A colorimetric-fluorescence dual signal detection method for Salmonella based on multivalent aptamers and CHA amplification

Abstract

The present invention discloses a method for colorimetric-fluorescent dual-signal detection of Salmonella based on multivalent aptamers and CHA amplification, which is characterized by including the steps of preparing a multivalent aptamer competitive probe solution by mixing single-stranded S1, single-stranded S2, single-stranded S3, single-stranded S4, Salmonella aptamer and cDNA; dissolving hairpin probe H1 and hairpin probe H2 in PBS buffer respectively; mixing the Salmonella solution to be detected with the multivalent aptamer competitive probe, incubating for 1 hour, adding hairpin probe H1 and hairpin probe H2 for CHA amplification reaction, and then adding hemin solution, H2O2 solution and ABTS 2‑ solution for peroxidase-catalyzed reaction, and respectively performing colorimetric and fluorometric detections to calculate the concentration of Salmonella in the solution to be detected. The advantages are simple, rapid, high sensitivity, strong specificity and high accuracy.

Description

Technical Field

[0001] The invention relates to a method for detecting Salmonella, in particular to a method for detecting Salmonella by using colorimetric-fluorescence dual signals based on multivalent aptamers and CHA amplification. Background Art

[0002] Salmonella is a common foodborne pathogen that is widely found in a variety of foods such as meat, vegetables, egg products and dairy products, posing a great threat to human health and life safety. Rapid and accurate detection of Salmonella in food plays an important role in timely detection and prevention of foodborne diseases caused by Salmonella. Commonly used methods for detecting Salmonella include plate colony count method, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR). Among them, the plate colony count method is accurate and sensitive but time-consuming and cumbersome to operate; the ELISA method has strong specificity but has disadvantages such as difficulty in antibody preparation and purification; the PCR method has the characteristics of high sensitivity, but the operation process is complicated and easily contaminated.

[0003] Aptamers are oligonucleotide sequences or short polypeptides obtained through in vitro screening techniques, usually composed of DNA or RNA. Aptamers have the characteristics of high stability, easy modification and coupling, and low immunogenicity, which makes them have broad application prospects in the biomedical field. However, due to the less than ideal affinity of aptamers, most aptamer sensors need to obtain ideal sensitivity through complex signal amplification strategies such as nanomaterials, nucleic acid signal amplification, cascade enzyme catalytic reactions, etc. In recent years, DNA nanoprogrammed multivalent aptamers have played a great role in improving the affinity of aptamers and have attracted widespread attention in the fields of bacterial detection, medical imaging, diagnosis and treatment.

[0004] The colorimetric method has the advantages of simple operation, low cost, and easy observation, and has been widely used in the rapid detection of pathogenic bacteria. In addition, the fluorescence method is another most commonly used optical detection method with the characteristics of high sensitivity. Therefore, the development of a fluorescence / colorimetric dual-signal detection method can effectively improve the detection sensitivity, and at the same time, through the self-correction of the two methods, the results are more reliable. At present, there are no related research reports on the method of colorimetric-fluorescence dual-signal detection of Salmonella based on multivalent aptamers and CHA amplification at home and abroad. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a method for detecting Salmonella with colorimetric-fluorescent dual signals based on multivalent aptamers and CHA amplification with high sensitivity, strong specificity and high accuracy.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: a method for detecting Salmonella by colorimetric-fluorescent dual signals based on multivalent aptamers and CHA amplification, which is not intended for diagnosis or treatment, and comprises the following steps:

[0007] Step 1: Synthesis of aptamer competitive probe:

[0008] 25 µM single-stranded S1 solution, 25 µM single-stranded S2 solution, 25 µM single-stranded S3 solution, 25 µM single-stranded S4 solution, 10 µM Salmonella aptamer solution, 10 µM cDNA solution and TM buffer were mixed in a volume ratio of 1:1:1:1:10:10:26 and then annealed to obtain a multivalent aptamer competitive probe solution; wherein the nucleotide sequence of the single-stranded S1 is shown in SEQ ID NO.1: 5'-TCGATGACCCACTCTCACTTACACTTCCTACAGTCTGAAACATCTACAGCTCTGCTACACGAGAGATGCACGCACATAGTA-3';

[0009] The nucleotide sequence of the single-stranded S2 is shown in SEQ ID NO.2: 5'-TCGATGACCCACTCTCACTTTATCACCAGGTCAGTCTGACAGTGTAGCAGAGCTGTAGATAGATGCTGAGGAGTCCAATAC-3';

[0010] The nucleotide sequence of the single-stranded S3 is shown in SEQ ID NO.3: 5'-TCGATGACCCACTCTCAC TTTCAGACTGACCTGGTGATAAAACGACACTGACGTGGTGAATCTACTATGTGCGTGCATCTC-3';

[0011] The nucleotide sequence of the single-stranded S4 is shown in SEQ ID NO.4: 5'-TCGATGACCCACTCTCAC TTTTCAGACTGTAGGAAGTGTGCTTCACCACGTCAGTGTCGTTTGTATTGGACTCCTCAGCAT-3';

[0012] The nucleotide sequence of the Salmonella aptamer is shown in SEQ ID NO.5: 5'-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTT TG ATCACTATTGGGCCTTTCTGATGTCGGTAGT-3';

[0013] The nucleotide sequence of the cDNA is shown in SEQ ID NO.6: 5'-CAAACCACCGTGGTTACAGT-3';

[0014] Step 2: Preparation of hairpin probe:

[0015] The hairpin probe H1 is dissolved in PBS buffer and then annealed to obtain a H1 solution with a concentration of 1.5 μM; the hairpin probe H2 is dissolved in PBS buffer and then annealed to obtain a H2 solution with a concentration of 1 μM, wherein the nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO.7: 5'-FAM-ACCGTGGTTACAGTGGGTGGGTGGGGTCGACTGTAACCACGGTGGTT-BHQ-3', and the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO.8: 5'-TGGGTGGGTGGGTGGGTCGAACCACCGTGGTTACAGTCGACCCCACCCACCCACTGT-3';

[0016] Step 3: Fluorescence detection of Salmonella:

[0017] Add the sample to be tested to the multivalent aptamer competitive probe solution prepared in step 1, incubate at room temperature for 1 hour, then add the 1.5 μM H1 solution and 1 μM H2 solution prepared in step 2, incubate at room temperature for 30 minutes to perform CHA reaction, obtain CHA reaction product, record the generated fluorescence signal in the wavelength range of 510 nm to 550 nm with a microplate reader, and calculate the concentration of Salmonella in the sample to be tested based on the quantitative relationship between the fluorescence intensity and the concentration of Salmonella;

[0018] Step 4: Colorimetric detection of Salmonella:

[0019] Add 0.1 mM heme solution, 50 mM H2O2 solution and 50 μM 2,2'-hydrazinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) to the CHA reaction product obtained in step 3. 2- ) solution for peroxidase catalyzed reaction, the absorbance was measured at 450 nm with an enzyme reader, and the concentration of Salmonella in the sample to be tested was calculated based on the quantitative relationship between the absorbance value and the concentration of Salmonella.

[0020] Furthermore, the annealing process described in step 1 and step 2 is heating at 95° C. for 4 minutes and rapidly cooling to 4° C. and maintaining for 1 minute.

[0021] Further, the sample to be tested, the multivalent aptamer competitive probe solution, the H1 solution, the H2 solution, the heme solution, the H2O2 solution and the ABTS solution in step 3 and step 4 are 2- The volume ratio of the solution is 200:20:2.5:2.5:0.96:1.2:1.2.

[0022] Principle of the invention: The mechanism of the fluorescence-colorimetric dual-mode method for detecting Salmonella based on multivalent aptamer competitive probes and CHA amplification is as follows Figure 1 As shown. A tetrahedral DNA scaffold is formed by self-assembly of four carefully designed single DNA strands, and four extended chains (blue) extend from the vertices, where specific aptamers that bind to the target Salmonella are attached to form a tetrahedral DNA nanostructure bound to multivalent aptamers. Subsequently, the complementary DNA fragments (cDNA) of the Salmonella aptamers are further hybridized and used to prepare multivalent aptamer competitive probes. In the presence of Salmonella, the affinity of the multivalent aptamers attached to the surface for binding to the bacteria is enhanced, releasing a large number of cDNA fragments that are able to trigger the subsequent CHA reaction. In the CHA system, the H1 hairpin is a fluorescence quenching probe, and FAM and BHQ1 are modified at its 3' and 5' ends respectively. The released cDNA opens the H1 hairpin through hybridization, so that the quenching group and the fluorescent group at both ends of H1 are separated, generating a fluorescent signal; then, the opened H1 hybridizes with H2, so that the G-rich DNA sequence in H2 is released, which combines with heme to form a DNA enzyme with peroxidase activity, catalyzing the substrate (H2O2 and 2,2'-aminobis(3-ethylbenzothiazoline-6-sulfonic acid)ABTS 2- ) to generate a colorimetric signal. The free cDNA enters the next round of CHA, thereby completing the simultaneous amplification of fluorescence and colorimetric signals. Therefore, based on the dual-round signal amplification and dual-mode readout method, sensitive and accurate detection of Salmonella can be achieved.

[0023] Compared with the prior art, the advantages of the present invention are:

[0024] 1. The multivalent aptamer competitive probe in the present invention is a rigid planar nanostructure synthesized by a one-step method. The aptamer constructed with a tetrahedron as a skeleton has better affinity and specificity.

[0025] 2. The method based on CHA amplification in the present invention carries both fluorescent groups and quenching groups on the CHA hairpin, as well as a G-rich DNA sequence, as a medium for converting bacterial signals into colorimetric signals and fluorescent signals, thereby realizing colorimetric and fluorescent dual signal output for detecting Salmonella; colorimetric detection has poor sensitivity and is easily interfered by changes in operating conditions and biological environment. However, fluorescent detection exhibits higher sensitivity and resistance to external interference. Therefore, the dual signals complement each other to improve the sensitivity, stability and accuracy of detection.

[0026] In summary, the fluorescence-colorimetric dual signal detection method based on multivalent aptamers and CHA amplification of the present invention uses multivalent aptamer competitive probes to specifically bind to Salmonella, and the released cDNA triggers the CHA system to generate fluorescent signals and release the blocked G-quadruplexes at the same time, which catalyzes the substrate ABTS 2- The colorimetric signal is generated to achieve rapid detection of Salmonella in milk, eggs, cod and chicken. Therefore, this method has broad prospects in food safety monitoring, clinical diagnosis and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the principle of colorimetric-fluorescent dual signal detection of Salmonella based on multivalent aptamers and CHA amplification in specific embodiment 1;

[0028] Figure 2 It is an agarose gel electrophoresis diagram of the multivalent aptamer competitive probe in the second specific embodiment, wherein 1 is Maker, 2 is Salmonella aptamer, 3 is cDNA, 4 is Salmonella aptamer-cDNA, 5 is tetrahedron, and 6 is the multivalent aptamer competitive probe;

[0029] Figure 3 The fluorescence detection result of the feasibility of catalytic hairpin self-assembly in specific embodiment 3;

[0030] Figure 4 The colorimetric detection result of the feasibility of catalytic hairpin self-assembly in specific embodiment 3;

[0031] Figure 5 is the linear relationship between fluorescence intensity and Salmonella concentration in specific embodiment 4;

[0032] Figure 6 is the linear relationship between the absorbance value and the Salmonella concentration in the specific embodiment 4;

[0033] Figure 7 The specific experimental results of the fluorescence method for detecting Salmonella based on multivalent aptamers and CHA amplification in specific embodiment 5;

[0034] Figure 8The specific experimental results of the colorimetric method for detecting Salmonella based on multivalent aptamers and CHA amplification in the fifth specific embodiment;

[0035] Fig. 9 The linear correlation analysis result between the fluorescence signal and the colorimetric signal of the dual-signal detection method for Salmonella based on multivalent aptamers and CHA amplification in specific embodiment 6;

[0036] Fig.10 The results of the fluorescent method based on multivalent aptamers and CHA amplification for detecting Salmonella in milk, cod, eggs and chicken in Specific Example 7;

[0037] Fig.11 The results of the colorimetric method based on multivalent aptamers and CHA amplification for detecting Salmonella in milk, cod, eggs and chicken in Specific Example 7 are shown. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below with reference to the accompanying drawings.

[0039] Specific embodiment 1: A method for detecting Salmonella by colorimetric-fluorescent dual signals based on multivalent aptamers and CHA amplification, such as Figure 1 As shown, the specific steps are as follows:

[0040] Step 1: Synthesis of multivalent aptamer competitive probes:

[0041] 0.4 μL of 25 μM solution of four single-stranded DNAs (single-strand S1, single-strand S2, single-strand S3, single-strand S4), 4 μL of 10 μM Salmonella aptamer solution and 4 μL of 10 μM cDNA solution were mixed in 10.4 μL TM buffer (50 mM MgCl2 and 20 mM Tris-HCl, pH 8.0), and then the solution was annealed to obtain a multivalent aptamer competitive probe solution, wherein the annealing process was heating at 95°C for 4 minutes and rapidly cooling to 4°C for 1 minute. The sequences of the four single-stranded DNAs are as follows:

[0042] The nucleotide sequence of single-stranded S1 is shown in SEQ ID NO.1: 5'- TCGATGACCCACTCTCAC TTA CACTTCCTACAGTCTGAAACATCTACAGCTCTGCTACACGAGAGATGCACGCACATA GTA-3′ (the underlined part is the part complementary to the aptamer);

[0043] The nucleotide sequence of single-stranded S2 is shown in SEQ ID NO.2: 5'- TCGATGACCCACTCTCACTTTATCACCAGGTCAGTCTGACAGTGTAGCAGAGCTGTAGATAGATGCTGAGGAGTCCAATAC-3′ (the underlined part is the part complementary to the aptamer);

[0044] The nucleotide sequence of single-stranded S3 is shown in SEQ ID NO.3: 5'- TCGATGACCCACTCTCAC TTTCAGACTGACCTGGTGATAAAACGACACTGACGTGGTGAATCTACTATGTGCGTGCATCTC-3′ (the underlined part is the part complementary to the aptamer);

[0045] The nucleotide sequence of single-stranded S4 is shown in SEQ ID NO.4: 5'- TCGATGACCCACTCTCAC TTTTCAGACTGTAGGAAGTGTGCTTCACCACGTCAGTGTCGTTTGTATTGGACTCCTCAGCAT-3′ (the underlined part is the part complementary to the aptamer);

[0046] The nucleotide sequence of the Salmonella aptamer is shown in SEQ ID NO.5: 5'- GTGAGAGTGGGTCATCGA AAAAACTCCTCTG ACTGTAACCACGGTGGTTTG ATCACTATTGGGCCTTTCTGATGTCGGTAGT-3' (the underlined part in front is the part complementary to the four single-stranded DNAs; the underlined part in the back is the part complementary to the cDNA);

[0047] The nucleotide sequence of cDNA is shown in SEQ ID NO.6: 5'-CAAACCACCGTGGTTACAGT-3'.

[0048] Step 2: Preparation of hairpin probe:

[0049] The hairpin probe H1 was dissolved in PBS buffer and annealed (denatured at 95°C for 10 minutes and then gradually cooled to room temperature within 4 hours) to obtain a H1 solution with a concentration of 1.5 μM; the hairpin probe H2 was dissolved in PBS buffer and annealed (denatured at 95°C for 10 minutes and then gradually cooled to room temperature within 4 hours) to obtain a H2 solution with a concentration of 1 μM, wherein the nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO.7: 5'-FAM-ACCGTGGTTACAGTGGGTGGGTGGGGTCGACTGTAACCACGGTGGTT-BHQ-3', and the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO.8: 5'- TGGGTGGGTGGGTGGGTCGAACCACCGTGGTTACAGTCGACCCCACCCACCCACTGT-3' (the underlined part is the quadruplex sequence, referred to as G sequence for short).

[0050] Step 3: Fluorescence detection of Salmonella:

[0051] Take 200 μL of the sample to be tested and add it to the 20 μL multivalent aptamer competitive probe solution prepared in step 1, incubate at room temperature for 1 hour, then add 2.5 μL 1.5 μM H1 solution and 2.5 μL 1 μM H2 solution prepared in step 2, incubate at room temperature for 30 minutes for CHA reaction, obtain CHA reaction product, record the generated fluorescence signal in the wavelength range of 510 nm to 550 nm with an ELISA reader, and calculate the concentration of Salmonella in the sample to be tested based on the quantitative relationship between fluorescence intensity and Salmonella concentration. In the CHA reaction system, the H1 hairpin is a fluorescence quenching probe, and FAM and BHQ1 are modified at its 3' and 5' ends respectively. The released cDNA opens the H1 hairpin by hybridization, so that the quenching group and the fluorescent group at both ends of H1 are separated, thereby generating a fluorescence signal.

[0052] Step 4: Colorimetric detection of Salmonella:

[0053] Add 0.96 μL of 0.1 mM heme solution, 1.2 μL of 50 mM H2O2 solution and 1.2 μL of 50 μM 2,2'-hydrazinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) to the CHA reaction product obtained in step 3. 2- ) solution for peroxidase catalytic reaction, and measure its absorbance at 450 nm with a microplate reader. According to the quantitative relationship between the absorbance and the concentration of Salmonella, the concentration of Salmonella in the sample to be tested is calculated. In the CHA reaction system, the opened H1 hybridizes with H2, releasing the G-rich quadruplex sequence in H2, which combines with heme to form a DNA enzyme with peroxidase activity, catalyzing the substrate H2O2 and ABTS 2- To generate a colorimetric signal.

[0054] Specific Example 2: Verify the successful synthesis of the multivalent aptamer competitive probe in step 1 of Specific Example 1.

[0055] In order to intuitively characterize the formation of multivalent aptamer-based competitive probes, 3 µL of Salmonella aptamer solution (prepared by diluting the 10 µM Salmonella aptamer solution after annealing with PBS buffer to 1 µM), 3 µL of cDNA solution (concentration of 1 µM, solvent is PBS buffer), 3 µL of Salmonella aptamer-cDNA mixed solution (prepared by mixing 1.5 µL of 1 µM Salmonella aptamer solution with 1.5 µL of 1 µM cDNA solution and then annealing), 3 µL of tetrahedral sequence solution (mixing 0.8 µL of 25 µM four single-stranded DNAs (single-strand S1, single-strand S2, single-strand S3, single-strand S4) and then annealing), and 3 µL of the multivalent aptamer competitive probe solution synthesized in step 1 of specific embodiment 1 were sequentially added to 1wt% agarose gel electrophoresis for separation (stained with GelRed nucleic acid dye, electrophoresis buffer is 1×TAE, 130V). Constant pressure for 30 minutes) and observed by imaging on a gel imager. Figure 2 It can be seen that with the increase of DNA chains, the migration speed of the band gradually decreases, which indicates the successful formation of multivalent aptamer competitive probes.

[0056] Specific Example 3: Verify the feasibility of catalyzing hairpin self-assembly in step 3 of Specific Example 1.

[0057] 1. The feasibility of catalytic hairpin self-assembly was verified by fluorescence method. The experimental group was designed as follows:

[0058] a: 2.5 µl of 1.5 µM H1 solution;

[0059] b: 2.5 µl of 1.5 µM H1 solution was mixed with 2.5 µl of 1 µM H2 solution;

[0060] c: 2.5 µl of 0.5 µM cDNA solution was mixed with 2.5 µl of 1.5 µM H1 solution;

[0061] d: Mix 2.5 µl of 0.5 µM cDNA solution, 2.5 µl of 1.5 µM H1 solution, and 2.5 µL of 1 µM H2 solution.

[0062] After the a, b, c, and d groups were left to stand for 30 minutes, the fluorescence was observed using a blue light meter, and the fluorescence value was measured at 510 nm to 550 nm using an enzyme marker. Figure 3It can be seen that the fluorescence value of H1 alone is very low, indicating that the structure of H1 is stable. When H2 is added, the fluorescence value increases slightly, but no obvious change can be observed by the naked eye, indicating that H2 cannot open H1. When cDNA is added to H1, the fluorescence value increases significantly, indicating that cDNA opens H1 to produce a fluorescent signal. When the three are mixed, the fluorescence value increases further, indicating that the CHA reaction is triggered and signal amplification is achieved.

[0063] 2. The feasibility of catalytic hairpin self-assembly was verified by colorimetry. The experimental group was designed as follows:

[0064] a: 2.5 μL of 1 μM H2 solution;

[0065] b: 2.5 μL of 1.5 μM H1 solution was mixed with 2.5 μL of 1 μM H2 solution;

[0066] c: 2.5 μL of 0.5 μM cDNA solution was mixed with 2.5 μL of 1 μM H2 solution;

[0067] d: 2.5 μL of 0.5 μM cDNA solution, 2.5 μL of 1.5 μM H1 solution and 2.5 μL of 1 μM H2 solution were mixed.

[0068] After the a, b, c, and d groups were left to stand for 30 minutes, 0.96 μL of 0.1 mM heme, 1.2 μL of 50 mM H2O2, and 1.2 μL of 50 μM ABTS were added. 2- Catalytic reaction was carried out, the color was observed by naked eyes, and the absorbance was measured at 450 nm using an enzyme marker. Figure 4 It can be seen that the absorbance is very low when only H2 is present, indicating that H2 alone is very stable. When cDNA is added, the absorbance is basically the same as H2, indicating that cDNA cannot open H2. When H1 is added to H2, the absorbance increases slightly, but no obvious change can be observed with the naked eye, indicating that H1 cannot open H2. When the three are mixed, the absorbance increases, indicating that only when cDNA, H1 and H2 are present at the same time can the CHA reaction be triggered and the signal amplified.

[0069] Specific embodiment 4: The sensitivity of Salmonella was determined by the method of specific embodiment 1.

[0070] 1. Bacterial culture: Inoculate the frozen Salmonella into BHI liquid culture medium and culture at 37℃ for 20 hours. Centrifuge 1 mL of the bacterial solution at 6000 rpm for 8 min. Remove the supernatant and wash once with PBS buffer. Finally, redissolve the precipitate in 1 mL of PBS buffer and store at 4℃ for later use.

[0071] 2. Fluorescence detection: 200 μL of a series of different concentrations of Salmonella solution were added to 20 μL of multivalent aptamer competitive probe solution prepared in step 1 of specific embodiment 1, incubated at room temperature for 1 hour, then added 2.5 μL of 1.5 μM H1 solution and 2.5uL of 1 μM H2 solution prepared in step 2, and then incubated at room temperature for 30 minutes to perform CHA reaction to obtain CHA reaction product; the generated fluorescence signal was recorded with an ELISA instrument within the wavelength range of 510 nm to 550 nm, the fluorescence intensity corresponding to different concentrations of Salmonella was measured, and the fluorescence intensity-Salmonella concentration curve was plotted. The results are as follows: Figure 5 As shown, the linear equation is y = 1E6x + 787366, the correlation coefficient is R = 0.9855, the linear relationship is good, the detection limit is 28 CFU / mL, and it can be used for the detection of Salmonella of unknown concentration.

[0072] 3. Colorimetric detection: Add 0.96 μL 0.1 mM hemoglobin, 1.2 μL 50 mM H2O2 and 1.2 μL 50 μM ABTS to the CHA reaction product. 2- The peroxidase-catalyzed reaction was carried out, and its absorbance was measured at 450 nm using an enzyme reader. The absorbance values ​​corresponding to different concentrations of Salmonella were determined, and the absorbance value-Salmonella concentration curve was drawn. Figure 6 As shown, the linear equation is y = 0.03686x + 0.0898, and the correlation coefficient is R = 0.9891. The linear relationship is good, and the detection limit is 10 CFU / mL, which can be used for the detection of Salmonella of unknown concentration.

[0073] Specific Example 5: The specific experiment of Salmonella was carried out using the method of Specific Example 1.

[0074] 1. Fluorescence detection: 10 6 CFU / mL Vibrio parahaemolyticus ( V. parahaemolyticus), 10 6 CFU / mL Vibrio alginolyticus ( V. alginolyticus), 10 6 CFU / mL Vibrio vulnificus ( V. vulnificus), 10 6 CFU / mL Staphylococcus aureus ( S .aureus), 10 6 CFU / mL Listeria monocytogenes ( L .monocytogenes), 10 6 CFU / mL Escherichia coli (E .coli O157:H7), 10 6 CFU / mL Salmonella ( Salmonella ) and 10 6 The CFU / mL mixed bacterial solution (each of the above bacterial solutions was mixed in a volume ratio of 1:1:1:1:1:1:1) was subjected to fluorescence determination using the method of Specific Example 1. The results are shown in Figure 7 As shown, when Salmonella is present, the fluorescence intensity value detected is much higher than the fluorescence intensity value of interfering foodborne pathogens, indicating that the detection method is specific to Salmonella.

[0075] 2. Colorimetric detection: 10 6 CFU / mL Vibrio parahaemolyticus ( V. parahaemolyticus), 10 6 CFU / mL Vibrio alginolyticus ( V. alginolyticus), 10 6 CFU / mL Vibrio vulnificus ( V. vulnificus), 10 6 CFU / mL Staphylococcus aureus ( S .aureus), 10 6 CFU / mL Listeria monocytogenes ( L .monocytogenes), 10 6 CFU / mL Escherichia coli ( E .coli O157:H7), 10 6 CFU / mL Salmonella ( Salmonella ) and 10 6 The absorbance of the CFU / mL mixed bacterial solution (each of the above bacterial solutions was mixed in a volume ratio of 1:1:1:1:1:1:1) was measured using the method of Specific Example 1. The results are as follows Figure 8 As shown, when Salmonella is present, the absorbance value detected is much higher than the absorbance value of interfering foodborne pathogens, indicating that the detection method is specific to Salmonella.

[0076] Specific embodiment six: Linear correlation analysis between the fluorescence signal and the colorimetric signal in the method of specific embodiment one.

[0077] In order to evaluate the linear correlation between the fluorescence signal and the colorimetric signal in the method of the first embodiment, a series of Salmonella samples with different concentrations were designed, which were 10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6CFU / mL, 10 7 CFU / mL, and measure the fluorescence and colorimetric signals respectively by the method of Specific Example 1, and record the results. Then, the two detection results are analyzed by linear fitting method, and the Pearson's correlation coefficient (Pearson's r) is calculated to quantify the correlation between them.

[0078] The results are as follows Fig. 9 As shown, the correlation coefficient between the fluorescence reading and the colorimetric reading is 0.9836, showing a strong positive correlation, which indicates that the two detection methods are consistent over the entire concentration range. The experimental results show that the dual-mode detection of fluorescence and colorimetry in the method of the above-mentioned specific embodiment 1 can achieve sensitive, stable and accurate detection of the target substance, providing strong data support for its effectiveness in applications such as food testing.

[0079] Specific embodiment seven: verify the value of the method of specific embodiment one in practical applications.

[0080] Salmonella standard solution was added to milk, cod, chicken and eggs as actual samples, and the Salmonella in different samples was detected by the method of specific embodiment 1. The results are as follows: Fig.10 and Fig.11 shown.

[0081] Depend on Fig.10 It can be seen that the fluorescence signal is related to the Salmonella concentration (10 1 -10 7 The detection limits of fluorescence detection in milk, cod, chicken and eggs were 16, 32, 22 and 19 CFU / mL, respectively.

[0082] Depend on Fig.11 It can be seen that the absorbance value is related to the Salmonella concentration (10 1 -10 7 The detection limits of fluorescence detection in milk, cod, chicken and eggs were 35, 32, 34 and 33 CFU / mL, respectively.

[0083] Specific embodiment eight: verify the accuracy and stability of the method of specific embodiment one.

[0084] The method of the first specific embodiment was used to detect different concentrations of Salmonella in milk, cod, chicken and eggs, and the recovery rate was calculated. The results are shown in Tables 1 and 2.

[0085] Table 1 shows the recovery rates of different concentrations of Salmonella in milk, cod, chicken and eggs by fluorescence detection method

[0086]

[0087] As shown in Table 1, different concentrations (1 × 10 2 - 1 × 10 4 The average recoveries of Salmonella in 4000 CFU / mL (0.1447 W / mL) were 92.73%, 92.80%, 91.88% and 88.77%, respectively, indicating that the detection method has high accuracy and can be used for the detection of Salmonella in food samples.

[0088] Table 2 shows the recovery rates of Salmonella at different concentrations in milk, cod, chicken and eggs by colorimetric detection method

[0089]

[0090] As shown in Table 2, different concentrations (1 × 10 2 - 1 × 10 4 The average recoveries of Salmonella in 4000 CFU / mL (0.1447 W / mL) were 97.49%, 96.61%, 92.27% and 91.43%, respectively, indicating that the detection method has high accuracy and can be used for the detection of Salmonella in food samples.

[0091] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A method for detecting Salmonella by colorimetric-fluorescent dual signal based on multivalent aptamers and CHA amplification, which is not intended for diagnosis or treatment, and is characterized in that The following steps are involved: Step 1: Synthesis of aptamer competitive probe: 25 µM single-stranded S1 solution, 25 µM single-stranded S2 solution, 25 µM single-stranded S3 solution, 25 µM single-stranded S4 solution, 10 µM Salmonella aptamer solution, 10 µM cDNA solution and TM buffer were mixed in a volume ratio of 1:1:1:1:10:10:26 and then annealed to obtain a multivalent aptamer competitive probe solution; wherein The nucleotide sequence of the single-stranded S1 is shown in SEQ ID NO.1: 5'-TCGATGACCCACTCTCACTTACACTTCCTACAGTCTGAAACATCTACAGCTCTGCTACACGAGAGATGCACGCACATAGTA-3'; The nucleotide sequence of the single-stranded S2 is shown in SEQ ID NO.2: 5'-TCGATGACCCACTCTCACTTTATCACCAGGTCAGTCTGACAGTGTAGCAGAGCTGTAGATAGATGCTGAGGAGTCCAATAC-3'; The nucleotide sequence of the single-stranded S3 is shown in SEQ ID NO.3: 5'-TCGATGACCCACTCTCAC TTTCAGACTGACCTGGTGATAAAACGACACTGACGTGGTGAATCTACTATGTGCGTGCATCTC-3'; The nucleotide sequence of the single-stranded S4 is shown in SEQ ID NO.4: 5'-TCGATGACCCACTCTCAC TTTTCAGACTGTAGGAAGTGTGCTTCACCACGTCAGTGTCGTTTGTATTGGACTCCTCAGCAT-3'; The nucleotide sequence of the Salmonella aptamer is shown in SEQ ID NO.5: 5'-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT-3'; The nucleotide sequence of the cDNA is shown in SEQ ID NO.6: 5'-CAAACCACCGTGGTTACAGT-3'; Step 2: Preparation of hairpin probe: The hairpin probe H1 is dissolved in PBS buffer and then annealed to obtain a H1 solution with a concentration of 1.5 μM; the hairpin probe H2 is dissolved in PBS buffer and then annealed to obtain a H2 solution with a concentration of 1 μM, wherein the nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO.7: 5'-FAM-ACCGTGGTTACAGTGGGTGGGTGGGGTCGACTGTAACCACGGTGGTT-BHQ-3', and the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO.8: 5'-TGGGTGGGTGGGTGGGTCGAACCACCGTGGTTACAGTCGACCCCACCCACCCACTGT-3'; Step 3: Fluorescence detection of Salmonella: Add the sample to be tested to the multivalent aptamer competitive probe solution prepared in step 1, incubate at room temperature for 1 hour, then add the 1.5 μM H1 solution and 1 μM H2 solution prepared in step 2, incubate at room temperature for 30 minutes to perform CHA reaction, obtain CHA reaction product, record the generated fluorescence signal in the wavelength range of 510 nm to 550 nm with a microplate reader, and calculate the concentration of Salmonella in the sample to be tested based on the quantitative relationship between the fluorescence intensity and the concentration of Salmonella; Step 4: Colorimetric detection of Salmonella: Add 0.1 mM heme solution, 50 mM H2O2 solution and 50 μM ABTS to the CHA reaction product obtained in step 3. 2- The solution undergoes a peroxidase-catalyzed reaction, and the absorbance is measured at 450 nm using an enzyme reader. The concentration of Salmonella in the sample to be tested is calculated based on the quantitative relationship between the absorbance value and the concentration of Salmonella.

2. The method for detecting Salmonella by colorimetric-fluorescent dual signals based on multivalent aptamers and CHA amplification according to claim 1, which is not intended for diagnosis or treatment, and is characterized in that: The annealing process described in step 1 and step 2 is heating at 95° C. for 4 minutes and rapidly cooling to 4° C. for 1 minute.

3. The method for detecting Salmonella by colorimetric-fluorescent dual signals based on multivalent aptamers and CHA amplification according to claim 1, which is not intended for diagnosis or treatment, and is characterized in that: The sample to be tested in step 3 and step 4, the multivalent aptamer competitive probe solution, the H1 solution, the H2 solution, the heme solution, the H2O2 solution and the ABTS 2- The volume ratio of the solution is 200:20:2.5:2.5:0.96:1.2:1.2.

Images