Sandalwood saerf89 gene and its use in biosynthesis of (z)-alpha-trans-santalol

Abstract

The application discloses an application of a transcription factor coded by a sandalwood SaERF89 gene in biosynthesis of (Z)-alpha-trans-exo-bergamotol, and belongs to the technical field of biotechnology. The nucleotide sequence of the SaERF89 gene is shown in SEQ ID NO. 1, or is completely complementary to the sequence shown in SEQ ID NO. 1, or is a nucleotide sequence coding an amino acid sequence shown in SEQ ID NO. 2. The content of (Z)-alpha-trans-exo-bergamotol in the transgenic sandalwood callus is significantly improved, and a new method for efficient generation of (Z)-alpha-trans-exo-bergamotol is provided.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and specifically relates to a Santalum album SaERF89 gene and its application in biosynthesis of α-bisabolol. BACKGROUND

[0002] Santalum album is a famous aromatic plant, and its wood and essential oil are highly valued for their unique fragrance and multiple uses. Santalum album trees are mainly distributed in India, Australia and Southeast Asia, and are widely planted and researched due to their valuable economic and medicinal values. Santalum album wood and its essential oil have important applications in spices, medicine and cosmetics. Santalum album essential oil is a high-value spice extracted from Santalum album wood, with a warm, sweet, woody fragrance. Its fragrance is long-lasting and is often used as a base ingredient in high-end perfumes and aromatherapy products. Santalum album essential oil is widely used in cosmetics and skin care products due to its anti-inflammatory, antibacterial and moisturizing properties. Santalum album essential oil can relieve skin inflammation and promote cell regeneration, and is often found in products such as creams, lotions and body washes.

[0003] (Z)-α-exo-bergamotol belongs to the terpene class of compounds and is commonly found in the essential oils of certain plants. Its chemical structure makes it valuable in aromatherapy and the perfume industry. Specifically, (Z)-α-exo-bergamotol is used as a perfume ingredient in perfumes and cosmetics due to its unique fragrance characteristics. In plants, (Z)-α-exo-bergamotol often coexists with other components to form complex fragrance combinations. Its fragrance is often described as fresh, floral and woody, which can enhance the sensory experience of products. In addition, research has shown that some terpenes may have antioxidant, anti-inflammatory and other biological activities, which has attracted attention to their potential applications in medicinal and health products. In summary, (Z)-α-exo-bergamotol is a natural compound with fragrance characteristics and potential biological activity, widely used in the perfume and cosmetics industry.

[0004] Currently, the synthesis of (Z)-a-exo-bergamotol is mainly achieved by chemical synthesis or plant extraction method. However, the chemical reaction involves expensive chemical reagents, harsh reaction conditions, difficult stereo-selectivity, long synthesis route, low total yield, environmental unfriendliness and other shortcomings. The plant extraction method relies on high content of plant raw materials. With the development of synthetic biology, more and more natural products can be artificially prepared by biological cell factories, thereby overcoming the above shortcomings. Meanwhile, (Z)-a-exo-bergamotol is also one of the active components of sandalwood essential oil. Improving the content of bisabolol in sandalwood callus is also of great significance to improve the quality and market value of sandalwood essential oil. SUMMARY

[0005] The technical problem to be solved by the present application is how to improve the content of (Z)-a-exo-bergamotol in sandalwood.

[0006] In order to achieve the above application purposes, the present application provides the following technical solutions.

[0007] In one aspect, the present application provides a transcription factor SaERF89 for improving the content of (Z)-a-exo-bergamotol in sandalwood, and the amino acid sequence thereof comprises the sequence shown in SEQ ID NO. 2.

[0008] In another aspect, the present application provides a gene SaERF89 for improving the content of (Z)-a-exo-bergamotol in sandalwood, and the nucleotide sequence thereof encodes the amino acid sequence shown in SEQ ID NO. 2, or based on the principle of complementary pairing, the gene provided by the present application can be a nucleotide sequence fully complementary to the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 2.

[0009] In a preferred embodiment, the nucleotide sequence of the above-mentioned gene is shown in SEQ ID NO. 1, or a nucleotide sequence fully complementary to the sequence shown in SEQ ID NO. 1.

[0010] It is well known to those skilled in the art that the gene sequence can also comprise introns, promoters and various regulatory elements, so the nucleotide sequence of the above-mentioned gene can also comprise introns, promoters and various regulatory elements.

[0011] In another aspect, the present application provides use of a transcription factor SaERF89 in increasing the content of (Z)-a-exo-bergamotol in Santalum album, wherein the amino acid sequence of the transcription factor SaERF89 comprises a sequence as shown in SEQ ID NO. 2.

[0012] In another aspect, the present application provides use of a transcription factor SaERF89 gene in increasing the content of (Z)-a-exo-bergamotol in Santalum album, wherein the nucleic acid sequence of the transcription factor SaERF89 gene is a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO. 2, or a sequence fully complementary to the nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO. 2.

[0013] In a preferred embodiment, the nucleotide sequence of the transcription factor SaERF89 gene is as shown in SEQ ID NO. 1, or a nucleotide sequence fully complementary to the sequence as shown in SEQ ID NO. 1.

[0014] In another aspect, the present application provides a method for increasing the content of (Z)-a-exo-bergamotol in Santalum album, characterized in that the content of (Z)-a-exo-bergamotol in Santalum album is increased by increasing the mRNA expression amount of the transcription factor SaERF89 gene or the expression amount of the protein encoded by the transcription factor SaERF89 gene in the cells of Santalum album.

[0015] In a preferred embodiment, the mRNA expression amount of the transcription factor SaERF89 gene or the expression amount of the protein encoded by the transcription factor SaERF89 gene is achieved by directly overexpressing the transcription factor SaERF89 gene in the cells of Santalum album.

[0016] In a preferred embodiment, the mRNA expression amount of the transcription factor SaERF89 gene or the expression amount of the protein encoded by the transcription factor SaERF89 gene is achieved by expressing other regulatory genes of the transcription factor SaERF89 gene in the cells of Santalum album.

[0017] In a preferred embodiment, the aforementioned increasing the content of (Z)-a-exo-bergamotol in Santalum album refers to increasing the content of (Z)-a-exo-bergamotol in the callus of Santalum album.

[0018] In another aspect, the present application provides use of the aforementioned protein or the aforementioned gene in cultivating sandalwood varieties with high (Z)-a-exo-bergamotol content.

[0019] Further, the cultivating sandalwood varieties with high (Z)-a-exo-bergamotol content is obtained by overexpressing the aforementioned protein or the aforementioned gene.

[0020] A method for increasing the content of (Z)-a-exo-bergamotol in sandalwood callus, characterized in that the method comprises the following steps:

[0021] 1) obtaining the gene according to claim 2;

[0022] 2) connecting the gene in step 1) with an overexpression vector to obtain a recombinant vector;

[0023] 3) cultivating sandalwood callus;

[0024] 4) transforming the recombinant vector in step 2) into the sandalwood callus in step 3).

[0025] Compared with the prior art, the present application has the following advantages:

[0026] The present application provides a new gene with the function of regulating the content of (Z)-a-exo-bergamotol in sandalwood and the protein encoded by the gene, and a method for regulating the content of (Z)-a-exo-bergamotol in sandalwood. The method can be realized in tissue culture cells, and a series of disadvantages of chemical synthesis can be avoided. BRIEF DESCRIPTION OF DRAWINGS

[0027] The advantages of the present application will be described in detail below in combination with the drawings and specific embodiments.

[0028] Figure 1 is the GFP signal of transgenic sandalwood callus.

[0029] Figure 2 is the expression analysis of SaERF89 gene in transgenic sandalwood callus.

[0030] Figure 3 is the content analysis of (Z)-a-exo-bergamotol in sandalwood callus after transformation of SaERF89. DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The experimental methods in the following examples are conventional methods, unless otherwise specified. The test materials used in the following examples are commercially available from conventional biochemical reagent stores, unless otherwise specified.

[0033] The sandalwood SaERF89 gene nucleotide sequence involved in the present application is shown in SEQ ID NO. 1:

[0034] ATGTGCGGCGGTGCCATCATCTCCGATTACGACCCCGGCAACCGAGGCCGCAAACTCACCACGGAGGAGCTCTGGTCTGAACTCGACGCCTTCTCCGATTTCTTCAGCTTCGATCCCACGGGAGTCAATGATTTCTCATGCCACAAGCTCTCTTCCAAGCAAGAGCAACTCTCCCAAGTGACTGTTGGAGACATGGGGACGGCGGCGGGTCGCAACAACAAGGAGAAGAAGACTCAGAGGGCTCGGAAGAACGTGTACAGAGGAATCCGGCAGAGGCCGTGGGGGAAGTGGGCCGCGGAAATCCGCGACCCGCACAAGGGAGTCCGAGTCTGGCTCGGCACCTTCAACACCGCGGAAGACGCCGCGAGAGCTTACGACGCCGCCGCCAAGCGCATCCGCGGCGACAAGGCCAAGCTCAACTTCCCTAACCAACCTCCGCCGGGGGCTCCTCTGCCCAAGAGGCGGTGCCTCACCACCGAGTCGACTCGGTTCCCGACCCCTCCGAGTCGCCGCAGGGGCTGCCCCTTCCACGACAACGGAGTGTGCCCTCAGAACCAGGTGGCCAGCGAGGTGGGGCTGAAGGAGCGGATCTCGAGCTTGGAGTCCTTCCTGGGGCTGGAGCCGGAGCCGGAGTTGGCGAGCTCGGCGAGCGGAACCGGTGAGTCGACTCAGGACGATCTCTGGGTTCTGGGCGATTTCCCCCTCACAGGAGAGGGTGGATTCTAG.

[0035] The amino acid sequence of the sandalwood SaERF89 protein is shown in SEQ ID NO. 2:

[0036] MCGGAIISDYDPGNRGRKLTTEELWSELDAFSDFFSFDPTGVNDFSCHKLSSKQEQLSQVTVGDMGTAAGRNNKEKKTQRARKNVYRGIRQRPWGKWAAEIRDPHKGVRVWLGTFNTAEDAARAYDAAAKRIRGDKAKLNFPNQPPPGAPLPKRRCLTTESTRFPTPPSRRRGCPFHDNGVCPQNQVASEVGLKERISSLESFLGLEPEPELASSASGTGESTQDDLWVLGDFPLTGEGGF.

[0037] Example 1 Cloning of Sandalwood SaERF89 Gene

[0038] According to the transcriptome data of sandalwood, the gene SaERF89 closely related to the sandalwood alcohol synthesis pathway gene was obtained by gene expression pattern screening. The primers were designed as follows: SaERF89 ORF F: ATGTGCGGCGGTGCCATCATC, SaERF89 ORF R: ACCTAGAATCCACCCTCTCCT. The RNA of sandalwood leaves was extracted, and the cDNA was synthesized after reverse transcription. The full-length ORF sequence of SaERF89 was obtained by amplification and sequencing using the cDNA as a template.

[0039] Example 2 Construction of SaERF89 Overexpression Vector of Sandalwood

[0040] ECOR I and Xba I were selected for double digestion of pGreen35S-GFP (C17) vector, and the ORF of SaERF89 was homologously recombined on the C17 vector using infusion technology to obtain 35S: :SaERF89-GFP recombinant plasmid. The primers used are as follows:

[0041] 35S: :SaERF89-F: GCTTGATATCGAATTCATGTGCGGCGGTGCCATCATCTCC

[0042] 35S: :SaERF89-R: CAGCGAATTATCTAGAGAATCCACCCTCTCCTGTGAGGG

[0043] Example 3 Obtaining and Identifying of SaERF89 Transgenic Sandalwood Callus

[0044] (1) The SaERF89 overexpression plasmid was transformed into Agrobacterium, and the positive clones were picked and placed in 1 mL of LB+Kan (50 mg / L) liquid medium, and cultured at 28°C, 200 rpm, and shaking for 12 h.

[0045] (2)Expansion: Take 50 μL of the above small shake liquid and add to 50 mL of LB liquid medium containing Kan (50 mg / L), 28°C, 200 rpm, shake culture for 21 h until the OD value is about 0.6

[0046] (3) Centrifuge the above bacterial liquid at 5000 g for 10 min, collect the bacterial body, and then suspend it with 20 mL of the infection liquid (MS + AS 100 μM), and repeat the above centrifugation once.

[0047] (4) Suspend the bacterial body with the same volume of infection liquid (MS + AS 100 μM) (adjust to OD value of 0.6), and then place it in a 28°C dark incubator for 2-3 h, which is the infection liquid.

[0048] (5) Select the sandalwood callus with good and consistent growth, crush it with tweezers, and place it in the infection liquid, and perform infection on a shaker at 100 rpm / min for 12 min (shake during the period to ensure that the infection liquid and explants are in full contact).

[0049] (6) Filter the infected callus with sterile gauze in a clean bench, and then place it on sterile filter paper and blow for about 10 min to absorb as much of the bacterial liquid on the surface of the callus as possible, and then transfer it evenly to MS solid medium (+ 0.8 mg / L 2,4-D + 100 μM AS), and incubate it in the dark for 3 d.

[0050] (7) Wash the callus after dark incubation with sterile water for 2 times, 1 min each time, then wash it with liquid containing 200 mg / L Timentin (bacteriostatic agent) for 3 times, 2 min each time, then wash it with sterile water for 3 times, and then inoculate it on MS + 2,4-D (0.8 mg / L) + Timentin (200 mg / L) + BASTA (0.1 mg / L) solid medium for normal culture;

[0051] (8) Normal culture for 3 d, sample and observe the state with an inverted fluorescence microscope. Then observe the infection condition with a fluorescence microscope on the 7th day, and store the samples observed with obvious GFP signal at -80°C ( Figure 1 ).

[0052] (9) Extraction of sandalwood callus RNA

[0053] Extract the RNA of the callus without infection, the 7d callus transformed with empty vector C17, and the 7d callus transformed with 35S::SaERF89-GFP, verify the integrity of the RNA by gel electrophoresis, and determine the concentration of the RNA with a microspectrophotometer, and then perform reverse transcription.

[0054] (10) Reverse transcription to cDNA and qPCR analysis

[0055] The above RNA was respectively reverse transcribed by using a full-type gold reverse transcription kit, 1 μg of each sample was reverse transcribed, SaActin was used as an internal reference, and qPCR was used to detect gene expression, and the results are shown in Figure 2 .

[0056] Example 3 SaERF89 transgenic sandalwood callus increases the content of (Z)-a-exo-bergamotol

[0057] The content of (Z)-a-exo-bergamotol in the sample was detected by GC-MS, and the steps were as follows:

[0058] 1. Sample extraction process

[0059] (1) Take the sample (no special requirements, fresh sample by default) from the-80℃ refrigerator and grind it in liquid nitrogen, vortex mix uniformly, and take about 500mg (1mL of liquid) of each sample into a headspace bottle; (2) Add saturated NaCl solution, 20μL (10μg / mL) of internal standard solution; (3) Perform sample extraction by full-automatic headspace solid-phase microextraction (HS-SPME) for GC-MS analysis.

[0060] 2. Chromatography-mass spectrometry collection conditions

[0061] HS-SPME extraction conditions: under constant temperature conditions at 60℃, shake for 5min, insert a 120μm DVB / CWR / PDMS extraction head into the sample headspace bottle, extract for 15min under headspace, and analyze for 5min at 250℃, then perform GC-MS separation and identification. The extraction head is aged for 5min at 250℃ in the Fiber Conditioning Station before sampling. Note: The new extraction head is aged for 2h in the Fiber Conditioning Station before extraction. And SPME Arrow is used, which has a sensitivity of 10 times that of traditional SPME fiber head.

[0062] Chromatographic conditions: DB-MS capillary column (30m x 0.25mm x 0.25μm, Agilent J&W Scientific, Folsom, CA, USA), carrier gas is high-purity helium (purity not less than 99.999%), constant flow rate 1.2mL / min, injection port temperature 250℃, no split injection, solvent delay 3.5min. Programmed temperature: 40℃ for 3.5min, increased to 100℃ at 10℃ / min, then increased to 180℃ at 7℃ / min, and finally increased to 280℃ at 25℃ / min, and kept for 5min.

[0063] Mass spectrometry conditions: Electron impact ion source (EI), ion source temperature 230℃, quadrupole temperature 150℃, mass spectrometry interface temperature 280℃, electron energy 70eV, scan mode is selected ion detection mode (SIM), qualitative and quantitative ion precision scan (GB 23200.8-2016).

[0064] 3. Based on multiple species, literature, partial markers and retention index, a database is independently established, including determined RT and qualitative and quantitative ions for selected ion detection mode for precision scan, 1 quantitative ion is selected for each compound, 2-3 ion quantitative ion detection mode for precision scan, 1 quantitative ion is selected for each compound, 2-3 qualitative ions. All ions that need to be detected in each group are detected in time period according to peak order, if the detected retention time is consistent with the standard reference, and the selected ions all appear in the sample mass spectrum after background subtraction, it is determined that the substance (Yuan et al., 2021); the quantitative ion is selected for integration and correction work, and the accuracy of quantification is enhanced. The original data after mass spectrometry analysis are processed by MassHunter software for qualitative and quantitative analysis.

[0065] The results show that after overexpression of SaERF89 in sandalwood callus, the content of (Z)-α-exo-bergamotol is increased by an average of 41.75%, and there is a very significant difference (P<0.01). Figure 3 )。

[0066] The above is only a preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above with a preferred embodiment, it is not intended to limit the present application. Any person skilled in the art can make some changes or modifications to the above disclosed technical content without departing from the scope of the technical solution of the present application, and any brief introduction, modification, equivalent change and modification of the above embodiments according to the technical essence of the present application are still within the scope of the technical solution of the present application.

Claims

1. Use of a protein modulating the content of (Z)-a-exo-bergamotol in Santalum album for modulating the content of (Z)-a-exo-bergamotol in Santalum album, characterized in that, The sequence of the protein is shown as SEQ ID NO.

2.

2. Use of a gene modulating the content of (Z)-a-exo-bergamotol in Santalum album for modulating the content of (Z)-a-exo-bergamotol in Santalum album, characterized in that, The gene sequence encodes the amino acid sequence shown as SEQ ID NO.

2.

3. Use according to claim 1, characterized in that, The method for regulating the content of (Z)-a-exo-bergamotol in Santalum album is to increase the expression of the protein in Santalum album cells.

4. Use according to claim 2, characterized in that, The method for regulating the content of (Z)-a-exo-bergamotol in Santalum album is to increase the expression of the gene in Santalum album cells.

5. Use according to claim 1 or 2, characterized in that, The method for regulating the content of (Z)-a-exo-bergamotol in Santalum album is to increase the content of (Z)-a-exo-bergamotol in Santalum album callus.

6. Use of a protein that modulates the content of (Z)-a-exo-bergamotol in sandalwood for breeding sandalwood varieties with high content of (Z)-a-exo-bergamotol, characterized in that, The sequence of the protein is shown as SEQ ID NO.

2.

7. Use of a gene modulating the content of (Z)-a-exo-bergamotol in sandalwood for breeding a sandalwood variety with a high content of (Z)-a-exo-bergamotol, characterized in that, The gene sequence encodes the amino acid sequence shown as SEQ ID NO.

2.

8. Use according to claim 6, characterized in that, The method for cultivating Santalum album varieties with high content of (Z)-a-exo-bergamotol is to overexpress the protein.

9. Use according to claim 7, characterized in that, The method for cultivating Santalum album varieties with high content of (Z)-a-exo-bergamotol is to overexpress the gene.

10. A method for increasing the content of (Z)-a-exo-bergamotol in sandalwood callus, characterized by, The method comprises the following steps: 1) obtaining a gene, the sequence of which encodes the amino acid sequence shown as SEQ ID NO. 2; 2) linking the gene of step 1) with an overexpression vector to obtain a recombinant vector; 3) culturing Santalum album callus; 4) transforming the recombinant vector of step 2) into the Santalum album callus of step 3).

Images