

[0032] Figure 2 This is a test result diagram of the lateral flow RPA test strip provided in an embodiment of the present disclosure, in which A is the color depth of the positive strip at different temperatures, and B is the color depth of the positive strip at different lengths at 37°C;

[0033] Figure 3 A diagram showing the sensitivity test results of the real-time fluorescent RPA and lateral flow RPA test strips provided in an embodiment of the present disclosure, wherein A is the detection result of the real-time fluorescent RPA at different copy numbers / reactions, and B is the detection result of the lateral flow RPA test strips at different copy numbers / reactions;

[0034] Figure 4 The real-time fluorescence RPA specificity test results provided in the embodiments of the present disclosure;

[0035] Figure 5 The lateral flow RPA test strip specificity test results provided in the embodiments of the present disclosure.

[0036] Figure 5 The species corresponding to the extracts in are:

[0037] 1. Pelteobagrus fulvidraco; 2. Pelteobagrus longibiricus; 3. Pelteobagrus vachelli; 4. Pelteobagrus glossus; 5. Silver carp; 6. Bighead carp; 7. Black carp; 8. Grass carp; 9. Cutthroat anchovy; 10. Short-headed anchovy; 11. Mandarin fish; 12. Big-eyed mandarin fish; 13. Culter albus; 14. Dabry's bream; 15. Mongolian bream; 16. Redfin bream; 17. Negative control. DETAILED DESCRIPTION

[0038] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] As used herein, the phrases "in one embodiment," "according to one embodiment," "in some embodiments," and the like generally refer to the fact that the particular feature, structure, or characteristic following the phrase may be included in at least one embodiment of the present disclosure. Therefore, a particular feature, structure, or characteristic may be included in more than one embodiment of the present disclosure, so that these phrases do not necessarily refer to the same embodiment. As used herein, the terms "example," "exemplary," and the like are used to "serve as an example, instance, or illustration." Any implementation, aspect, or design described herein as "example" or "exemplary" is not necessarily to be construed as preferred or superior to other implementations, aspects, or designs. On the contrary, the use of the terms "example," "exemplary," and the like is intended to present concepts in a concrete manner.

[0040] Herein, example embodiments of the present disclosure will be described in more detail with reference to the accompanying drawings. As used herein, expressions such as "at least one of..." modify the entire list of elements when following a list of elements, rather than modifying individual elements in the list. For example, the expression "at least one of a, b, and c" should be understood to include only a, only b, only c, both a and b, both a and c, both b and c, or all of a, b, and c.

[0041] The terms used herein are only used to describe specific exemplary configurations and are not intended to be limited. As used herein, the singular articles "one", "an" and "the" may also be intended to include plural forms, unless it is clearly indicated above that this is not the case. The terms "comprise", "include" and "have" are inclusive, and therefore specify the presence of features, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, steps, operations, elements, components and / or combinations thereof. The method steps, processes and operations described herein should not be interpreted as necessarily requiring them to be performed in the specific order discussed or shown, unless specifically identified as an execution order. Additional or alternative steps may be adopted.

[0042] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0043] The present invention relates to concentration values, and the meaning includes fluctuations within a certain range. For example, fluctuations can be allowed within a corresponding precision range. For example, 2%, fluctuations within a range of ±0.1% can be allowed. For values ​​that are large or do not require too fine control, the meaning is also allowed to include greater fluctuations. For example, 100mM, fluctuations within the range of ±1%, ±2%, ±5%, etc. can be allowed. Involving molecular weight, the meaning is allowed to include fluctuations of ±10%.

[0044] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to two unless otherwise specified.

[0045] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0046] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0047] In the present invention, "optionally", "optional", "optionally", "optionally", "optional", "optional", "optional" means optional, that is, it means to be selected from any one of the two parallel schemes of "yes" or "no". If multiple "optional" or "optional" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" or "optional" is independent.

[0048] In the present invention, the term "RPA" refers to Recombinase Polymerase Amplification, which is a rapid detection technology based on isothermal nucleic acid amplification, which can quickly detect specific DNA sequences at a constant temperature. RPA technology uses recombinase and single-stranded DNA binding protein (SSB) to identify the target DNA sequence and amplify it using polymerase.

[0049] There are five species in the genus Pelteobagrus, namely, common yellow catfish, long-bearded yellow catfish, walleye yellow catfish, glossy yellow catfish and intermediate yellow catfish. The first four species are widely distributed in the Yangtze River system. At the same time, due to the influence of their growth environment, their appearances are easily confused with each other. Therefore, it is difficult to accurately identify them by appearance during on-site testing.

[0050] The defects existing in the above solutions are the results obtained by the inventor after practice and careful research. Therefore, the discovery process of the above problems and the solutions proposed by the present disclosure for the above problems below should be the contributions made by the inventor to the present disclosure during the disclosure process.

[0051] It should be noted that similar reference numerals and letters denote similar items in the following drawings, and therefore, once an item is defined in one drawing, further definition and explanation thereof is not required in subsequent drawings.

[0052] Some embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the absence of conflict, the following embodiments and features in the embodiments can be combined with each other.

[0053] The disclosed embodiment provides a method for detecting yellow catfish RPA Primer pair, the RPA Real-time fluorescence RPA The primer pair comprises an upstream primer and a downstream primer; wherein the nucleotide sequence of the upstream primer is: 5'- TCGTCGTG GCATGCCAGCTAAGCCTAGGAAGTG -3' ; The nucleotide sequence of the downstream primer is: 5'- CGTATTTGCCATCAT AGGAGCCTTCGTACACTG -3' .

[0054] The disclosed embodiment also provides a method for detecting yellow catfish. RPA Primer probes, including those described above RPA Primer pairs and real-time fluorescence RPA Primer probe; the real-time fluorescence RPA The modified nucleotide sequence of the primer probe is: CCAAAGTGGATTTTTGTTCAGGTGTCATGTA [Fluorophore -dT]A[THF ][Fluorescence quenching group -dT ] ATAGCCCGTAAATAG / iSpC3 / .

[0055] The disclosed embodiment also provides a method for detecting yellow catfish. RPA Primer pair, the RPA Primer pairs are in test strip format RPA The primer pair comprises an upstream primer and a downstream primer; wherein the nucleotide sequence of the upstream primer is: 5'- TCGTCGTG GCATGCCAGCTAAGCCTAGGAAGTG -3' ; The nucleotide sequence of the downstream primer is: 5'Biotin-CTTCCACTAC GTCTTATCAATGGGGGCCGTAT -3' .

[0056] The disclosed embodiment also provides a method for detecting yellow catfish. RPA Primer probes, including those described above RPA Primer pairs and test strip types RPA Primer probe; the test strip type RPA The modified nucleotide sequence of the primer probe is: 5' [Fluorophore -dT ]- TGTATAGCCCGTAAATAGGGGGAATCAGTGT[THF]ACGAAGGCTCCTATG-3'C3 Spacer .

[0057] Specifically, the applicant found that the above primer pair has excellent specificity when used as a primer for the identification of yellow catfish, and can avoid the occurrence of false positive or weak positive amplification. RPA And test strip type RPA It also has high sensitivity during the reaction and can ensure efficient performance under isothermal conditions.

[0058] In some embodiments, specifically, the fluorescent group -dT include FAM (Fluorescein amidite)-dT, iHEX (Hexachloro-fluorescein)-dT, TET (Tetrachlorofluorescein)-dT, Cyanine dye ( Cyanine dyes ), -dT, ROX (Carboxy-X-rhodamine)-dT, Texas Red ( Texas Red )-dT Any of Preferably FAM-dT.

[0059] In some embodiments, specifically, the fluorescence quenching group -dT include BHQ (Black Hole Quencher)-dT, Iowa Black-dT and BBQ (Blackberry Quencher)-dT Any one of BHQ-dT ,like BHQ1-dT, BHQ2-dT, BHQ3-dT etc., more preferably BHQ1-dT .

[0060] In some embodiments, specifically, the RPA The modified nucleotide sequence of the primer probe is: CCAAAGTGGATTTTTGTTCAGGTGTCATGTA / i6FAMdT / T / idSp / / iBHQ1dT / ATAGCCCGTAAATAG / iSpC3 / .

[0061] In some embodiments, specifically, the RPA The modified nucleotide sequence of the primer probe is: 5'FAM- TGTATAGCCCGTAAATAGGGGGAATCAGTGT[THF]ACGAAGGCTCCTATG-3'C3 Spacer .

[0062] Specifically, by combining the above primers and probes, the real-time fluorescence RPA Specificity and sensitivity in the reaction.

[0063] The disclosed embodiment also provides a method for detecting yellow catfish. RPA Reagents, including the above-mentioned detection of yellow catfish RPA Primer pairs; and / or the detection of yellow catfish as described above RPA Primer probe.

[0064] The disclosed embodiment also provides a method for detecting yellow catfish. RPA Kit, comprising: RPA Reagent; RPA The reagents include the above-mentioned detection of yellow catfish RPA Primer pairs; and / or the detection of yellow catfish as described above RPA Primer probe.

[0065] In some embodiments, specifically, the kit further comprises: RPA Enzyme mixture; RPA Enzyme cocktail contains recombinase, single-stranded binding protein (SSB) and DNA These are known in the art. RPA In some embodiments, the core components of the reaction can also be provided separately. RPA Individual components of an enzyme mixture.

[0066] In some embodiments, the kit further comprises: a reaction buffer; the reaction buffer is used to provide a suitable RPA The ionic environment and necessary chemical conditions for enzyme activity.

[0067] In some embodiments, specifically, the kit further comprises: Mg²⁺ In some specific embodiments, Mg- Supplied as acetate salt Mg²⁺ . Mg²⁺ It is well known in the art DNA Required for polymerase activity.

[0068] In some embodiments, the kit further contains: a stabilizer and a preservative to ensure the stability of the kit during storage and use.

[0069] In some embodiments, the kit further comprises: a detergent to help reduce inhibitors in the sample and improve amplification efficiency.

[0070] In some embodiments, the kit further comprises: a positive control and a negative control. RPA Accuracy and specificity of responses.

[0071] In some embodiments, specifically, the kit further comprises: LFD (Lateral Flow Device) Test strips. For visual detection RPA Amplification results.

[0072] In some embodiments, the kit further comprises: extraction and dilution buffer. If the kit is designed to detect directly from complex samples, it may contain a sample lysis and DNA Release buffer.

[0073] In some embodiments, specifically, the kit further comprises: instructions for providing detailed operating steps, reaction conditions, usage guidelines and precautions.

[0074] Specifically, other components in the kit mentioned in the present invention can be obtained through commercial channels, and can be provided in multiple or one reagent individually or in combination.

[0075] The present disclosure also provides a method for detecting yellow catfish, comprising the following steps: step S1, extracting nucleic acid to obtain a sample to be tested; step S2, using the yellow catfish detection method as described above to detect the sample to be tested. RPA The kit performs an amplification reaction and analyzes the reaction products.

[0076] In some embodiments, specifically, the sample to be tested is derived from a fish tissue sample.

[0077] In some embodiments, specifically, RPA During the reaction, the concentration of the nucleic acid is greater than or equal to 10 2 The number of copies / reaction can be determined by those skilled in the art in combination with common sense during specific implementation. RPA The reaction system and reaction conditions of the test.

[0078] In some embodiments, specifically, each 50μL The reaction system contains 10 ± 2 μmoL The upstream primer and 10±2 μmoL Downstream primer.

[0079] In some embodiments, specifically, each 50μL The reaction system also contains 6 ± 1 μmoL probe.

[0080] In some embodiments, specifically, the reaction temperature is 37±2 ℃ .

[0081] In some embodiments, specifically, the reaction time is 10~35 min .

[0082] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0083] Example 1, Primer screening for yellow catfish real-time fluorescence RPA and lateral flow RPA test strip detection technology.

[0084] 1. Design and synthesis of primers and probes

[0085] The present invention is based on GenBank The published gene sequence of yellow catfish was selected COI Gene fragment design RPAPrimers, exo fluorescent probes and nfo probes were synthesized by Beijing Liuhe BGI Technology Co., Ltd. The specific sequences of primers are shown in Tables 1 and 2.

[0086] Table 1 Real-time fluorescence RPA Primer and probe sequences

[0087] Name Sequence

[0088] Table 2 Primer and probe sequences for test strip RPA

[0089] Name Sequence

[0090] 2. Fluorescence RPA Establishment of reaction system

[0091] Use fluorescent type DNA Isothermal rapid amplification kit, preparation 50µL RPA The reaction system is as follows: upstream and downstream primers (10 μM) 2 μL , Probe (10 μM) 0.6 μL, A buffer (Rehydration buffer) 29.4 μL and ddH20 11.5 μL tube premix; then add to the lyophilized powder, mix thoroughly with the recombinase, nuclease exonuclease, single-stranded binding protein and polymerase in the lyophilized powder, then add the template, and finally add 280 mmol / L Magnesium acetate 2.5 μL B buffer .

[0092] After rapid vortexing, 12000 rpm / min Instantly separate, put in the model WL-16-II The fluorescence detection program was set as follows: reaction temperature 37℃～41℃ , reaction time 20min ,by 30 s The fluorescence signal of the FAM channel is collected as a unit. By optimizing its reaction system, a fluorescence-based RPA detection method.

[0093] Specifically, in order to determine the ideal amplification temperature of the real-time fluorescence RPA, this embodiment sets 3 Reaction temperature conditions: 37 ℃、39 ℃、41 ℃ . Real-time fluorescence type RPA Amplification system: upstream and downstream primers (10 μM) 2 μL , Probe (10 μM)0.6 μL, 29.4µL A buffer, 2.5µL contain MgAc of B buffer, 2µL pMV-HSY-COI Recombinant plasmid template, complement ddH2O to 50µL ; Add to freeze-dried powder (containing exonuclease, polymerase, recombinase and single-stranded binding protein), after rapid vortex oscillation 12000 rpm / min Then the experimental group was placed in real-time fluorescence quantitativePCR The amplification was performed in the instrument and the fluorescence signal was collected. This study adopted the following judgment rules: FAM When a clear amplification curve is observed on the fluorescence channel, this indicates that the target DNA The sequence was successfully amplified during the reaction, so it can be determined that the sample belongs to the yellow catfish species; FAM No amplification curve was observed on the fluorescence channel, indicating that the sample was not of the yellow catfish species.

[0094] See also Figure 1 , yellow catfish fluorescence RPA The total duration of the test is approximately 20 The results show that when the reaction temperature is 37℃ When the amplification concentration was 10 5 When the copy number 20 After one cycle, the amplification plateau is reached, producing an ideal amplification curve. 39 ℃ and 41 ℃ Under the conditions, even if the reaction 40 Therefore, when the reaction conditions are at the optimal temperature, the ideal amplification curve cannot be obtained. 37℃ When the fluorescence RPA Can 20 The species identification of yellow catfish can be completed better within minutes.

[0095] like Figure 1 As shown, Figure 1 A is the reaction temperature 37℃ When the fluorescence RPA Amplification curve of Figure 1 B is the reaction temperature 39 ℃ When the fluorescence RPA Amplification curve of Figure 1 C is the reaction temperature 41℃ When the fluorescence RPA The amplification curve of Figure 1 It can be seen that when the reaction temperature is 37℃ When the amplification curve and amplification efficiency were better, the species identification of yellow catfish could be completed well within 20 minutes.

[0096] 3. Optimization of reaction conditions for lateral flow RPA test strips

[0097] Using colloidal gold DNA Isothermal rapid amplification kit, preparation 50µL RPA The reaction system is as follows: upstream and downstream primers (10 μM) 2 μL , Probe (10 μM) 0.6 μL, A buffer (Rehydration buffer) 29.4 μL andddH20 11.5 μL tube premix; then add to the lyophilized powder, mix thoroughly with the lyophilized powder, then add the template, and finally add 280 mmol / L Magnesium acetate 2.5 μL B buffer .

[0098] After rapid vortexing, 12000 rpm / min Immediately separate and place in a water bath RPA Amplification. The fluorescence detection program is set as: reaction temperature 37℃～41℃ , reaction time 20min ,by 30 s Collect for units FAM By optimizing the reaction system, a fluorescence-based RPA detection method.

[0099] See also Figure 2 , this embodiment sets 3 Reaction temperature （37℃、39℃ and 41℃） , for this lateral flow RPA The test strips were used to test the optimal reaction temperature. The results showed that at 37°C, 39°C and 41°C, the yellow catfish RPA-LFD The test lines of the test strips all showed clearly visible positive bands, indicating that these three temperatures can effectively detect yellow catfish, and the higher incubation temperature has no significant effect on the color depth of the positive band.

[0100] like Figure 2 As shown, Figure 2 A is 37℃、39℃ and 41℃ Yellow catfish RPA-LFD The test results of the test strips, therefore, 37℃ It can be used as the optimal reaction temperature of the test strip.

[0101] In addition, this embodiment 37℃ Under the conditions, tested 5 Incubation time （5、8、10 and 12 minute ） The results showed that incubation 5 Weaker positive bands can be detected after incubation for 8、10 and 12 A relatively clear positive band appeared after 15 minutes. 37℃ Incubation 8-10 minutes can be used as the recommended reaction condition of the test strip for the identification of Pelteobagrus fulvidraco.

[0102] like Figure 2 As shown, Figure 2 B is 5、8、10 and 12Minutes of incubation, yellow catfish RPA-LFD The test results of the test strips can be seen from the figure. 37℃ Can be used as the optimal reaction temperature of the test strip, incubation 5 Weaker positive bands can be detected after incubation for 8、10 and 12 A relatively clear positive band appeared after 15 minutes. 37℃ Incubation 8-10 minutes can be used as the recommended reaction condition of the test strip for the identification of Pelteobagrus fulvidraco.

[0103] Example 2 Sensitivity Detection

[0104] In order to determine the real-time fluorescence type of yellow catfish RPA and RPA-LFD The sensitivity of the method, the present invention uses pMV-HSY- COI Recombinant plasmid (according to NC_018768.1 Yellow catfish COI Genes, artificially synthesized and inserted MV The plasmid was constructed in the vector for verifying the primer-probe combination reaction system) and was gradiently diluted ( 10~10 5 The number of copies / reaction) was used to evaluate the assay.

[0105] See also Figure 3 The results showed that the fluorescent RPA Able to reach 10 2 The minimum detection limit of copies / reaction; at the same time, using RPA-LFD When the method is tested, >10 3 In the copy number / reaction group, obvious positive bands can be shown. 10 2 copies / reaction), and was able to detect relatively weak but still discernible positive signals. RPA and RPA-LFD The methods are sensitive enough to be used for low levels of DNA The copy number detection is suitable for trace identification of Pelteobagrus fulvidraco species.

[0106] like Figure 3 As shown, Figure 3 A is 10~10 5 Copy number / reaction time, yellow catfish real-time fluorescence type RPA The test results; Figure 3 B is 10~10 5 Copy number / reaction time, Pelteobagrus fulvidraco RPA-LFD The test results of the test strips can be seen from the figure. RPA-LFD When the method is tested, >10 3 In the copy number / reaction group, obvious positive bands can be shown. 10 2 copies / reaction), and can also detect relatively weak but still discernible positive signals.

[0107] Example 3 Specificity Detection

[0108] In order to detect the specificity of the primers, the present invention uses yellow catfish and some common Yangtze River fish to test the specificity of the two methods. In order to avoid the detection bias caused by the genetic diversity of species, this example collects fish from Yangtze River breeding. 15 Total number of fish samples 149 Tail (each fish contains at least 6 tail), respectively DNA , and the same species DNA Mix equal amounts for on-site testing.

[0109] See also Figure 4 The results showed that only yellow catfish DNA The group using the target species as template can produce specific fluorescence amplification curves, while the other groups showed no obvious fluorescence amplification curves, indicating that the real-time fluorescence RPA method for yellow catfish can effectively distinguish yellow catfish from non-target species, thereby achieving species-specific identification in the Yangtze River Basin.

[0110] at the same time, RPA-LFD The same results were obtained using the same method: positive bands were detected only in yellow catfish, and there was no difference between the positive bands and other fish in the Yangtze River Basin of China. 14 Cross-reactions with common species were achieved with an accuracy rate of 100% ,show RPA-LFD It also has good species specificity.

[0111] Example 4 Detection of actual samples

[0112] This example collected the 15 Total number of fish samples 149 Tail (each fish contains at least 6 tail), respectively DNA , and the same species DNA Mix equal amounts for on-site testing.

[0113] Determine whether the sample contains yellow catfish through the test results DNA .

[0114] Fluorescence RPA The test results are based on FAM When a clear amplification curve is observed on the fluorescence channel, this indicates that the target DNA The sequence was successfully amplified during the reaction, so it can be determined that the sample belongs to the yellow catfish species; FAM No amplification curve was observed in the fluorescence channel, indicating that the sample was not a yellow catfish species. RPA The basis for judging the test results of the test strips is that if the test lines of the test strips show clearly visible positive bands, it can be determined that the sample belongs to the yellow catfish species; if there are no bands on the test lines of the test strips, it is determined that the sample is not the yellow catfish species.

[0115] 15 Total number of fish samples 149 The actual test results of the samples are shown in Table 3.

[0116] Table 3 Real-time fluorescence type RPA and lateral flow RPA Test results of fish samples using test strips

[0117] Fish samples Number of samples Fluorescence detection results Lateral flow test strip test results Yellow catfish Yellow catfish Pelteobagrus vachelli Glossy yellow catfish Silver carp Bighead carp herring grass carp Coilia nasus Short-fronted Coilfish Mandarin fish Bigeye Mandarin Fish Culter alba Dabryonyx Mongolian carp Procypris erythrocephalus

[0118] “+” represents a positive test result, and “-” represents a negative test result.

[0119] In summary, the RPA primer pairs, probes, kits and primers of the detection method for detecting yellow catfish can specifically identify yellow catfish DNA in the amplification reaction system, and have no cross-reaction with DNA of other similar species. At the same time, the sensitivity is high. The real-time fluorescence RPA can complete the detection within 20 minutes, and the minimum detection limit can reach 10² copies / reaction. The lateral flow RPA test strip type can achieve the same effect within 10 minutes, realizing the accurate and rapid distinction and identification of yellow catfish from species such as Pelteobagrus vachelli and Pelteobagrus longibaris on site.

[0120] Based on the above ideal embodiments of the present invention, the relevant staff can make various changes and modifications without departing from the technical concept of the present invention through the above description. The technical scope of the present invention is not limited to the contents of the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A method for detecting yellow catfish RPA The primer probe is characterized in that include RPA Primer pairs and real-time fluorescence RPA Primer probe; Said RPA Real-time fluorescence RPA A primer pair, comprising an upstream primer and a downstream primer; wherein The nucleotide sequence of the upstream primer is: 5'-TCGTCGTGGCATGCCAGCTAAGCCTAGGAAGTG -3' ； The nucleotide sequence of the downstream primer is: 5'- CGTATTTGCCATCATAGGAGCCTTCGTACACTG -3' ； Said RPA The modified nucleotide sequence of the primer probe is: CCAAAGTGGATTTTTGTTTCAGGTGTCATGTA / i6FAMdT / T / idSp / / iBHQ1dT / ATAGCCCGTAAATAG / iSpC3 / 。 2. A method for detecting yellow catfish RPA The primer probe is characterized in that include RPA Primer pairs and test strip types RPA Primer probe; Said RPA Primer pairs are in test strip format RPA A primer pair, comprising an upstream primer and a downstream primer; wherein The nucleotide sequence of the upstream primer is: 5'-TCGTCGTGGCATGCCAGCTAAGCCTAGGAAGTG -3' ； The nucleotide sequence of the downstream primer is: 5'Biotin-CTTCCACTACGTCTTATCAATGGGGGCCGTAT-3' ； The test strip type RPA The modified nucleotide sequence of the primer probe is: 5' [Fluorophore -dT ]- TGTATAGCCCGTAAATAGGGGGAATCAGTGT[THF]ACGAAGGCTCCTATG-3'C3 Spacer .

3. The method for detecting yellow catfish as claimed in claim 2 RPA The primer probe is characterized in that The fluorescent group -dT include FAM-dT, HEX-dT, TET-dT, Cyanine dye-dT, ROX-dT and Texas Red- dT Any one of .

4. The method for detecting yellow catfish as claimed in claim 2 RPA The primer probe is characterized in that Said RPA The modified nucleotide sequence of the primer probe is: 5'FAM-TGTATAGCCCGTAAATAGGGGGAATCAGTGT[THF]ACGAAGGCTCCTATG-3'C3 Spacer 。 5. A method for detecting yellow catfish RPA The kit is characterized in that include: RPA Reagents; Said RPA The reagent comprises the method for detecting yellow catfish as claimed in claim 1 or 2. RPA Primer probe.

6. A method for detecting yellow catfish, characterized in that: The steps include: Step S1, extracting nucleic acid to obtain a sample to be tested; Step S2, using the method for detecting yellow catfish as claimed in claim 5 to test the sample to be tested. RPA The kit performs an amplification reaction and analyzes the reaction products.

Images