Candida tropicalis strain with salt, acid and heat tolerance and its application in treatment of high-salt and strong-acid organic wastewater

By using salt- and acid-resistant tropical yeast Candida tropicalis to treat high-salt and strong-acid organic wastewater, the problems of poor microbial tolerance and high treatment costs were solved, and efficient and economical wastewater purification effects were achieved.

CN119040157BActive Publication Date: 2025-10-17THIRD INSTITUTE OF OCEANOGRAPHY STATE OCEANI C ADMINISTRATION
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411510020.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-28
Publication Date
2025-10-17
Estimated Expiration
2044-10-28

AI Technical Summary

Technical Problem

The biological treatment of high-salt and strong-acid organic wastewater faces the problems of poor microbial tolerance, high treatment cost and low treatment efficiency, and traditional methods are difficult to effectively treat it.

Method used

A salt- and acid-tolerant tropical Candida sp. Y1 was used to treat high-salt and strong-acid organic wastewater by forming biofilm in a reactor. The pH value and salinity were adjusted, the effluent quality was monitored, and the treatment parameters were optimized to achieve efficient degradation of organic pollutants.

Benefits of technology

This strain can survive stably under high-salt and strong acid conditions, can quickly degrade organic pollutants, achieve efficient wastewater purification, and reduce treatment costs. It is suitable for a variety of high-salt and strong acid organic wastewaters, is environmentally friendly, and has good economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119040157B_ABST
    Figure CN119040157B_ABST
Patent Text Reader

Abstract

A salt-tolerant acid-tolerant Candida tropicalis and its application in high-salt strong-acid organic wastewater treatment, relates to high-salt strong-acid organic wastewater biological treatment. The Candida tropicalis (Candida sp. Y1) is preserved in Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC No: 64779. The nucleotide sequence of the Candida tropicalis is shown in the sequence table SEQ ID. No 1. The strain has the ability to grow stably under high-salt (1%-8% NaCl) and strong-acid (pH 2-10) conditions and effectively degrade organic pollutants, and is particularly suitable for treating candied fruit wastewater and other high-salt strong-acid organic wastewater. The pure culture fermentation liquid is inoculated in the reactor filled with filler, and the membrane is completed in 3d. The reactor after membrane is connected to high-salt strong-acid organic wastewater. The treatment efficiency is high, the application range is wide, and the operation is simple, which provides a new scheme for the treatment of high-salt strong-acid organic wastewater.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the biological treatment of high-salinity and high-acidity organic wastewater, and in particular to a salt-tolerant and acid-tolerant Candida tropicalis strain and its application in the treatment of high-salinity and high-acidity organic wastewater. BACKGROUND

[0002] High-salinity and high-acidity organic wastewater is a challenging type of wastewater characterized by significantly elevated concentrations of salts and acidic substances, with salinity typically greater than 3% and pH less than 4. This type of wastewater is commonly found in multiple industrial sectors, including food processing, metal processing, mining, electroplating, chemical manufacturing, and other manufacturing industries (Amin A, Al Bazedi G, Abdel-Fatah MA. Experimental study and mathematical model of coagulation / sedimentation units for treatment of food processing wastewater[J]. Ain Shams Eng J, 2021, 12(1): 195-203. Zheng S, Zhang Y, Tong T, Cui C, Sun J. Dominance of yeast inactivated sludge under acidic pH and high organic loading[J]. Biochemical Engineering Journal, 2010, 52(2), 282-288.).

[0003] The biological treatment of high-salinity and high-acidity organic wastewater typically faces a series of challenges. First, low pH can inhibit the biological treatment process by reducing the number of microorganisms and lowering metabolic levels, so it is necessary to add alkaline substances to increase the pH of the wastewater to the neutral range before biochemical treatment, which generates a large amount of sludge and increases the salinity of the wastewater; the cost of chemicals required to adjust the pH significantly increases the operating cost of wastewater treatment. In addition, the high salinity of the wastewater can disrupt the osmotic pressure balance inside and outside the microorganisms, reduce enzyme activity, and even cause the microorganisms to dehydrate and die; it can also damage the settling performance of activated sludge and reduce the removal rate of organic matter and nutrients. If dilution of the wastewater is used to reduce salinity, it means that the treatment load is low, the treatment tank capacity is multiplied, and the capital cost is significantly increased.

[0004] The treatment of high-salinity and high-acidity organic wastewater is often accompanied by high energy consumption and high cost, so it is necessary to find more effective and economically feasible treatment methods. Currently, the main methods for treating high-salinity and high-acidity organic wastewater include electrolysis, membrane separation, and biological methods. However, except for the biological method, other methods are difficult to be widely applied in practice due to high treatment costs. The biological method is widely considered as a mature and effective wastewater treatment technology, which relies on the metabolic function of microorganisms to convert organic pollutants into stable and harmless substances through adsorption and degradation of microorganisms, thereby achieving efficient treatment of wastewater. However, ordinary microorganisms do not have salt-tolerant and acid-tolerant properties, making it difficult to adapt to the treatment of high-salinity and high-acidity organic wastewater such as candied wastewater, so screening of degrading bacteria that can adapt to high-salinity and high-acidity organic wastewater becomes the key.

[0005] Candida is a common fungus with extensive metabolic capacity and excellent survival adaptability, which enables it to survive and reproduce in extreme wastewater environments, thus providing the possibility for biological treatment of high-salinity and high-acidity wastewater (He Y, Zhang Y, Li T, Peng X, Jia X. High-concentration COD wastewater treatment with simultaneous removal of nitrogen and phosphorus by a novel Candida tropicalis strain: Removal capability and mechanism [J]. Environmental Research, 2022, 212, 113471.). In addition, Candida has the ability to degrade various organic pollutants in wastewater, converting harmful substances in wastewater into relatively harmless products (Babler K., Sharkey M., Arenas S., Amirali A., Beaver C., Comerford. Detection of the clinically persistent, pathogenic yeast spp. Candida auris from hospital and municipal wastewater in Miami-Dade County, Florida [J]. Science of The Total Environment, 2023, 898, 165459.). SUMMARY

[0006] The present application aims at solving the problems of low treatment efficiency and poor microbial tolerance of traditional biological methods for treating high-salinity strong-acid organic wastewater, and provides a salt-tolerant and acid-tolerant Candida tropicalis.

[0007] Another object of the present application is to provide an application of the salt-tolerant and acid-tolerant Candida tropicalis in the treatment of high-salinity strong-acid organic wastewater.

[0008] To achieve the above-mentioned objects, the technical scheme adopted by the present application is as follows:

[0009] The salt-tolerant and acid-tolerant Candida tropicalis is deposited in the Guangdong Microbial Culture Collection Center, with the accession number GDMCC No: 64779, and the deposit date is June 21, 2024, and the address is No. 59, Building 5, 100, Xianlie Middle Road, Guangzhou, Guangdong Province. The Candida tropicalis is used as a microbial inoculant to treat high-salinity strong-acid organic wastewater represented by preserved fruit wastewater.

[0010] The nucleotide sequence of the Candida tropicalis is shown in the sequence table SEQ ID. No 1, and is as follows: CCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC.

[0011] The individual morphology of the Candida tropicalis is as follows: the colony is white, slightly yellow, opaque, round, and the surface is smooth and moist.

[0012] The salt tolerance (in terms of NaCl mass) of the Candida tropicalis strain is 10-80 g / L, and the strain can grow at a pH value of 2-10.

[0013] The application also provides a use of the salt-tolerant and acid-tolerant Candida tropicalis strain in high-salt and strong-acid organic wastewater treatment.

[0014] The pure culture fermentation broth is inoculated into a reactor provided with a filler, and the biofilm is formed in 3 days.

[0015] In the wastewater treatment process, the organic load design value of biological treatment is 2.5-4 kg-COD / m 3 .d, to ensure the efficiency and stability of the treatment process.

[0016] In the wastewater treatment process, the operating parameters of the reactor, including reaction time, aeration amount, stirring speed, etc., can be adjusted according to the influent COD concentration, salinity, pH value, and required effluent water quality, to optimize the treatment effect.

[0017] In the wastewater treatment process, the effluent water quality and COD removal rate can be monitored regularly, and the treatment conditions can be adjusted according to the monitoring results to ensure that the effluent water quality meets the discharge standard or reuse requirements.

[0018] The outstanding technical effects of the application are:

[0019] 1. Efficient degradation: The Candida tropicalis strain of the application exhibits excellent salt and acid tolerance, can stably survive in high-salt and strong-acid wastewater, and rapidly degrade organic pollutants in the wastewater, thereby efficiently purifying the wastewater; it can grow at a salinity of 1%-8% and a pH value of 2-10, and is suitable for directly treating high-salt and strong-acid organic wastewater, achieving pH value improvement and COD removal.

[0020] 2. Wide applicability: The strain of the application can solve the problems of difficult biochemical treatment and high treatment cost of high-salt and strong-acid organic wastewater, and is suitable for treating various high-salt and strong-acid organic wastewater, such as candied fruit wastewater.

[0021] 3. Environmental friendliness: Compared with traditional chemical treatment methods, biological treatment is more environmentally friendly and reduces the risk of secondary pollution.

[0022] 4. Economic benefits: The treatment cost is reduced, and the economic benefits of wastewater treatment are improved. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1This is a diagram showing the colony morphology characteristics of salt- and acid-tolerant Candida tropicalis strains;

[0024] Figure 2 This is a diagram of the individual morphological characteristics of salt- and acid-tolerant Candida tropicalis strains;

[0025] Figure 3 The effect of pH on the growth curve of salt- and acid-tolerant Candida tropicalis;

[0026] Figure 4 The effect of salinity on the growth curve of salt- and acid-tolerant Candida tropicalis;

[0027] Figure 5 The COD removal effect of salt- and acid-tolerant tropical Candida in treating preserved fruit wastewater at pH=2;

[0028] Figure 6 The COD removal effect of salt- and acid-tolerant tropical Candida in treating preserved fruit wastewater at pH=3;

[0029] Figure 7 The COD removal effect of salt- and acid-tolerant tropical Candida in treating preserved fruit wastewater at pH=4;

[0030] Figure 8 Effect of salinity on COD removal rate of preserved fruit wastewater by salt- and acid-tolerant tropical yeast Candida albicans. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the following embodiments will further illustrate the present invention in conjunction with the accompanying drawings. It should be understood that the specific embodiments described herein are merely for explaining the present invention and are not intended to limit the present invention. On the contrary, the present invention encompasses any substitutions, modifications, equivalent methods and solutions made within the spirit and scope of the present invention as defined by the claims. Furthermore, in order to provide the public with a better understanding of the present invention, some specific details are described in detail in the following detailed description of the present invention. Those skilled in the art can fully understand the present invention without the description of these details. Where not described in detail, existing methods may be adopted.

[0032] The present invention provides a salt- and acid-tolerant tropical Candida species (Candidasp. Y1), deposited with GDMCC No. 64779. The species was deposited with Guangdong Provincial Center for Microbiological Culture Collection on June 21, 2024, at Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0033] The Candida tropicalis above is separated from the activated sludge of the candied fruit wastewater treatment device, and the colony morphology on the screening plate is milky white, slightly yellow, flat; through ITS sequencing, it is determined as Candida tropicalis, and the internal number is Y1.

[0034] Example 1 Isolation and identification of Candida tropicalis strain

[0035] (1) Sample source: activated sludge of candied fruit wastewater treatment device.

[0036] (2) Acidic high-salt YM solid medium formula and preparation: tryptone 5 g, malt extract powder 3 g, sodium chloride 30 g, gellan gum 15 g, water 1000 mL, adjust pH to 3 with HCl, autoclave at 121℃ for 20 min.

[0037] (3) Isolation and purification steps: take 10 mL of activated sludge of candied fruit wastewater treatment device, add to a conical flask containing 90 mL of sterilized medium, shake at 30℃, 2000 r / min for 30 min, then dilute by 10 times, take 0.1 mL of bacterial suspension with dilution multiples of 10 -1 , 10 -2 , 10 -3 and spread on the plate, and culture at 30℃. The colonies grown on the plate are re-isolated and purified by dilution and spreading method until pure culture is obtained, and then preserved in 30% glycerol at -80℃. The isolated pure strain is inoculated on the plate and cultured at 30℃, and the morphological characteristics of the colonies are observed and recorded to determine Candida tropicalis. As shown in Figure 1 、 Figure 2 , the individual morphology of Candida tropicalis is: the colony is white, slightly yellow, opaque, round, smooth and moist.

[0038] (4) ITS sequencing and results: The isolated pure strain was subjected to ITS sequencing, and the sequencing result sequence was: CCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC;

[0039] The similarity with Candida tropicalis was 99%, and it was determined as Candida tropicalis.

[0040] Example 2 Influence of pH and salinity on growth curve of Candida tropicalis

[0041] By drawing the growth curves under different initial pH values and NaCl salinity, the growth characteristics of Candida tropicalis were studied. Figure 3 The growth curves of Candida tropicalis under different initial pH values are shown, and the process does not control the pH value, and the salinity is 3%. It can be seen that Candida tropicalis can grow in the pH range of 2-10. When the initial pH value increases from 2 to 7, the growth rate increases, and when the initial pH value increases to 10, the growth rate decreases. The optimal pH value is 7 and 8. Figure 4 The growth curves of Candida tropicalis under different NaCl salinity are shown, and the initial pH value is 3. It can be seen that Candida tropicalis can grow in the salinity range of 1%-8%. When the salinity is 3%, 4%, and 5%, it can maintain rapid growth. When the salinity continues to increase to 6%, 7%, and 8%, the growth is inhibited. The optimal salinity range is 3%-5%.

[0042] The results show that the bacteria can grow in the pH range of 2-10 and salinity range of 1%-8%, but the optimal growth conditions are pH 7-8 and salinity 3%-5%.

[0043] Example 3 Influence of pH on treatment of candied fruit wastewater by Candida tropicalis

[0044] The isolated Candida tropicalis is used to treat candied fruit wastewater (candied fruit wastewater from plum processing), and the influence of different initial pH values on COD removal rate and pH increase is studied. The specific steps are as follows:

[0045] a. The above-mentioned Candida tropicalis seed liquid is expanded for pure culture;

[0046] b. The expanded bacterial liquid is added to a reactor filled with filler (polyurethane foam filler), and continuous aeration is carried out for 3 days to complete the biofilm formation, and then high-salinity acidic candied fruit wastewater is treated. The intermittent treatment method is adopted, and the reaction time of each batch is 3 days. A total of 3 groups of experiments are carried out, the salinity is 35 g / L, and the initial pH values are 2, 3 and 4, respectively.

[0047] The COD concentration is determined every certain time, and the results are shown in Figure 5 、 6 、7. With the increase of initial pH value from 2 to 4, the COD removal rate gradually increases, and the COD removal rates of initial pH value 2 and initial pH value 4 are 37%, 64%, 74% and 64%, 78%, 85% at 1 d, 2 d and 3 d, respectively. In addition, the degradation process of initial pH value 4 can achieve significant pH increase, and the pH values at 1 d, 2 d and 3 d are 5.6, 6.6 and 7.8, respectively. The pH increase of the degradation process of initial pH value 2 and 3 is limited, and the main reason is that sulfuric acid is used to adjust the pH value of candied fruit wastewater at the beginning of the reaction, and the mechanism of Candida tropicalis for treating candied fruit wastewater to increase the pH value is to consume the organic acids contained in the candied fruit wastewater to increase the pH value. The acidic Candida tropicalis cannot consume sulfuric acid. From the above results, it can be seen that the treatment of candied fruit wastewater by Candida tropicalis can tolerate acidic environment with pH as low as 2. For most of the pH and salinity treatment environment of candied fruit wastewater (pH: 3.5-4.5, salinity: about 3%), when the COD concentration of the influent is about 10000 mg / L, the treatment time can be selected as 2 to 3 days, and the organic volume load is between 2.8-3.7 kg-COD / m 3 .d.

[0048] The results show that with the increase of initial pH value from 2 to 4, the COD removal rate gradually increases, and significant pH increase can be achieved at initial pH value 4. The bacteria can tolerate acidic environment with pH as low as 2.

[0049] Example 4 Influence of salinity on treatment of candied fruit wastewater by Candida tropicalis

[0050] The isolated Candida tropicalis was used to treat candied fruit wastewater (prune processing candied fruit wastewater) according to the following steps to study the treatment effect of Candida tropicalis on candied fruit wastewater under different salinity conditions:

[0051] a. The above-mentioned Candida tropicalis seed liquid was expanded and pure cultured;

[0052] b. The expanded culture liquid was added to a reactor containing filler (polyurethane foam filler), and continuous aeration was carried out for 3 d to complete the biofilm formation, and then high-salinity and high-acid candied fruit wastewater was treated. The batch reaction time was 7 d.

[0053] As shown in Figure 8 , when the initial pH value was 3.18 and the initial COD concentration was 9950 mg / L, and the reaction time was 0.5 d, the COD removal rates under the conditions of salinity of 3%, 4%, 5%, and 7% were 51.68%, 45.35%, 47.14%, and 40.83%, respectively. Nearly half of the COD was degraded by Candida tropicalis, and then the COD removal rate gradually decreased. The COD removal rate under the condition of 3% salinity reached 84.84% at 4 d, and the COD removal rate only increased to 87.07% at 7 d, indicating that under the condition of 3% salinity, all degradation was basically completed at 4 d, and more organic matter could not be consumed. Under the conditions of 4%, 5%, and 7% salinity, the COD concentration continued to decrease after 4 d. The COD of 4% salinity decreased from 2066 mg / L at 4 d to 1618 mg / L at 7 d, and the final COD degradation rate was 83.74%. The COD of 5% salinity decreased from 2281 mg / L at 4 d to 1579 mg / L at 7 d, and the final COD degradation rate was 84.13%. The COD of 7% salinity decreased from 3509 mg / L at 4 d to 2320 mg / L at 7 d, and the final COD degradation rate was 76.69%. From the above results, it can be seen that Candida tropicalis can tolerate 7% salinity when treating candied fruit wastewater, but the COD removal rate decreases with the increase of salinity.

[0054] The results show that the strain can tolerate 7% salinity, but the COD removal rate decreases with the increase of salinity. Under the condition of 3% salinity, all degradation is basically completed at 4 d.

[0055] Experiments show that the Candida tropicalis strain has excellent salt and acid resistance, can stably survive in high-salt (1% to 8% NaCl) and strong-acid (pH 2 to 10) wastewater, and rapidly degrade organic pollutants in the wastewater, so as to efficiently purify the wastewater. The strain is suitable for directly treating high-salt and strong-acid organic wastewater, can realize pH promotion and COD removal, solves the problems that high-salt and strong-acid organic wastewater is difficult to be biologically treated and the treatment cost is high, and has good economic benefit and environmental benefit. The application has high treatment efficiency, wide application range and simple operation, and provides a new scheme for treating high-salt and strong-acid organic wastewater.

[0056] The above examples are only the preferred embodiments of the present application and should not be considered as limiting the scope of the present application. Any equivalent changes and improvements made according to the scope of the present application should still belong to the scope of the present application.

Claims

1. A salt- and acid-tolerant tropical Candida species, characterized in that Candida tropicalis Candida sp.Y1 was deposited in Guangdong Provincial Microbiological Culture Collection with the deposit number GDMCC No:64779.

2. The salt- and acid-tolerant tropical Candida species according to claim 1, characterized in that The sequence of the ITS sequencing result is shown in the sequence listing SEQ ID No.

1.

3. The salt- and acid-tolerant tropical Candida species according to claim 1, characterized in that Its salinity tolerance is 10-80 g / L in terms of NaCl mass; it grows under pH values ​​of 2-10.

4. Use of the salt- and acid-tolerant tropical Candida strain according to claim 1 in the treatment of high-salt and strong-acid organic wastewater.

5. The use according to claim 4, characterized in that The specific method is: A salt- and acid-tolerant tropical Candida species as described in claim 1 is inoculated into a reactor filled with filler, and biofilm formation is completed within 3 days. High-salt and strong-acid organic wastewater is introduced in an intermittent treatment mode, and the degradation of organic pollutants in the organic wastewater and the improvement of the effluent water quality are achieved by adjusting the influent salinity and pH value.

6. The use according to claim 4 or 5, characterized in that In the process of organic wastewater treatment, the design value of biological treatment organic load is 2.5~4 kg-COD / m 3 .d.

Citation Information

Patent Citations

  • Candida tropicalis as well as composition and application thereof

    CN102433266A

  • Candida tropicalis with function of gossypol degradation and application of candida tropicalis

    CN105274012A