A SV molecular marker primer for constructing garlic molecular identity card and its application

Abstract

The application discloses a SV molecular marker primer for constructing a garlic molecular identity card and application thereof, and relates to the technical field of genetic engineering. 23 = 94143178827 genotypes, so as to construct a representative garlic molecular identity card. The garlic molecular identity card based on the SV molecular marker developed by the application can realize purity and genetic relationship identification of different garlic varieties, and provides technical support for research on garlic core germplasm resources and garlic germplasm innovation and variety selection.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an SV molecular marker primer for constructing a garlic molecular identity card and an application thereof. Background Art

[0002] Garlic (Allium sativum L.) is a crop of the genus Allium (Allium L.) in the family Liliaceae. It is an important vegetable and medicinal plant, native to Central Asia, and has a cultivation history of over 4,000 years. my country's annual garlic planting area is approximately 12.65 million mu, accounting for more than 50% of the global garlic planting area, making it the country with the largest garlic planting area and the highest yield in the world.

[0003] Garlic has abundant germplasm resources and a vast cultivated area, but its germplasm resources are highly repetitive, resource evaluation techniques are backward, and variety identification is very difficult. We have developed universal SV molecular markers, constructed a garlic molecular identity card, and applied SV molecular markers to the analysis of garlic population genetic structure to screen core germplasm, providing technical support for the research of garlic core germplasm resources, garlic germplasm innovation, and variety breeding.

[0004] The molecular markers that have been applied include restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA marker (RAPD), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), insertion-deletion marker (InDel) and single nucleotide polymorphism (SNP), etc.; the number of RFLP, RAPD, AFLP and SSR molecular markers in the genome is small; the number of SNP molecular markers is the largest, but the development cost and detection cost are high, and the structural variations of the genome mainly include deletion, duplication, insertion, translocation, inversion and transposition, etc.; the common RAPD, SSR, ISSR, In-Del and other markers reflect the polymorphism of several bases to several hundred bases in the genome between individuals, and the SV (structure variation) marker is a new type of molecular marker developed based on genome sequencing; the SV marker can detect structural variations of up to several thousand bases on the genome, and the SV marker is co-dominant inheritance, has the advantages of repeatability and stability, simple operation and easy detection, and is an ideal type of molecular marker.

[0005] However, there is no report on developing a general SV molecular marker for constructing a garlic molecular identity card, and applying the SV molecular marker to the analysis of the genetic structure of a garlic population to screen core germplasm; therefore, the present application aims to provide an SV molecular marker primer for constructing a garlic molecular identity card and application thereof. SUMMARY

[0006] The present application aims to provide an SV molecular marker primer for constructing a garlic molecular identity card and application thereof, and 23 molecular markers are developed by using large-fragment structural variations, the detection can be completed by using ordinary agarose gel electrophoresis, it is safe and non-toxic, simple and fast to operate, uniformly distributed on each chromosome of garlic, each site has three possibilities (AA, Aa and aa), and there are 3 23 94143178827 genotypes in total, so as to construct a representative garlic molecular identity card.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows: an SV molecular marker primer for constructing a garlic molecular identity card, wherein the SV molecular marker primer comprises at least the following 23 pairs of primers: PD118, PD119, PD124, PD130, PD213, PD216, PD219, PD223, PD301, PD312, PD315, PD408, PD412, PD414, PD506, PD509, PD510, PD607, PD609, PD701, PD703, PD806, PD810;

[0008] The forward primer sequence of PD118 is shown in SEQ ID NO: 1, the reverse primer sequence of PD118 is shown in SEQ ID NO: 2; the forward primer sequence of PD119 is shown in SEQ ID NO: 3, the reverse primer sequence of PD119 is shown in SEQ ID NO: 4; the forward primer sequence of PD124 is shown in SEQ ID NO: 5, the reverse primer sequence of PD124 is shown in SEQ ID NO: 6; the forward primer sequence of PD130 is shown in SEQ ID NO: 7, the reverse primer sequence of PD130 is shown in SEQ ID NO: 8; the forward primer sequence of PD213 is shown in SEQ ID NO: 9, the reverse primer sequence of PD213 is shown in SEQ ID NO: 10; the forward primer sequence of PD216 is shown in SEQ ID NO: 11, the reverse primer sequence of PD216 is shown in SEQ ID NO: 12; the forward primer sequence of PD219 is shown in SEQ ID NO: 13, the reverse primer sequence of PD219 is shown in SEQ ID NO: 14; the forward primer sequence of PD223 is shown in SEQ ID NO: 15, the reverse primer sequence of PD223 is shown in SEQ ID NO: 16; the forward primer sequence of PD301 is shown in SEQ ID NO: 17, the reverse primer sequence of PD301 is shown in SEQ ID NO: 18; the forward primer sequence of PD312 is shown in SEQ ID NO: 19, the reverse primer sequence of PD312 is shown in SEQ ID NO: 20; the forward primer sequence of PD315 is shown in SEQ ID NO: 21, the reverse primer sequence of PD315 is shown in SEQ ID NO: 22; the forward primer sequence of PD408 is shown in SEQ ID NO: 23, the reverse primer sequence of PD408 is shown in SEQ ID NO: 24; the forward primer sequence of PD412 is shown in SEQ ID NO: 25, the reverse primer sequence of PD412 is shown in SEQ ID NO: 26; the forward primer sequence of PD414 is shown in SEQ ID NO: 27, the reverse primer sequence of PD414 is shown in SEQ ID NO: 28; the forward primer sequence of PD506 is shown in SEQ ID NO: 29, the reverse primer sequence of PD506 is shown in SEQ ID NO: 30; the forward primer sequence of PD509 is shown in SEQ ID NO: 31, the reverse primer sequence of PD209 is shown in SEQ ID NO: 32; the forward primer sequence of PD510 is shown in SEQ ID NO: 33, the reverse primer sequence of PD510 is shown in SEQ ID NO: 34; the forward primer sequence of PD607 is shown in SEQ ID NO: 35, the reverse primer sequence of PD607 is shown in SEQ ID NO: 36; the forward primer sequence of PD609 is shown in SEQ ID NO: 37, the reverse primer sequence of PD609 is shown in SEQ ID NO: 38;The forward primer sequence of PD701 is shown in SEQ ID NO: 39, and the reverse primer sequence of PD701 is shown in SEQ ID NO: 40; the forward primer sequence of PD703 is shown in SEQ ID NO: 41, and the reverse primer sequence of PD703 is shown in SEQ ID NO: 42; the forward primer sequence of PD806 is shown in SEQ ID NO: 43, and the reverse primer sequence of PD806 is shown in SEQ ID NO: 44; the forward primer sequence of PD810 is shown in SEQ ID NO: 45, and the reverse primer sequence of PD810 is shown in SEQ ID NO: 46.

[0009] The present invention also provides a method for constructing molecular identification cards of different garlic varieties using SV molecular marker PCR detection results, comprising the following steps:

[0010] S1. Extract the total DNA of the garlic sample to be tested;

[0011] S2. Using the total DNA of the garlic sample to be tested as a template, SV molecular marker primers were used for PCR amplification, and then agarose gel electrophoresis was performed for detection;

[0012] S3. The products amplified by each pair of primers are assigned values ​​of "0", "1" or "2" according to the long, short or heterozygous states of the band patterns, and a garlic molecular ID card containing 23 numbers is constructed according to the chromosome sequence.

[0013] The present invention also provides a kit for constructing a garlic molecular identity card, which comprises the SV molecular marker primers.

[0014] The present invention also provides an application of the SV molecular marker primer or the kit in constructing a garlic molecular identity card.

[0015] The following are the sequences involved in the present invention:

[0016] SEQ ID NO: 1:

[0017] PD118-F:TCGTTTGGGGTCTGAAGTCC.

[0018] SEQ ID NO: 2:

[0019] PD118-R: GGCCATAACCAGAAGGGGAAG. SEQ ID NO: 3:

[0020] PD119-F:TCTGCTATTGGAAAAGCGTACA. SEQ ID NO: 4:

[0021] PD119-R:TTAAACTGCAATGACGGTGC。

[0022] SEQ ID NO:5:

[0023] PD124-F:CGCCATACATTGCACTTCTTCT。SEQ ID NO:6:

[0024] PD124-R:ACTACACAACACCACACAGAGT。SEQ ID NO:7:

[0025] PD130-F:GCCTAAAGAAACCTCCAATGTGG。SEQ ID NO:8:

[0026] PD130-R:AGTGGACAGTCTGAGCTTAAC。SEQ ID NO:9:

[0027] PD213-F:GGGCAATTGAGTTACAGGGC。

[0028] SEQ ID NO:10:

[0029] PD213-R:CAGCATGTGGGCTTTTGAGC。

[0030] SEQ ID NO:11:

[0031] PD216-F:CATAGTCACAACTGCCCGGT。SEQ ID NO:12:

[0032] PD216-R:TGGGCTGGAAATTTGTTTTTTGT。SEQ ID NO:13:

[0033] PD219-F:TGGGAAGCCGATTTCAATGTG。SEQ ID NO:14:

[0034] PD219-R:TGCCCAAAAGTTATGTCTTCGA。SEQ ID NO:15:

[0035] PD223-F:GGGAAGACGTGAGATGCTGT。SEQ ID NO:16:

[0036] PD223-R:TGGTAGGACAAGTGGAGACA。SEQ ID NO:17:

[0037] PD301-F:TCATCTAAACCCGTTGTCCCA。SEQ ID NO:18:

[0038] PD301-R:CTTATGCAAGCCCTATCCAGC。SEQ ID NO:19:

[0039] PD312-F:TTCGTTTAGATAGCACTGGT。

[0040] SEQ ID NO:20:

[0041] PD312-R:CTGAAGACACTAGGGGTATC。SEQ ID NO:21:

[0042] PD315-F:GAAGCAATCATACCTCGAAG。SEQ ID NO:22:

[0043] PD315-R:CAGCAAGGCAAAGTAAAAGA。SEQ ID NO:23:

[0044] PD408-F:GGTATCGTCTAGCATCTCAT。SEQ ID NO:24:

[0045] PD408-R:CCATAAGGTACAAGTTCCCT。SEQ ID NO:25:

[0046] PD412-F:GTTTGGTTCAGGATTTCAGT。SEQ ID NO:26:

[0047] PD412-R:CCAAAATTCTCTTCTGGCAA。SEQ ID NO:27:

[0048] PD414-F:GAGCTAGTCGTAATTTTGGG。SEQ ID NO:28:

[0049] PD414-R:ATGTTATCCGATTTACGCAG。SEQ ID NO:29:

[0050] PD506-F:TGGGAAATTGACATGAACTG。SEQ ID NO:30:

[0051] PD506-R:ATAGCCAACTTCTCAACTGT。SEQ ID NO:31:

[0052] PD509-F: AATTCGACTTCCTGACATTG. SEQ ID NO: 32:

[0053] PD509-R: TGACACTAGGTTCGATGAAT. SEQ ID NO: 33:

[0054] PD510-F: GCATGAATGATAGCATGTGA.

[0055] SEQ ID NO: 34:

[0056] PD510-R: GTCAACAACAGATGACCAAA.

[0057] SEQ ID NO: 35:

[0058] PD607-F: TCAAGAGGAGAAACAGGGGAGA. SEQ ID NO: 36:

[0059] PD607-R: TGCATTTGCCTATTCTTGCCG.

[0060] SEQ ID NO: 37:

[0061] PD609-F: GGTGGAGAAATGATTTGGGCAC. SEQ ID NO: 38:

[0062] PD609-R: ATTGCGCAGTGTGTCGAGTA.

[0063] SEQ ID NO: 39:

[0064] PD701-F: GGTGACTTATTGGAATTGGG.

[0065] SEQ ID NO: 40:

[0066] PD701-R: ATTAGTCTGCTAGGTTTGCA.

[0067] SEQ ID NO: 41:

[0068] PD703-F: AGAGTTCGGAATGGTAGTTT.

[0069] SEQ ID NO: 42:

[0070] PD703-R: CCATCAAAGAAATCACCCTC.

[0071] SEQ ID NO: 43:

[0072] PD806-F: CACCTATTCTTTTCGTCCAC.

[0073] SEQ ID NO: 44:

[0074] PD806-R:GGTTACATGCCCTGAAATAG.

[0075] SEQ ID NO: 45:

[0076] PD810-F:GCCAATCACACAATTTATGC.

[0077] SEQ ID NO: 46:

[0078] PD810-R: TGGAAAGAAGGATTTACGGT.

[0079] Compared with the existing technology, this solution has the following beneficial effects:

[0080] 1. The present invention uses large fragment structural variation to develop 23 molecular markers, which can be detected using ordinary agarose gel. It is safe and non-toxic, easy to operate and quick. Each chromosome of garlic contains at least 2 molecular markers, and each site has 3 possibilities (AA, Aa and aa), totaling 3 23 = 94143178827 genotypes, theoretically representing nearly all existing garlic germplasm resources, allowing the construction of a representative garlic molecular ID. This garlic molecular ID, based on SV molecular markers, enables identification of the genetic relationships of different garlic varieties, providing technical support for research on core garlic germplasm resources, garlic germplasm innovation, and variety breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1 This is the agarose gel electrophoresis result of PCR detection of As005 garlic material by 23 pairs of SV molecular markers in Example 3 of the present invention;

[0082] Figure 2 This is the agarose gel electrophoresis result of PCR detection of As024 garlic material by 23 pairs of SV molecular markers in Example 3 of the present invention;

[0083] Figure 3 This is the agarose gel electrophoresis result of PCR detection of As063 garlic material by 23 pairs of SV molecular markers in Example 3 of the present invention;

[0084] Figure 4This is the agarose gel electrophoresis result of PCR detection of As203 garlic material by 23 pairs of SV molecular markers in Example 3 of the present invention;

[0085] Figure 5 This is the agarose gel electrophoresis result of PCR detection of As267 garlic material using 23 pairs of SV molecular markers in Example 3 of the present invention. DETAILED DESCRIPTION

[0086] In order to enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0087] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0088] Example 1: Development of molecular markers

[0089] In this example, molecular marker primers were designed by screening sites with chromosome structural differences greater than 50 bp in the results of garlic whole genome resequencing. After PCR detection and verification, a total of 23 pairs of garlic SV molecular marker primers were screened and named PD118, PD119, PD124, PD130, PD213, PD216, PD219, PD223, PD301, PD312, PD315, PD408, PD412, PD414, PD506, PD509, PD510, PD607, PD609, PD701, PD703, PD806, and PD810, respectively. Among them, the amplification position of PD118, PD119, PD124, and PD130 primers is located at chromosome 1. The amplification position of primers PD213, PD216, PD219, and PD223 is located on chromosome 2 (As2), the amplification position of primers PD301, PD312, and PD315 is located on chromosome 3 (As3), the amplification position of primers PD408, PD412, and PD414 is located on chromosome 4 (As4), the amplification position of primers PD506, PD509, and PD510 is located on chromosome 5 (As5), the amplification position of primers PD607 and PD609 is located on chromosome 6 (As6), the amplification position of primers PD701 and PD703 is located on chromosome 7 (As7), and the amplification position of primers PD806 and PD810 is located on chromosome 8 (As8). The base sequences of the corresponding primers are shown in Table 1:

[0090] Table 1 Sequences of 23 pairs of SV molecular marker primers in garlic

[0091]

[0092] Example 2: Method for constructing molecular ID cards for different garlic varieties

[0093] The method for constructing molecular ID cards of different garlic varieties in this embodiment includes the following steps:

[0094] (1) Adoption The Plant Genomic DNA Isolation Kit (Plus) was used to extract total DNA from garlic samples of different varieties to be tested. The specific extraction steps were as follows: 2 cm fresh garlic leaves were placed in a 2 mL centrifuge tube, two steel balls were added, and the mixture was ground on a liquid nitrogen grinder at 65 Hz for 40 s; 400 μL YPA Buffer and 6 μL RNase A (10 mg / ml) were added in sequence, vortexed for 1 min, and allowed to stand at room temperature for 10 min to fully lyse the mixture; 130 μL YPB Buffer was added, mixed, and vortexed for 1 min; centrifuged at 12,000 rpm for 5 min, and the supernatant was transferred to a new centrifuge tube; 1.5 volumes of YPC Buffer were added and mixed thoroughly; the entire solution was added to an adsorption column (Pure Columns YM) loaded in a collection tube, which could be transferred multiple times, centrifuged at 12,000 rpm for 1 min, the waste liquid was discarded, and the adsorption column was returned to the tube; 500 μL Wash Buffer was added to the adsorption column GB, centrifuge at 12000rpm for 1min, discard the waste liquid in the tube, put the adsorption column back into the collection tube, and repeat this step once; centrifuge at 12000rpm for 2min, discard the waste liquid in the collection tube, and place the adsorption column at room temperature for several minutes to completely dry; place the adsorption column in Nuclease-free Centrifuge Tubes (1.5ml), add 50-100μL YGEBuffer to the middle part of the adsorption column, place it at room temperature for 2-5min, centrifuge for 1min, collect the solution, and store it at -20℃ for a long time.

[0095] (2) PCR amplification was performed using the total DNA of different garlic varieties as templates using the primers listed in Table 1. The PCR reaction system consisted of 20 μL of 2×SevenBasis Taq PCR Mix (10 μL), ddH₂O (7 μL), forward and reverse primers F / R (1 / 1 μL), and DNA template (1 μL). The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min and 10 min at 10°C.

[0096] (3) Detect the PCR amplification products by agarose gel electrophoresis.

[0097] (4) PCR product assignment: The product amplified at each site was assigned a value of "0", "1" or "2" according to the long, short or heterozygous state of the band type. By assigning values ​​to the 23 amplified products, a garlic molecular ID card containing 23 numbers was constructed according to the chromosome sequence; among them, the bands amplified by the PD118 primer were 307 bp and 248 bp respectively, the bands amplified by the PD119 primer were 346 bp and 274 bp respectively, and the bands amplified by the PD124 primer were 321 bp and 269 bp respectively. The bands amplified by PD130 primers were 308 bp and 211 bp, respectively; the bands amplified by PD213 primers were 386 bp and 249 bp, respectively; the bands amplified by PD216 primers were 302 bp and 229 bp, respectively; the bands amplified by PD219 primers were 282 bp and 222 bp, respectively; the bands amplified by PD223 primers were 373 bp and 301 bp, respectively; the bands amplified by PD301 primers were 298 bp and 241 bp, respectively; the bands amplified by PD312 primers were 379 bp and 282bp, the bands amplified by PD315 primers were 363bp and 296bp respectively, the bands amplified by PD408 primers were 360bp and 296bp respectively, the bands amplified by PD412 primers were 453bp and 383bp respectively, the bands amplified by PD414 primers were 321bp and 262bp respectively, the bands amplified by PD506 primers were 355bp and 263bp respectively, the bands amplified by PD509 primers were 358bp and 265bp respectively, and the bands amplified by PD510 primers were 330bp and 330bp respectively. The bands amplified by PD607 primers were 205bp and 136bp respectively, the bands amplified by PD609 primers were 441bp and 381bp respectively, the bands amplified by PD701 primers were 412bp and 351bp respectively, the bands amplified by PD703 primers were 439bp and 378bp respectively, the bands amplified by PD806 primers were 488bp and 378bp respectively, and the bands amplified by PD810 primers were 373bp and 309bp respectively.

[0098] Example 3: Accuracy verification and application experiment of molecular markers

[0099] In this example, the experimental materials As005, As024, As063, As203, and As267 were derived from the Key Laboratory of Vegetable Germplasm Innovation and Genetic Improvement of Hubei Province. The specific variety names and sources are shown in Table 2. At the same time, in this example, the 23 garlic SV molecular markers in Example 1 were specifically used to identify 5 different garlic varieties according to the method described in Example 2. The PCR amplification products were subjected to agarose gel electrophoresis for identification. Figures 1-5 The molecular IDs of the five garlic varieties are shown in Table 2:

[0100] Table 25 Garlic Varieties Names, Origins and Molecular Identification

[0101] Variety No. Variety Name Variety Source Molecular ID As005 Nanzhang garlic Nanzhang County, Xiangyang City, Hubei Province 00000001000111100011110 As024 Detoxified garlic Xuzhou Agricultural Academy, Jiangsu Province 11111110111010011110001 As063 Tang garlic Gucheng County, Xiangyang City, Hubei Province 10110010111000011100001 As203 Product 407 Xuzhou Agricultural Academy, Jiangsu Province 20112010111002221101101 As267 SA721 Chinese Academy of Agricultural Sciences, Vegetable and Flower Research Institute 22111110111002211121001

[0102] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the embodiments as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. An SV molecular marker primer for constructing a garlic molecular identity card, characterized in that: The SV molecular marker primers include at least the following 23 pairs of primers: PD118, PD119, PD124, PD130, PD213, PD216, PD219, PD223, PD301, PD312, PD315, PD408, PD412, PD414, PD506, PD509, PD510, PD607, PD609, PD701, PD703, PD806, PD810; The forward primer sequence of PD118 is shown in SEQ ID NO: 1, and the reverse primer sequence of PD118 is shown in SEQ ID NO: 2; the forward primer sequence of PD119 is shown in SEQ ID NO: 3, and the reverse primer sequence of PD119 is shown in SEQ ID NO: 4; the forward primer sequence of PD124 is shown in SEQ ID NO: 5, and the reverse primer sequence of PD124 is shown in SEQ ID NO: 6; the forward primer sequence of PD130 is shown in SEQ ID NO: 7, and the reverse primer sequence of PD130 is shown in SEQ ID NO: 8; the forward primer sequence of PD213 is shown in SEQ ID NO: 9, and the reverse primer sequence of PD213 is shown in SEQ ID NO: 10; the forward primer sequence of PD216 is shown in SEQ ID NO: 11, and the reverse primer sequence of PD216 is shown in SEQ ID NO: 12; the forward primer sequence of PD219 is shown in SEQ ID NO: 13, and the reverse primer sequence of PD219 is shown in SEQ ID NO: NO: 14; the forward primer sequence of PD223 is shown in SEQ ID NO: 15, and the reverse primer sequence of PD223 is shown in SEQ ID NO: 16; the forward primer sequence of PD301 is shown in SEQ ID NO: 17, and the reverse primer sequence of PD301 is shown in SEQ ID NO: 18; the forward primer sequence of PD312 is shown in SEQ ID NO: 19, and the reverse primer sequence of PD312 is shown in SEQ ID NO: 20; the forward primer sequence of PD315 is shown in SEQ ID NO: 21, and the reverse primer sequence of PD315 is shown in SEQ ID NO: 22; the forward primer sequence of PD408 is shown in SEQ ID NO: 23, and the reverse primer sequence of PD408 is shown in SEQ ID NO: 24; the forward primer sequence of PD412 is shown in SEQ ID NO: 25, and the reverse primer sequence of PD412 is shown in SEQ ID NO: 26; the forward primer sequence of PD414 is shown in SEQ ID NO: 27, and the reverse primer sequence of PD414 is shown in SEQ ID NO: NO: 28; the forward primer sequence of PD506 is shown in SEQ ID NO: 29, and the reverse primer sequence of PD506 is shown in SEQ ID NO: 30; the forward primer sequence of PD509 is shown in SEQ ID NO: 31, and the reverse primer sequence of PD209 is shown in SEQ ID NO: 32; the forward primer sequence of PD510 is shown in SEQ ID NO: 33, and the reverse primer sequence of PD510 is shown in SEQ ID NO: 34; the forward primer sequence of PD607 is shown in SEQ ID NO: 35, and the reverse primer sequence of PD607 is shown in SEQ ID NO: 36; the forward primer sequence of PD609 is shown in SEQ ID NO: 37, and the reverse primer sequence of PD609 is shown in SEQ ID NO: 38;The forward primer sequence of PD701 is shown in SEQ ID NO: 39, and the reverse primer sequence of PD701 is shown in SEQ ID NO: 40; the forward primer sequence of PD703 is shown in SEQ ID NO: 41, and the reverse primer sequence of PD703 is shown in SEQ ID NO: 42; the forward primer sequence of PD806 is shown in SEQ ID NO: 43, and the reverse primer sequence of PD806 is shown in SEQ ID NO: 44; the forward primer sequence of PD810 is shown in SEQ ID NO: 45, and the reverse primer sequence of PD810 is shown in SEQ ID NO:

46.

2. A method for constructing molecular identification cards of different garlic varieties using the PCR detection results of the SV molecular marker primers as claimed in claim 1, characterized in that: The following steps are involved: S1. Extract the total DNA of the garlic sample to be tested; S2, using the total DNA of the garlic sample to be tested as a template, using the SV molecular marker primers to perform PCR amplification, and performing agarose gel electrophoresis detection; S3. The products amplified by each pair of primers are assigned values ​​of "0", "1" or "2" according to the long, short or heterozygous states of the band patterns, and a garlic molecular ID card containing 23 numbers is constructed according to the chromosome sequence.

3. A kit for constructing a garlic molecular identity card, characterized in that: The kit comprises the SV molecular marker primers according to claim 1.

4. Use of the SV molecular marker primers as claimed in claim 1 or the kit as claimed in claim 3 in constructing a garlic molecular identity card.

Images