A strain of rhodotorula mucilaginosa resistant to furfural and application thereof
By using adaptive domestication techniques, a furfural-resistant Rhodotorula glutinis strain F3 was obtained, which solved the furfural inhibition problem, enabled efficient production of carotenoids, reduced production costs, and improved the utilization efficiency of lignocellulose hydrolysate.
Patent Information
- Application Number
- CN202411379556.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2044-09-30
AI Technical Summary
Existing Rhodotorula glutinis strains exhibit enzyme activity inhibition when exposed to inhibitors such as furfural in lignocellulose, leading to high production costs of carotenoids and causing oxidative and osmotic stress damage to cells.
By using adaptive domestication techniques, Rhodotorula glutinis strains were continuously cultured and screened under furfural stress to obtain Rhodotorula glutinis strain F3, which is resistant to high concentrations of furfural. The expression of antioxidant enzyme-related genes was regulated to improve the adaptability to oxidative stress.
The Rhodotorula glutinis F3 strain, when grown at furfural concentrations of up to 40-45 mM, significantly increased carotenoid yield and furfural metabolism rate, reduced production costs, and improved the utilization efficiency of lignocellulose hydrolysate.
Smart Images

Figure CN119040155B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a furfural-resistant Rhodotorula glutinis strain F3 and its applications. Background Technology
[0002] Carotenoids are an important class of isoprene pigments found in nature, widely used in nutrition and health products, biomedicine, cosmetics, and animal feed. With increasing emphasis on healthy living, natural pigments are gaining popularity due to their potential antioxidant activity and health benefits. Currently, some red yeasts, such as *Rhodotorula* and *Rhodotorula*, are attracting growing attention because they can produce carotenoids regardless of season, location, soil, or climate change. However, high production costs remain a major bottleneck hindering the commercialization of microbial carotenoid production. Lignocellulose, as the world's most abundant renewable resource, could be effectively utilized as a carbon source for carotenoid production, not only reducing production costs but also achieving waste utilization and promoting sustainable development.
[0003] Rhodotorula mucilaginosa is a type of microorganism with industrial application potential. Its unique metabolic capabilities enable it to utilize lignocellulose hydrolysate as a carbon source for cell growth, providing a new pathway for low-cost production of carotenoids. However, inhibitors such as furfural in lignocellulose can suppress the activity of enzymes such as pyruvate, acetaldehyde, and alcohol dehydrogenase in Rhodotorula mucilaginosa, reducing the levels of important intracellular substances and triggering complex stress environments such as oxidative and osmotic stress, causing cell damage. Summary of the Invention
[0004] (I) Purpose of the Invention
[0005] The purpose of this invention is to provide a furfural-resistant Rhodotorula glutinis strain F3 and its application in the production of carotenoids using a carbon source.
[0006] (II) Technical Solution
[0007] To address the aforementioned problems, the first aspect of this invention provides a furfural-resistant Rhodotorula mucilaginosa strain, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) on July 1, 2024, with accession number CGMCC NO.31122. The Rhodotorula mucilaginosa strain is named Rhodotorula mucilaginosa F3.
[0008] According to another aspect of the invention, the invention also provides the use of the above-described Rhodotorula glutinis strain in the production of carotenoids using a carbon source.
[0009] Preferably, the carbon source contains furfural.
[0010] Preferably, the highest concentration of furfural that the Rhodotorula glutinis F3 can tolerate is 40mM-45mM.
[0011] Preferably, the carbon source is a YPD culture medium containing furfural or a lignocellulose hydrolysate.
[0012] Preferably, the application includes:
[0013] Rhodotorula glutinis F3 was inoculated into YPD medium containing furfural or lignocellulose hydrolysate for fermentation culture, and carotenoids were obtained from the fermentation broth.
[0014] Preferably, the inoculum size of the Rhodotorula glutinis F3 is OD. 600 =0.8-1.2.
[0015] (III) Beneficial Effects
[0016] The above-described technical solution of the present invention has the following beneficial technical effects:
[0017] This invention utilizes adaptive domestication technology to continuously culture and screen a primitive Rhodotorula glutinis strain under furfural stress. This primitive strain was then enriched with numerous genetically diverse mutation sites to obtain a stable strain—Rhodotorula glutinis F3—that exhibits high furfural tolerance and high carotenoid production. Experiments show that Rhodotorula glutinis F3 can combat oxidative stress under furfural stress by regulating the expression of antioxidant enzyme-related genes, thereby improving its survival rate. Specifically, Rhodotorula glutinis F3 can grow in media with furfural concentrations as high as 40mM-45mM, and its adaptability, glucose and furfural metabolism rates, carotenoid production, and SOD activity are significantly improved compared to the primitive Rhodotorula glutinis strain. This indicates that Rhodotorula glutinis F3 can reduce the production cost of carotenoids, improve the utilization efficiency of lignocellulose hydrolysate, and achieve waste utilization, demonstrating significant commercial and scientific research value. Therefore, this invention provides excellent strains and optimization targets for the subsequent development and optimization of cell factories, and provides a theoretical basis and practical experience for the sustainable production of microbial carotenoids.
[0018] Information on strain preservation
[0019] The strain of Rhodotorula mucilaginosa was named Rhodotorula mucilaginosa F3 and was deposited at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.31122 and deposit date of July 1, 2024. Attached Figure Description
[0020] Figure 1 This is a colony diagram of the original strain WT.
[0021] Figure 2 This is a diagram of the cell morphology of the original strain WT.
[0022] Figure 3 This is a cell morphology diagram of the mutant strain F3.
[0023] Figure 4 This is a comparison of the growth curves of the original strain WT and the mutant strain F3 in YPD medium with a furfural concentration of 25 mM.
[0024] Figure 5 This is a biomass comparison diagram of the original strain WT and the mutant strain F3 after being cultured in YPD medium with a furfural concentration of 25 mM.
[0025] Figure 6 This is a comparison chart showing the glucose and furfural consumption of the original strain WT and the mutant strain F3 in YPD medium with a furfural concentration of 25 mM.
[0026] Figure 7 This is a comparison chart showing the accumulation of carotenoids in the original strain WT and the mutant strain F3 after being cultured in YPD medium with a furfural concentration of 25 mM.
[0027] Figure 8 This is a comparison diagram of intracellular ROS levels after the original strain WT and the mutant strain F3 were cultured in YPD medium with a furfural concentration of 25 mM.
[0028] Figure 9 This is a comparison diagram of intracellular SOD activity after the original strain WT and the mutant strain F3 were cultured in YPD medium with a furfural concentration of 25 mM.
[0029] Figure 10 This is a comparison chart of the total intracellular protein concentrations of the original strain WT and the mutant strain F3 after being cultured in YPD medium with a furfural concentration of 25 mM. Detailed Implementation
[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and the accompanying drawings. It should be understood that these descriptions are merely exemplary and not intended to limit the scope of the invention. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.
[0031] This application employs a method of continuously increasing the furfural concentration in YPD medium to adapt and domesticate the original strain Rhodotorula glutinis WT for 211 days, thereby obtaining the mutant strain Rhodotorula glutinis F3.
[0032] Growth curve analysis revealed that the mutant strain Rhodotorula glutinis F3 exhibited a shorter lag phase than the original strain Rhodotorula glutinis WT.
[0033] The determination of strain biomass, glucose and furfural content in fermentation broth revealed that mutant strain F3 metabolized furfural faster and had higher substrate utilization than the original strain WT.
[0034] Measurements of carotenoid accumulation revealed that the total carotenoid production of the mutant strain Rhodotorula glutinis F3 was significantly higher than that of the original strain WT.
[0035] The determination of reactive oxygen species (ROS) levels, superoxide dismutase (SOD) activity, and total protein concentration revealed that Rhodotorula glutinis F3 can enhance the strain's ability to scavenge ROS by increasing SOD activity, thereby playing a role in protecting cells.
[0036] Based on the above experimental results, on the one hand, the present invention provides a furfural-resistant Rhodotorula mucilaginosa strain, which is deposited at the China General Microbiological Culture Collection Center on July 1, 2024, with the accession number CGMCC NO.31122. This Rhodotorula mucilaginosa strain is named Rhodotorula mucilaginosa F3.
[0037] On the other hand, the present invention also provides the application of Rhodotorula glutinis strain F3 in the production of carotenoids using carbon sources.
[0038] According to the present invention, the carbon source contains furfural.
[0039] According to the present invention, the highest concentration of furfural that the Rhodotorula glutinis F3 can tolerate is 40mM-45mM.
[0040] According to the present invention, the carbon source can be YPD medium containing furfural or lignocellulose hydrolysate.
[0041] According to the present invention, the application includes:
[0042] Rhodotorula glutinis F3 was inoculated into YPD medium containing furfural or lignocellulose hydrolysate for fermentation culture, and carotenoids were obtained from the fermentation broth.
[0043] In the above applications, the preferred inoculum size for Rhodotorula glutinis F3 is OD. 600 =0.8-1.2.
[0044] The following embodiments will further illustrate the present invention, but are not intended to limit the invention.
[0045] The culture media used in the following examples are as follows:
[0046] Yeast Extract Peptone Glucose Medium (YPD): 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 20 g / L agar.
[0047] Example 1: Obtaining a mutant Rhodotorula glutinis strain
[0048] 1. Isolation and screening of the original strain
[0049] Pickled radishes collected from Chenggong District, Kunming City were crushed with a grinder. 1g of the crushed sample was added to 5mL of physiological saline and shaken to mix. The sample was then serially diluted 10-fold. The sample was then spread on YPD agar medium and cultured. Typical colonies with color and morphology consistent with those of Rhodotorula glutinis were picked from the plates and streaked for purification. Single colonies were picked and enriched in YPD medium. The original strain was obtained through morphological and molecular identification and was named Rhodotorula glutinis WT.
[0050] 2. Identification of the original strain
[0051] 2.1 Morphological identification
[0052] like Figure 1 As shown, when the original strain grew on YPD agar medium, the colonies were orange-red, bright, soft, and viscous, with no significant change in the medium color and no exudate. The strain was observed under a light microscope as follows... Figure 2 As shown, the cells are spherical, elliptical, or oval in shape, and their reproductive method is mostly budding.
[0053] 2.2 Molecular Identification
[0054] Using the strain's genome as a template, PCR amplification was performed using universal sequencing primers ITS1 and ITS4 for fungal identification. The primer sequence for ITS1 was: TCCGTAGGTGAACCTGCGG, and the primer sequence for ITS4 was: TCCCCGCTTATTGATATGC. The amplified products were sequenced by Sangon Biotech Co., Ltd. (Shanghai). The sequencing results were compared with known nucleic acid sequences in the NCBI database for homology. It was found that the original strain WT had a 99.66% similarity to Rhodotorula mucilaginosa, therefore WT was identified as Rhodotorula mucilaginosa, and the strain was named Rhodotorula mucilaginosa WT. The ITS sequence of Rhodotorula mucilaginosa WT has the nucleotide sequence shown in SEQ ID No. 1.
[0055] TGGGCTTTTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGA GACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGG GAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGC AGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGACCCGTCTTGAACCCCCGGACCAACGC
[0056] The original strain of *Rhodotorula glutinis* WT, preserved in glycerol tubes at -80℃, was streaked onto YPD agar medium and cultured for 5 generations at 30℃ to obtain single colonies. Single colonies of *Rhodotorula glutinis* WT were picked from the plates and inoculated into YPD medium at pH 5.0, and cultured at 30℃ for 72 h. The acclimation starting point was defined as the furfural concentration of 5 mM, which showed a significant difference between the original strain's lag phase and that in YPD medium; that is, furfural was added to YPD medium to achieve a furfural concentration of 5 mM. The culture was centrifuged at 2772 × g for 5 minutes, the supernatant was discarded, and the cell pellet was washed with 3 mL of physiological saline. After centrifugation again, the supernatant was discarded, the cell pellet was retained, and YPD medium with a furfural concentration of 5 mM was added to adjust the initial OD. 600 The inoculum size was 1.0, and Rhodotorula glutinis WT was cultured at this inoculum size. The OD of the strain was observed every 24 hours. 600 The process involves washing the strain once after it reaches a plateau phase, retaining the bacterial precipitate, and then adding YPD medium with an increased furfural concentration of 2.5 mM (i.e., furfural concentration of 7.5 mM) to adjust the OD. 600The culture was subcultured for 5 generations, then washed once more. YPD medium (10 mM furfural) was added to the bacterial pellet to increase the furfural concentration by 2.5 mM to adjust the OD. 600 The strain was cultured at a concentration of 1.0, and then passaged five times, with the furfural concentration increasing by 2.5 mM each time for continuous acclimatization. If the lag phase of the strain significantly increased during this process, the furfural concentration was reduced by 2.5 mM, and the passage process was repeated until the strain reached its biological limit, i.e., after more than five passages in a certain concentration of furfural medium, the growth rate and lag phase could not be recovered, yielding a maximum acclimatization concentration of 40–45 mM furfural. The acclimatized strain was cultured at the maximum acclimatization concentration for five passages, and the bacterial culture was collected, mixed with glycerol solution, and frozen at -80°C. The culture was then sent to Sangon Biotech Co., Ltd. (Shanghai) for strain identification. Using the strain's genome as a template, PCR amplification was performed using the universal sequencing primers ITS1 and ITS4 for fungal identification. The primer sequence for ITS1 was: TCCGTAGGTGAACCTGCGG, and the primer sequence for ITS4 was: TCCCCGCTTATTGATATGC. The amplified products were sequenced by Sangon Biotech Co., Ltd. (Shanghai). The sequencing results were compared with known nucleic acid sequences in the NCBI database for homology. It was found that the mutant strain had a similarity of 99.82% with Rhodotorula mucilaginosa. Therefore, the single strain was identified as Rhodotorula mucilaginosa and named Rhodotorula mucilaginosa F3.
[0057] Identification of mutant strains
[0058] Morphological identification: The mutant strain was observed under a light microscope, such as... Figure 3 As shown, the cells are spherical, elliptical, or oval in shape, and their reproductive method is mostly budding.
[0059] The ITS sequence of Rhodotorula glutinis F3 has the nucleotide sequence shown in SEQ ID No. 2.
[0060] ACTCAGCATTCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTT TTCCGCGTTGGACCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATT GTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCT CTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGACCGTTTAAAGAAAGACACACAAA
[0061] Example 2: Determination of bacterial biomass, glucose and furfural content in fermentation broth
[0062] The original strain *Rhodotorula glutinis* WT and the mutant strain *Rhodotorula glutinis* F3 were pre-cultured on YPD medium at 30℃ and 210 rpm for 72 h. After washing the cells twice with sterile water, the bacterial sludge was collected and resuspended in YPD medium at the maximum furfural concentration (25 mM) for which the original strain could grow, with an initial OD of 0.6. The cultures were then incubated at 30℃ and 210 rpm for 144 h. Samples were taken every 12 h to measure the OD value of the fermentation broth and monitor the growth curve of the strain. The biomass of the strain was determined by gravimetric method. Samples were taken every 24 h, and the fermentation broth was centrifuged to separate the cells and supernatant. The cells were washed twice with sterile water, centrifuged to collect the bacterial sludge, and dried at 60℃ to a constant weight (approximately 24 h) before weighing.
[0063] The glucose and furfural contents of the fermentation broth were determined by filtering the supernatant obtained after centrifugation through a 0.22 μm filter. The supernatant was analyzed using HPLC with a refractive index detector (RID) and an Aminex HPX-87H column (300 × 7.8 mm) at 60 °C. The mobile phase was 5 mM sulfuric acid, eluted at 0.6 mL / min for 50 min, with an injection volume of 20 μL. Glucose and furfural standards were used for qualitative and quantitative analysis.
[0064] The results are as follows Figure 4 As shown, the mutant strain *Rhodotorula glutinis* F3 entered the exponential phase after 36 hours, while the original strain *Rhodotorula glutinis* WT entered the exponential phase after 72 hours. The lag phase of the mutant strain was shortened by 36 hours compared to the original strain. Figure 5 As shown, the dry weight of Rhodotorula glutinis F3 cells reached 10.15 g / L, while the starting strain only had 8.28 g / L. Furthermore, from... Figure 6 The results showed that the mutant strain *Rhodotorula glutinis* F3 could completely metabolize furfural within 24 hours, while the original strain *Rhodotorula glutinis* WT took 24–48 hours to completely metabolize it. The rate of furfural metabolism represents the strain's detoxification ability; the faster the metabolism, the stronger the detoxification ability. Furthermore, the original strain *Rhodotorula glutinis* WT metabolized furfural first and then utilized glucose in the early stages of fermentation, while the mutant strain *Rhodotorula glutinis* F3 could metabolize both furfural and glucose simultaneously. The glucose provided energy for the strain, resulting in a faster growth rate and also contributing to its detoxification ability, indicating that *Rhodotorula glutinis* F3 has stronger adaptability and a faster growth rate under furfural stress. Specifically, at 120 hours, the glucose content in the fermentation broth of *Rhodotorula glutinis* F3 was already below 1 g / L; by 144 hours, *Rhodotorula glutinis* F3 had essentially consumed all the glucose, while the original strain's fermentation broth still had 1.7 ± 0.4 g / L of unutilized glucose, indicating that the mutant strain *Rhodotorula glutinis* F3 metabolized furfural faster and had improved substrate utilization.
[0065] Example 3: Determination of Carotenoid Content in Bacterial Cells
[0066] The original strain of *Rhodotorula glutinis* WT and the mutant strain *Rhodotorula glutinis* F3 were pre-cultured on YPD medium at 30°C and 210 rpm for 72 h. After washing the cells twice with sterile water, the bacterial sludge was collected and resuspended in YPD medium at the maximum furfural concentration (25 mM) that *Rhodotorula glutinis* WT could grow on, with an initial OD of 0.6. The culture was then incubated at 30°C and 210 rpm for 144 h. The fermentation broth was centrifuged at 2772 × g for 5 min to collect the cells, which were then washed twice with sterile water. The cells were resuspended in 2 mol / L HCl to a density of approximately 10 g / L and magnetically stirred at 65°C and 300 rpm for 35 min. The HCl disrupted the cell wall due to osmotic pressure difference, releasing intracellular contents. The sample was then rapidly cooled and washed with deionized water to remove residual acid. Anhydrous ethanol was added to the cell debris to bring the density back to approximately 10 g / L, and the mixture was thoroughly vortexed. Subsequently, equal volumes of deionized water and n-hexane were added to extract carotenoids. After vortexing and centrifugation (2772×g, 5 min), the hexane phase containing carotenoids (upper layer) was transferred to a clean test tube. Hexane was added to the precipitate, and this extraction step was repeated until the cell debris became light-colored or colorless. The crude carotenoid extract was dried under N2 and used for further separation.
[0067] The crude carotenoid extract was redissolved in 0.5 mL of hexane / ethyl ether (7 / 1, v / v) solution and purified using a solid-phase extraction column. Nonpolar carotenoids were eluted first with hexane / ethyl ether (7 / 1, v / v) solution, followed by polar carotenoids with methanol / acetone / hexane (2 / 2 / 1, v / v / v) solution. The fractions were collected and dried under N2. Total carotenoids, polar and nonpolar carotenoids were dissolved in 1.5 mL of acetone containing 0.2% (w / v) butylated hydroxytoluene and filtered through a 0.45 μm filter. Analysis was performed using HPLC equipped with a diode array detector (DAD). A TC-C18 column (250 × 4.6 mm, 5 μm) was used for carotenoid separation at 25 °C. Mobile phase A was acetonitrile / H2O (9 / 1, v / v), and mobile phase B was ethyl acetate. The gradient elution program was as follows (1 mL / min): 0–6 min, 20% B–60% B; 6–15 min, 60% B; 15–20 min, 60% B–100% B; 20–25 min, 100% B–20% B; 25–30 min, 20% B. The injection volume was 20 μL. Qualitative and quantitative analyses were performed at the maximum absorption wavelengths of each carotenoid: 494 nm for erythropoietin, 486 nm for cytosine, 450 nm for β-carotene, and 461 nm for γ-carotene. Carotenoids extracted using acid-heat treatment were considered as total carotenoids because this method yielded the highest total carotenoid content. The formula for calculating the carotenoid recovery rate is as follows:
[0068]
[0069] The results are as follows Figure 7 As shown, the total carotenoid accumulation of the mutant strain Rhodotorula glutinis F3 after 144 h of fermentation reached 97.07 ± 3.8 μg / g cell dry weight, while the WT of the original strain Rhodotorula glutinis was 51.3 ± 2.5 μg / g cell dry weight. The total carotenoid production of the mutant strain Rhodotorula glutinis F3 increased by 89.2% compared with the WT of the original strain. In addition, the mutant strain Rhodotorula glutinis F3 synthesized a new γ-carotene, and the production of β-carotene and cytosine were both higher than those of the original strain.
[0070] Example 4: Determination of intracellular total protein concentration, ROS level and SOD activity in bacterial strains
[0071] First, following the culture method described in Example 3, fermentation broths of the original strain and the mutant strain were obtained. The broth was centrifuged at 2772×g for 5 min, and the cell pellet was collected. The pellet was then washed twice with phosphate-buffered saline (pH 7.0) and resuspended. Next, intracellular ROS levels were detected using a reactive oxygen species assay kit (chemiluminescence assay) according to the manufacturer's instructions.
[0072] To determine intracellular SOD activity and total protein concentration, cell disruption is necessary. The procedure is as follows: Transfer the bacterial suspension (resuspended in 1 mL phosphate-buffered saline) to a 2 mL EP tube, add 0.4 g of 0.12 mm zirconia beads, and then use a cryo-mortar to disrupt the cells at 0°C and 65 Hz for 5 min. Subsequently, the cells are analyzed using a catalase assay kit (ammonium molybdate method), a total superoxide dismutase assay kit (WST-1 method), and a total protein assay kit (BCA method) according to their respective manufacturer's instructions.
[0073] The results are as follows Figures 8-10 As shown, see Figure 8 The mutant strain, *Rhodotorula glutinis* F3, had lower levels of intracellular reactive oxygen species (ROS) than the original strain. See also... Figure 9 Intracellular superoxide dismutase (SOD) activity was generally negatively correlated with ROS levels. The mutant strain *Rhodotorula glutinis* F3 had a higher SOD activity than the original strain (WT), at 1298.7 ± 52.8 U / mgprot. This indicates that the mutant strain *Rhodotorula glutinis* F3 can cope with furfural stress by increasing SOD activity and reducing ROS production. For total protein concentration, see [link to relevant documentation]. Figure 10 The effective concentration of the mutant strain Rhodotorula glutinis F3 was 923.8 ± 95.7 μg / mL, significantly higher than that of the original strain Rhodotorula glutinis WT. This indicates that under furfural stress, the mutant strain Rhodotorula glutinis F3 can counteract oxidative stress and improve its survival rate by regulating the expression of antioxidant enzyme-related genes.
[0074] It should be understood that the specific embodiments described above are merely illustrative or explanatory of the principles of the invention and do not constitute a limitation thereof. Therefore, any modifications, equivalent substitutions, improvements, etc., made without departing from the spirit and scope of the invention should be included within the protection scope of the invention. Furthermore, the appended claims are intended to cover all variations and modifications falling within the scope and boundaries of the appended claims, or equivalent forms of such scope and boundaries.
Claims
1. A furfural-resistant Rhodotorula glutinis strain, characterized in that, The strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on July 1, 2024, with accession number CGMCC NO.31122. The strain was named *Rhodotorula glutinis*. Rhodotorula mucilaginosa )F3.
2. The use of the Rhodotorula glutinis strain as described in claim 1 in the production of carotenoids using a carbon source.
3. The application according to claim 2, characterized in that, The carbon source contains furfural.
4. The application according to claim 3, characterized in that, The highest concentration of furfural that the Rhodotorula glutinis F3 can tolerate is 40mM-45mM.
5. The application according to any one of claims 2-4, characterized in that, The carbon source is a YPD medium containing furfural or a lignocellulose hydrolysate.
6. The application according to claim 5, characterized in that, The applications include: Rhodotorula glutinis F3 was inoculated into YPD medium containing furfural or lignocellulose hydrolysate for fermentation culture, and carotenoids were obtained from the fermentation broth.
Citation Information
Patent Citations
Rhodotorula mucilaginosa for producing high-yield grease by using acetic acid as well as preparation method and application of
CN119120234A