EPSPS mutant protein, mutant gene and application thereof

Abstract

The present invention discloses EPSPS mutant proteins, mutant genes, and applications thereof. Specifically, the E75N mutation of the present invention can significantly enhance enzyme activity while simultaneously increasing the glyphosate tolerance concentration of wild-type rice EPSPS by approximately 20-fold. Furthermore, the E75N mutation can significantly enhance enzyme activity while simultaneously increasing the glyphosate tolerance concentration of the rice EPSPS P177S mutant to approximately 50 times that of the wild-type; significantly enhance the enzyme activity of the rice EPSPS T173I / P177S mutant to near wild-type levels, while further increasing the glyphosate tolerance concentration; and, after mutating the corresponding homologous sites, can also enhance the enzyme activity and glyphosate tolerance concentration of EPSPS in corn, wheat, soybean, cotton, and rapeseed. Transgenic plants of the rice EPSPS E75N mutant and corresponding corn, wheat, soybean, cotton, and rapeseed EPSPS mutants can all tolerate treatment with four times the recommended field dose of glyphosate.

Description

Technical Field

[0001] The invention belongs to the field of protein engineering and plant herbicide resistance, and particularly relates to an EPSPS mutant protein and a mutant gene and application thereof. Background Art

[0002] In recent years, weed control has faced significant challenges due to the rapid development of resistant weed populations and a shortage of new target herbicides. Using gene editing technology to precisely engineer crops to confer specific herbicide resistance could help expand the application range and lifespan of existing herbicides.

[0003] Glyphosate is a highly effective, broad-spectrum, systemic herbicide with broad-spectrum lethality, effective against over 40 plant families. Glyphosate targets 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). By binding to EPSPS, glyphosate inhibits its activity, ultimately leading to plant death. EPSPS catalyzes the synthesis of EPSP from phosphoenolpyruvate and shikimate-3-phosphate in the shikimate pathway. EPSP is a precursor for the biosynthesis of tryptophan, phenylalanine, and tyrosine. By inhibiting EPSPS, glyphosate interferes with the biosynthesis of aromatic amino acids, leading to a shortage of these amino acids. Ultimately, the plant dies due to a lack of tryptophan, phenylalanine, tyrosine, and secondary products of the shikimate pathway. Because many crops, such as rice, corn, and wheat, are sensitive to glyphosate, it has long been used primarily for weed control in economic crop gardens, such as orchards, tea plantations, and mulberry fields.

[0004] The discovery of glyphosate-resistance genes and the use of transgenic or gene-editing technologies to confer glyphosate resistance in sensitive crops have made glyphosate's application in arable land possible. For example, by mutating the glyphosate target site EPSPS, reducing its affinity for glyphosate, herbicide resistance can be achieved, as in the rice EPSPS T173I and P177S sites. Due to their significant application potential, the discovery of target resistance sites has become a research hotspot in the breeding of herbicide-resistant crops. However, discovering new glyphosate-resistance mutation sites remains a significant challenge. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a key mutation site that can broadly improve the glyphosate resistance of plant EPSPS proteins, a mutant gene containing the mutation site, and an expression vector that can be used to construct transformed plants and for the cultivation of glyphosate-resistant transgenic crops or gene-edited crops.

[0006] Technical solution: In order to solve the above technical problems, the present invention provides an EPSPS mutant protein, wherein the mutant protein includes the following proteins (a), (b) or (c):

[0007] (a) a wild-type rice EPSPS protein having a mutation at amino acid position 75 or at a corresponding homologous site in another plant EPSPS protein, resulting in a protein having higher 5-enolpyruvylshikimate-3-phosphate synthase activity or glyphosate resistance; the amino acid sequence of the wild-type rice EPSPS protein is shown in SEQ ID No. 1;

[0008] (b) a protein derived from (a) in which the amino acid sequence in (a) is substituted, deleted or added with one or more amino acids and has 5-enolpyruvylshikimate-3-phosphate synthase activity or glyphosate resistance;

[0009] (c) a protein having at least 85% amino acid sequence identity with any one of the EPSPS mutant proteins of (a) or (b) above, and having higher 5-enolpyruvylshikimate-3-phosphate synthase activity or glyphosate resistance than the wild type of the plant.

[0010] The mutant protein of the present invention has higher enzyme activity and glyphosate tolerance than the wild-type rice EPSPS protein. The site mutations of the protein can include 19 natural amino acid mutation forms, specifically including: K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L, or H.

[0011] Preferably, the amino acid sequence of the EPSPS mutant protein has a higher 5-enolpyruvylshikimate-3-phosphate synthase activity when the amino acid position 75 of the amino acid sequence is mutated from E to K, S, G, M, Y, N, A, V, C, W, T, D, F or I relative to the wild-type rice EPSPS protein;

[0012] Preferably, the wild-type rice EPSPS has a higher tolerance to glyphosate concentration when the amino acid E at position 75 is mutated to K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L or H;

[0013] The present invention also provides a rice EPSPS mutant protein, namely rice EPSPS E75N / P177S, which can further improve the enzyme activity and glyphosate tolerance concentration compared with the wild-type rice EPSPS.

[0014] The present invention also provides a rice EPSPS mutant protein, namely rice EPSPS E75N / T173I / P177S, which can significantly improve the enzyme activity of rice EPSPS T173I / P177S to a level close to that of wild-type rice EPSPS, while further increasing the glyphosate tolerance concentration.

[0015] Wherein, the other plants include but are not limited to corn, wheat, soybean, cotton or rapeseed, and other plants are also included;

[0016] When the plant is corn, the homologous site of the 75th amino acid site of the wild-type rice EPSPS protein is located at the 67th amino acid site of the wild-type corn EPSPS protein. Preferably, when the 67th amino acid site is mutated from E to K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L or H, the plant has a higher 5-enolpyruvylshikimate-3-phosphate synthase activity or a higher glyphosate tolerance concentration;

[0017] When the plant is wheat, the homologous site of the 75th amino acid site of the wild-type rice EPSPS protein is located at the 70th amino acid site of the wild-type wheat EPSPS protein. Preferably, when the 70th amino acid site is mutated from E to K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L or H, the plant has a higher 5-enolpyruvylshikimate-3-phosphate synthase activity or a higher glyphosate tolerance concentration;

[0018] When the plant is soybean, the homologous site of the 75th amino acid site of the wild-type rice EPSPS protein is located at the 85th amino acid site of the wild-type soybean EPSPS protein. Preferably, when the 85th amino acid site is mutated from E to K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L or H, the plant has a higher 5-enolpyruvylshikimate-3-phosphate synthase activity or a higher glyphosate tolerance concentration;

[0019] When the plant is cotton, the homologous site of the amino acid position 75 of the wild-type rice EPSPS protein is located at the amino acid position 81 of the wild-type cotton EPSPS protein. Preferably, when the amino acid position 81 is mutated from E to K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L or H, the plant has a higher 5-enolpyruvylshikimate-3-phosphate synthase activity or a higher glyphosate tolerance concentration.

[0020] When the plant is rapeseed, the homologous site of the 75th amino acid site of the wild-type rice EPSPS protein is located at the 76th amino acid site of the wild-type rapeseed EPSPS protein. Preferably, when the 76th amino acid site is mutated from E to K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L or H, the plant has a higher 5-enolpyruvylshikimate-3-phosphate synthase activity or a higher glyphosate tolerance concentration;

[0021] The present invention also provides an EPSPS mutant gene, which encodes the EPSPS mutant protein.

[0022] The EPSPS mutant gene comprises a mutation in the nucleotide 223 and / or the nucleotide 224 and / or the nucleotide 225 of the 75th amino acid encoding the EPSPS protein in the wild-type rice EPSPS gene, and a mutation in the nucleotides encoding the corresponding homologous amino acid sites in other plant EPSPS genes;

[0023] Among them, when the amino acid at position 75 of the wild-type rice EPSPS protein, the amino acid at position 67 of the wild-type corn EPSPS protein, the amino acid at position 70 of the wild-type wheat EPSPS protein, the amino acid at position 85 of the wild-type soybean EPSPS protein, the amino acid at position 81 of the wild-type cotton EPSPS protein, or the amino acid at position 76 of the wild-type rapeseed EPSPS protein is E, the corresponding base is gag, and when it mutates to K, the corresponding base is aaa or aag; when it mutates to S, the corresponding base is tct, tca, tcc, tcg, agt, or agc; when it mutates to G, the corresponding base is ggt, ggc, gga, or ggg; when it mutates to M, the corresponding base is atg; when it mutates to Y, the corresponding base is tat or tac; when it mutates to N, the corresponding base is aat or aac; when it mutates to A, the corresponding base is gct, gcc , gca or gcg; when it mutates to V, the corresponding base is gtt, gtc, gta or gtg; when it mutates to C, the corresponding base is tgt or tgc; when it mutates to W, the corresponding base is tgg; when it mutates to T, the corresponding base is act, acc, acg or aca; when it mutates to D, the corresponding base is gat or gac; when it mutates to F, the corresponding base is ttt or ttc; when it mutates to I, the corresponding base is att, atc or ata; when it mutates to P, the corresponding base is cct, cca, ccg or ccc; when it mutates to Q, the corresponding base is caa or cag; when it mutates to R, the corresponding base is cgt, cgc, cgg, cga, aga or agg; when it mutates to L, the corresponding base is ctt, ctc, cta, ctg, tta or ttg; when it mutates to H, the corresponding base is cat or cac;

[0024] Preferably, the base sequences corresponding to the mutation of the wild-type EPSPS protein to different amino acids are shown in Table 2, and the rice wild-type EPSPS gene sequence is shown in SEQ ID No. 2;

[0025] Preferably, the EPSPS mutant gene further comprises a mutation in the nucleotides encoding the 173rd amino acid and / or the 177th amino acid of the wild-type rice EPSPS protein or the corresponding homologous amino acid sites of other plant EPSPS proteins; preferably, the bases at nucleotides 517 to 519 encoding the 173rd amino acid of the wild-type rice EPSPS protein or the homologous amino acid sites of other plant EPSPS proteins are att, atc or ata; and the bases at nucleotides 529 to 531 encoding the 177th amino acid of the wild-type rice EPSPS protein or the homologous amino acid sites of other plant EPSPS proteins are tct, tca, tcc, tcg, agt or agc.

[0026] The other plants include but are not limited to corn, wheat, soybean, cotton or rapeseed, and other plants are also included.

[0027] The present invention also includes an expression cassette, a recombinant vector or a recombinant bacterium, which contains the EPSPS mutant gene.

[0028] The present invention also includes the use of the EPSPS mutant protein, the EPSPS mutant gene, the expression cassette, the recombinant vector or the recombinant bacteria in cultivating glyphosate-resistant plants.

[0029] The application includes obtaining plants with glyphosate resistance by gene editing, transgenic, mutagenesis, hybridization, backcrossing or asexual reproduction methods.

[0030] Wherein, the glyphosate-resistant plant comprises the EPSPS mutant gene or expresses the EPSPS mutant protein.

[0031] Beneficial Effects: Compared to existing technologies, the present invention offers the following advantages: By comparing the growth curves of rice mutants and wild-type EPSPS-complementing auxotrophic Escherichia coli, the present invention demonstrates that mutations at amino acid position 75 improve the enzyme activity or glyphosate tolerance of rice EPSPS. The E75N mutation significantly enhances enzyme activity while increasing the glyphosate tolerance concentration of wild-type rice EPSPS by approximately 20-fold. Furthermore, the E75N mutation significantly increases enzyme activity while also increasing the glyphosate tolerance concentration of the rice EPSPS P177S mutant to approximately 50-fold that of the wild-type. The enzyme activity of the rice EPSPS T173I / P177S mutant is significantly increased to near the level of wild-type rice EPSPS, while further increasing the glyphosate tolerance concentration. Mutating the corresponding homologous sites also enhances the enzyme activity and glyphosate tolerance concentration of EPSPS in corn, wheat, soybeans, cotton, and rapeseed. The rice EPSPS E75N mutant and the corresponding corn, wheat, soybean, cotton, and rapeseed EPSPS mutant transgenic plants can all tolerate glyphosate treatment at four times the recommended field dose. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Comparison of amino acid sequences of EPSPS from different plants;

[0033] Figure 2 Growth curves of Escherichia coli auxotrophic bacteria complemented with different EPSPS;

[0034] Figure 3 Effects of glyphosate treatment on transgenic plants of rice EPSPS mutants;

[0035] Figure 4 Effects of glyphosate treatment on transgenic wheat EPSPS mutant plants;

[0036] Figure 5 Effects of glyphosate treatment on cotton EPSPS mutant transgenic plants;

[0037] Figure 6 Effects of glyphosate treatment on soybean EPSPS mutant transgenic plants;

[0038] Figure 7 Effects of glyphosate treatment on transgenic plants of rapeseed EPSPS mutant;

[0039] Figure 8 Effects of glyphosate treatment on maize EPSPS mutant transgenic plants. DETAILED DESCRIPTION

[0040] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0041] Example 1 Screening of Rice EPSPS Mutants

[0042] Glyphosate-resistant rice EPSPS mutants were screened using spontaneous mutants of Escherichia coli XL-1Red. The specific steps were as follows: a synthetic rice wild-type EPSPS gene fragment (GeneScript, sequence shown as SEQ ID No. 2) and a pSC-19 plasmid (the pUC19 vector replication origin was replaced with pSC101, and the lacO residue was deleted to release repression; the sequence of the pSC-19 plasmid is shown as SEQ ID No. 3) were used as templates. The rice wild-type EPSPS gene fragment and the pSC-19 linearized vector were amplified using a high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase, Novagen).

[0043] The primer sequences for amplifying the EPSPS mutant fragment are as follows:

[0044] F:5'- ACACAGGAAACAGCT ATGGCGGCGACCATGG-3';

[0045] R:5'- TCGGGGCTGGCTTAA TCAGTTCCTGACGAAAGTGCTTAGAACG-3'.

[0046] The primer sequences for amplifying the linearized pSC-19 vector are as follows:

[0047] F:5'-TTAAGCCAGCCCCGACACC-3';

[0048] R:5'-AGCTGTTTCCTGTGTGAAAGAAACCG-3'.

[0049] The PCR annealing temperature was 55°C, and the system and other reaction conditions were carried out according to the instructions of the Novozyme high-fidelity enzyme.

[0050] The PCR product of the amplified wild-type rice EPSPS gene fragment and the pSC-19 linearized vector product were purified and ligated (ClonExpress II One Step Cloning Kit, Novex) to replace the lacZα open reading frame in the plasmid. The ligation product was transformed into Escherichia coli DH5α, and after clones grew, transformants were selected for sequencing verification. Transformants with correct sequencing results were transferred and the plasmid was extracted to obtain the rice wild-type EPSPS complementing plasmid (FastPure Plasmid Mini Kit, Novex). This plasmid was transformed into Escherichia coli XL-1 Red competent cells (Agilent), and transformants were subcultured on M9 minimal medium plates containing 5 mM glyphosate. Growing colonies were selected for culture, and the plasmid was extracted (FastPure Plasmid Mini Kit, Novex) for sequencing to identify the rice EPSPS mutation. This screening method initially identified a glyphosate-resistant rice EPSPS mutant protein, namely, rice EPSPS E75K.

[0051] Example 2: Enzyme activity and resistance evaluation of EPSPS and related mutants

[0052] After the preliminary screening of EPSPS mutants in Example 1, the enzyme activity and resistance were subsequently verified for a second time.

[0053] 1. Obtaining auxotrophic Escherichia coli: The EPSPS gene aroA of Escherichia coli BL21(DE3) was knocked out using the well-known λ-Red homologous recombination method (An efficient recbination system for chromosome engineering in Escherichia coli. PNAS 200097(11)5978-5983; May 16, 2000, doi:10.1073 / pnas.100127597.). The obtained amino acid auxotrophic Escherichia coli were used to evaluate the enzyme activity and resistance of EPSPS and related mutants. Escherichia coli BL21(DE3)::ΔaroA competent cells were prepared using the Super Competent Preparation Kit (Biyuntian Company), and the specific operations were carried out according to the instructions.

[0054] 2. Construction of EPSPS complementing plasmid: Using the wild-type EPSPS gene of wheat (SEQ ID No. 5), wild-type EPSPS gene of cotton (SEQ ID No. 6), wild-type EPSPS gene of soybean (SEQ ID No. 7), wild-type EPSPS gene of rapeseed (SEQ ID No. 8), wild-type EPSPS gene of corn (SEQ ID No. 9) and pSC-19 plasmid (the replication origin of pUC19 vector was replaced with pSC101, and lacO was deleted to release repression, the sequence of the pSC-19 plasmid is shown in SEQ ID No. 3) synthesized by GenScript as templates, a high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase (Novagen) was used to amplify the EPSPS gene fragment (primer sequences for each plant species are shown in Table 1) and the pSC-19 linearized vector (F: 5'-TTAAGCCAGCCCCGACACC-3'; R: 5'-AGCTGTTTCCTGTGTGAAAGAAACCG-3'). PCR annealing temperature was 55°C, and all other reaction conditions were followed according to the manufacturer's instructions. PCR products of wild-type EPSPS fragments from wheat, cotton, soybean, rapeseed, and maize, along with the pSC-19 linearized vector, were purified and ligated (ClonExpress II One Step Cloning Kit, Novagen) to replace the lacZα open reading frame in the plasmid. The ligation products were transformed into Escherichia coli DH5α, and transformants were selected for sequencing verification after colonies emerged. Transformants that were sequenced correctly were then ligated and plasmids extracted to generate the wild-type EPSPS complementing plasmids for wheat, cotton, soybean, rapeseed, and maize (FastPure Plasmid Mini Kit, Novagen) for use.

[0055] 3. The wild-type EPSPS complementing plasmid of rice constructed in Example 1 and the wild-type EPSPS complementing plasmids of wheat, cotton, soybean, rapeseed, and corn constructed in this example were respectively transformed into the Escherichia coli BL21(DE3)::ΔaroA competent cells prepared in this example to evaluate EPSPS enzyme activity and resistance using growth curves.

[0056] Table 1 Primers for constructing EPSPS complementation vectors for maize, wheat, cotton, soybean and rapeseed

[0057]

[0058] 4. Site-directed mutagenesis of EPSPS: Using the above-mentioned rice wild-type EPSPS complementing plasmid as a template, PCR was used to perform site-directed mutagenesis to construct the rice EPSPS E75 saturation mutant. GCGGCGAAGGCGGAGPCR amplification (Phanta Max Super-Fidelity DNA Polymerase, Novagen) was performed using the following sequence: nnnATCGTGCTCCAGCCCATCAGGGAGATCTCCG-3'; R: 5'-CTCCGCCTTCGCCGCCGGC-3' (uppercase letters indicate template-specific sequences; lowercase letters nnn represent sequences identical to the mutated amino acid codons; the specific base sequences are shown in Table 2; the underlined portion indicates the recombinant homology arm sequence). PCR annealing temperature was 55°C, and the PCR system and other reaction conditions were determined according to the manufacturer's instructions. The PCR product was digested with the restriction endonuclease Dpn I and circularized using the ClonExpress II One Step Cloning Kit, Novagen. The ligation products were transformed into Escherichia coli DH5α. After clones were grown, transformants were selected for sequencing to verify the correct transfer sequencing. Rice EPSPS site-directed mutants E75N, E75G, E75A, E75V, E75L, E75I, E75P, E75F, E75Y, E75W, E75S, E75T, E75C, E75M, E75Q, E75D, E75K, E75R, and E75H were extracted and prepared (FastPure Plasmid MiniKit, Norwegian). These plasmids were transformed into E. coli BL21(DE3)::ΔaroA competent cells prepared in this example for growth curve assessment of EPSPS enzyme activity and resistance.

[0059] Table 2 Base sequences corresponding to the mutated amino acid codons in the site-directed mutagenesis primers

[0060] Mutated amino acid Base sequence in the primer (5'-nnn-3') G GGA A GCA V GTA L CTA I ATT P CCA F TTC Y TAT W TGG S TCA T ACT C TGT M ATG N AAC Q CAA D GAT K AAG R CGA H CAT

[0061] 5. Using the above constructed rice EPSPS site-directed mutant E75N plasmid as a template, PCR was used to perform site-directed mutagenesis to construct a rice EPSPS E75N / P177S combined mutant. GGAACTGCAATGCGAAGTTTGACAGCAGCCGTGACTGC-3'; R: 5'-TCGCATTGCAGTTCCAGCG-3' (the underlined part is the recombinant homology arm sequence) was PCR amplified (Phanta Max Super-Fidelity DNA Polymerase, Novagen), the PCR annealing temperature was 55°C, and the system and other reaction conditions were carried out according to the instructions. After the PCR product was digested with the restriction endonuclease Dpn I, it was circularized using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novagen). The ligation product was transformed into Escherichia coli DH5α. After the clones grew out, the transformants were picked for sequencing to verify the correct transformants for transfer sequencing, and the rice EPSPS combination mutant E75N / P177S plasmid (FastPure Plasmid Mini Kit, Novagen) was extracted for use. The plasmid was transformed into the Escherichia coli BL21 (DE3):: ΔaroA competent cells prepared in this example for use in evaluating EPSPS enzyme activity and resistance using a growth curve.

[0062] 6. Using the rice EPSPS combination mutant E75N / P177S plasmid constructed above as a template, PCR was used for site-directed mutagenesis to construct the rice EPSPS E75N / T173I / P177S combination mutant. Primers F: 5'-GCAATGCGAAGTTTGACAGCAGC-3'; R: 5'- CAAACTTCGCATTGC AATTCCAGCGTTCCCCAAGAAGAGT-3' (the underlined part is the recombinant homology arm sequence) was PCR amplified (Phanta Max Super-Fidelity DNA Polymerase, Novozyme), the PCR annealing temperature was 55 ° C, and the system and other reaction conditions were carried out according to the instructions. After the PCR product was digested with the restriction endonuclease Dpn I, it was circularized using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novozyme). The ligation product was transformed into Escherichia coli DH5α, and after the clones grew out, the transformants were picked for sequencing verification. The transformants with correct transfer sequencing were extracted and the rice EPSPS E75N / T173I / P177S combined mutant plasmid (FastPure Plasmid Mini Kit, Novozyme) was obtained for standby use. The plasmid was transformed into the Escherichia coli BL21 (DE3) prepared in this example:: ΔaroA competent cells for use in evaluating EPSPS enzyme activity and resistance using a growth curve.

[0063] 7. Using the aforementioned complementing plasmids for EPSPS of maize, wheat, cotton, soybean, and rapeseed as templates, site-directed mutagenesis was performed at the homologous sites corresponding to rice EPSPS E75 using PCR. PCR amplification was performed using the primers listed in Table 3 (Phanta Max Super-Fidelity DNA Polymerase, Novagen). The PCR annealing temperature was 55°C, and the system and other reaction conditions were determined according to the manufacturer's instructions. The PCR product was digested with the restriction endonuclease Dpn I and circularized using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novagen). The ligation product was transformed into Escherichia coli DH5α. After clones were grown, transformants were selected for sequencing to verify the correct transformants. The maize E67N plasmid, wheat E70N plasmid, soybean E85N plasmid, cotton E81N plasmid, and rapeseed E76N plasmid were extracted and prepared (FastPure Plasmid Mini Kit, Novagen) for later use. The above plasmid was transformed into the E. coli BL21(DE3)::ΔaroA competent cells prepared in this example for use in evaluating EPSPS enzyme activity and resistance using a growth curve.

[0064] Table 3 EPSPS site-directed mutagenesis primers for maize, wheat, cotton, soybean and rapeseed

[0065]

[0066] 8. The wild-type EPSPS complementing plasmid of rice constructed in Example 1, the EPSPS complementing plasmids of wild-type wheat, cotton, soybean, rapeseed, and corn, the rice EPSPS site-directed mutant E75N plasmid, E75G plasmid, E75A plasmid, E75V plasmid, E75L plasmid, E75I plasmid, E75P plasmid, E75F plasmid, E75Y plasmid, E75W plasmid, E75S plasmid, E75T plasmid, E75C plasmid, E75M plasmid, E75Q plasmid, E75D plasmid, E75K plasmid, E75R plasmid, E75H plasmid, the rice EPSPSSE75N / P177S combined mutant plasmid, and the rice EPSPS Escherichia coli BL21(DE3)::ΔaroA expressing E75N / T173I / P177S combined mutant plasmid, maize E67N plasmid, wheat E70N plasmid, soybean E85N plasmid, cotton E81N plasmid, and rapeseed E76N plasmid were streaked on LB plates containing ampicillin (100 ppm). Normally growing single colonies were picked and inoculated into 24-well deep-well plates. The deep-well plates contained 300 μL of M9 liquid medium (6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 0.5 g / L NaCl, 1.0 g / L NH4Cl, 0.241 g / L MgSO4, 0.011 g / L CaCl2, and 4 g / L glucose) containing ampicillin (100 ppm). Different concentrations of glyphosate (40 μM to 5 mM) were added according to the actual situation to evaluate the herbicide resistance of the bacteria. The bacteria were shaken at 37°C using a microplate reader, and the OD value of the deep-well plates was measured every 20 min. 600 nm The enzyme activity of different EPSPS was determined by comparing the growth curve trends when glyphosate was not added; the tolerance of different EPSPS to glyphosate was determined by comparing the growth curve trends when glyphosate was added at the same concentration.

[0067] according to Figure 2 The growth curve results showed that when the 75th amino acid E of rice EPSPS was mutated to K, S, G, M, Y, N, A, V, C, W, T, D, F, or I, its enzyme activity was improved; and when it was mutated to any of the other 19 amino acids, the glyphosate tolerance concentration was higher than that of the wild type; at the same time, the E75N mutation could significantly improve the enzyme activity and glyphosate tolerance concentration of rice EPSPS T173I / P177S and P177S mutants; in addition, at the homologous sites corresponding to the EPSPS E75N mutation in corn, wheat, cotton, soybean, and rapeseed, the enzyme activity and glyphosate tolerance concentration of the corresponding plants were all improved.

[0068] Example 3: Agrobacterium-mediated genetic transformation of rice and identification of transgenic positive plants

[0069] 1. Construction of rice expression vector for mutant gene and Agrobacterium transformation

[0070] According to the coding region sequence of rice EPSPS gene (SEQ ID No.2), gene-specific primers with restriction sites added at both ends (F:5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGGCGGCGACCATGGC-3'R:5'- GACTCCTC TTAGAATTCCCGGGGATCC TCAGTTCCTGACGAAAGTGCTTAGAACG-3', the underlined part is the homology arm), the rice EPSPS site-directed mutant E75N plasmid constructed in Example 2 was used as a template to amplify the gene sequence containing the corresponding mutant EPSPS-E75N protein, and the corresponding mutation vector was constructed by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian) (with pCAMBIA1390 vector as the backbone, Hyg as the screening marker gene, and the expression cassette of the ZmUbi promoter-NOS terminator to drive the expression of the target gene. The complete sequence of the vector is shown in SEQ ID No. 4, and the insertion site is BamH I). The vector was aligned with the wild-type rice EPSPS gene sequence using Vector NIT software to verify the correctness of the gene mutation site of the EPSPS-E75N protein and the promoter linker, and an expression vector of the mutant rice EPSPS-E75N gene with the corresponding mutation site was constructed. The constructed plasmid vector was transformed into Agrobacterium EHA105 and the bacteria were cultured. The conventional Agrobacterium-mediated transformation of japonica rice Nipponbare was performed according to the method described in the literature (Agrobacterium-mediated transformation of rice using immature embryos or calliinduced from mature seeds [J]. Nat Protoc, 2008; 3(5): 824-34.).

[0071] The transgenic rice seedlings obtained in the above steps were transplanted into nutrient soil. When the seedlings reached the three-leaf stage, leaves were collected from the transgenic seedlings and DNA samples were extracted using the CTAB method for subsequent testing. The PCR products were amplified using the gene-specific primers described in this example, and the correct amino acid sequence at the mutation site was verified by sequencing to identify positive transgenic plants.

[0072] 2. Glyphosate treatment of transgenic plants expressing mutant EPSPS-E75N protein

[0073] Transgenic rice seedlings, identified through molecular testing, were transplanted into large pots in the greenhouse and evenly distributed across the experimental area. Foliar spraying was performed at 4X the recommended concentration for glyphosate (840 g ae / ha is the generally accepted recommended field concentration for glyphosate). Transgenic-positive plants were treated with a pressure sprayer, ensuring even distribution of droplets across the leaf surface. Transgenic recipient varieties served as controls. The plants were cultured for approximately 10 days, and their growth was observed.

[0074] The mutant rice plants and wild type rice plants were sprayed with 0X and 4X respectively, and the growth status of the plants in each group was recorded after 10 days. Figure 3 The results show that after spraying 0X glyphosate, both the mutant and wild-type rice plants grew well. After spraying 4X glyphosate, the wild-type plants showed no resistance and died. The mutant rice plants showed significant resistance to glyphosate at 4X and grew well. In summary, the rice mutant containing EPSPS-E75N exhibited significantly better glyphosate resistance than the wild-type.

[0075] Example 4: Agrobacterium-mediated genetic transformation of wheat and identification of transgenic positive plants

[0076] 1. Construction of wheat expression vector for mutant gene and Agrobacterium transformation

[0077] According to the coding region sequence of wheat EPSPS gene (SEQ ID No.5), gene-specific primers with restriction sites added at both ends (F:5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGGCGATGGCTGCCG-3'R:5'- GACTCCTCT TAGAATTCCCGGGGATCCCTAGTTCTTGACGAAGGTGCTTAGCA-3', the underlined part is the homology arm), using the wheat EPSPS site-directed mutant E70N vector constructed in Example 2 as a template, amplifying the gene sequence containing the corresponding mutant EPSPS-E70N protein, and constructing the corresponding mutation vector (using the pCAMBIA1390 vector as the backbone, Bar as the screening marker gene, and the expression cassette of the ZmUbi promoter-NOS terminator to drive the expression of the target gene by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian) by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian). The complete sequence of the vector is shown in SEQ ID No. 4, and the insertion site is BamH I. The vector is aligned with the wild-type wheat EPSPS gene sequence using Vector NIT software to verify the correctness of the EPSPS-E70N gene mutation site and the promoter linker, and an expression vector of the mutant wheat EPSPS-E70N gene corresponding to the mutation site is constructed. The constructed plasmid vector is transformed into Agrobacterium EHA105 and the bacteria are cultured. The conventional Agrobacterium-mediated method was used to transform the Fielder variety of wheat, and the transformation operation process was carried out according to the method described in the reference (An efficient and reproducible Agrobacterium-mediated transformation method for hexaploid wheat (Triticumaestivum L.) [J]. Plant Methods, 2019; 15 (121)).

[0078] The transgenic wheat seedlings obtained in the above steps were transplanted into nutrient soil. When the seedlings reached the three-leaf stage, leaves of the transgenic seedlings were collected and DNA samples were extracted using the CTAB method for subsequent testing. The PCR products were amplified using the gene-specific primers described in this example, and the correctness of the amino acid sequence at the mutation site was verified by sequencing to identify positive transgenic plants.

[0079] 2. Glyphosate treatment of transgenic plants expressing mutant EPSPS-E70N protein

[0080] Transgenic wheat seedlings, identified through molecular testing and screening, were transplanted into large pots in the greenhouse and evenly distributed across the experimental area. Foliar spraying was performed at 4X the recommended concentration for glyphosate (840 g ae / ha is the generally accepted recommended field concentration for glyphosate). Transgenic-positive plants were foliarly sprayed using a pressure sprayer, ensuring even distribution of droplets across the leaf surface. Transgenic recipient varieties served as controls. After one week of incubation, the growth of the corresponding plants was observed.

[0081] The mutant wheat plants and wild-type wheat plants were sprayed with 0X and 4X respectively, and the growth status of the plants in each group was recorded after 10 days. Figure 4 As can be seen from the results, after spraying 0X glyphosate, the mutant and wild-type wheat plants grew well. After spraying 4X glyphosate, the wild-type plants had no resistance, and their leaves withered and died. The mutant wheat plants had obvious resistance to glyphosate at 4X and grew well. In summary, the wheat mutant containing EPSPS-E75N is significantly more resistant to glyphosate than the wild-type.

[0082] Example 5: Agrobacterium-mediated genetic transformation of cotton and identification of transgenic positive plants

[0083] 1. Construction of cotton expression vector for mutant gene and Agrobacterium transformation

[0084] Based on the coding region sequence of cotton EPSPS gene (SEQ ID No.6), cotton gene-specific primers (F:5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGGCAACGCAGGTTGGC-3'R:5'- G ACTCCTCTTAGAATTCCCGGGGATCC TCAGTGCTTCGTAACTCTATCGAGAACT-3', the underlined part is the homology arm), the cotton EPSPS site-directed mutant E81N vector constructed in Example 2 was used as a template to amplify the corresponding mutant EPSPS gene sequence, and the corresponding mutation vector was constructed by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian) (with pCAMBIA1390 vector as the backbone, aadA as the screening marker gene, and the expression cassette of the ZmUbi promoter-NOS terminator to drive the expression of the target gene. The complete sequence of the vector is shown in SEQ ID No. 4, and the insertion site is BamH I). The vector was aligned with the wild-type cotton EPSPS gene sequence using Vector NIT software to verify the correctness of the EPSPS gene mutation site and the promoter linker, and an expression vector of the mutant cotton EPSPS-E75N gene corresponding to the mutation site was constructed. The constructed plasmid vector was transformed into Agrobacterium EHA105 and the bacteria were cultured. The conventional Agrobacterium-mediated method was used to transform the Baimian No. 1 cotton variety, and the operation process was carried out according to the method described in the reference (Efficient genotype-independent cotton genetic transformation and genome editing [J]. J Integr Plant Biol. 2023; 65(4): 907-917.).

[0085] The transgenic cotton seedlings obtained in the above steps were transplanted into nutrient soil. When the seedlings reached the three-leaf stage, leaves of the transgenic seedlings were collected and DNA samples were extracted using the CTAB method for subsequent testing. The PCR products were amplified using the gene-specific primers described in this example, and the correctness of the amino acid sequence at the mutation site was verified by sequencing to identify positive transgenic plants.

[0086] 2. Glyphosate treatment of transgenic plants expressing mutant EPSPS-E81N protein

[0087] Transgenic cotton seedlings, identified through molecular testing and screening, were transplanted into large pots in the greenhouse and evenly distributed across the experimental area. Foliar spraying was performed at 4X the recommended concentration for glyphosate (840 g ae / ha is the generally accepted field concentration for glyphosate, and 4X the recommended concentration is 4 x 840 = 3360 g ae / ha). Transgenic-positive plants were foliarly sprayed using a pressure sprayer, ensuring even distribution of droplets across the leaf surface. Transgenic recipient varieties served as controls. After one week of cultivation, the growth of the corresponding plants was observed.

[0088] The mutant cotton plants and wild-type cotton plants were sprayed with 0X and 4X respectively and observed after 7 days. The growth status of each group of plants was recorded. Figure 5 As can be seen from the results, after spraying 0X glyphosate, the mutant and wild-type cotton plants grew well. After spraying 4X glyphosate, the wild-type plants had no resistance, with leaves withering, slow growth, and death. The mutant cotton plants showed significant resistance to glyphosate at 4X and grew well. In summary, the cotton mutant containing EPSPS-E75N is significantly more resistant to glyphosate than the wild-type.

[0089] Example 6: Agrobacterium-mediated genetic transformation of soybean and identification of transgenic plants

[0090] 1. Construction of soybean expression vector for mutant gene and Agrobacterium transformation

[0091] Based on the coding region sequence of soybean EPSPS gene (SEQ ID No.7), soybean gene-specific primers (F:5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGGCCCAAGTGAGCAGAGT-3'R:5'- GACTCCTCTTAGAATTCCCGGGGATCCTTAGTGCTTTGTTAACCTCTCAAGGACTTCA-3', the underlined part is the homology arm), the soybean EPSPS site-directed mutant E85N vector constructed in Example 2 was used as a template to amplify the corresponding mutant EPSPS gene sequence, and the corresponding mutation vector was constructed by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian) (with pCAMBIA1390 vector as the backbone, aadA as the screening marker gene, and the expression cassette of the ZmUbi promoter-NOS terminator to drive the expression of the target gene. The complete sequence of the vector is shown in SEQ ID No. 4, and the insertion site is BamH I), and the EPSPS gene sequence of the wild-type cotton was aligned using Vector NIT software to verify the correctness of the EPSPS gene mutation site and the promoter linker, and an expression vector of the mutant soybean EPSPS gene corresponding to the mutation site was constructed. The constructed plasmid vector was transformed into Agrobacterium EHA105 and the bacteria were cultured. The conventional Agrobacterium-mediated method was used to transform the Tianlong No. 1 soybean variety. The operation process was carried out according to the method described in the reference (Development of an efficient marker-free soybean transformation method using the novel bacterium Ochrobactrum haywardense H1[J].Plant Biotechnol J.2022;20(5):977-990.).

[0092] The transgenic soybean seedlings obtained in the above steps were transplanted into nutrient soil. When the seedlings reached the three-leaf stage, leaves of the transgenic seedlings were collected and DNA samples were extracted using the CTAB method for subsequent testing. The PCR products were amplified using the gene-specific primers described in this example, and the correctness of the amino acid sequence at the mutation site was verified by sequencing to identify positive transgenic plants.

[0093] For the offspring of mutant EPSPS-E85N transgenic soybeans, the offspring of transgenic positive individual plants were selected and planted in soil. When the seedlings grew to the 3-leaf stage, each individual plant was extracted as a template and the correctness of the amino acid sequence of the mutation site was verified by amplification with gene-specific primers in the present embodiment. DNA was extracted using the CTAB method for subsequent testing. The PCR product fragment length can be used to clearly determine whether the transgenic plant obtained is positive, and the PCR product is confirmed as a positive transgenic plant through sequencing.

[0094] 2. Glyphosate treatment of transgenic soybeans expressing mutant EPSPS-E85N protein

[0095] Transgenic soybean seedlings, identified through molecular testing and screening, were transplanted into large pots in the greenhouse and evenly distributed across the experimental area. Foliar spraying was performed at 4X the recommended concentration for glyphosate (840 g ae / ha is the generally accepted recommended field concentration for glyphosate). Transgenic-positive plants were treated with a pressure sprayer, ensuring even distribution of droplets across the leaf surface. Transgenic recipient varieties served as controls. After one week of incubation, the growth of the corresponding plants was observed.

[0096] The mutant soybean plants and wild-type rice plants were sprayed with 0X and 4X respectively and observed after 7 days. The growth status of each group of plants was recorded. Figure 6 As can be seen from the results, after spraying 0X glyphosate, the mutant and wild-type soybean plants grew well. After spraying 4X glyphosate, the wild-type plants had no resistance, their leaves withered, and they died. The mutant soybean plants showed significant resistance to glyphosate at 4X and grew well. In summary, the soybean mutant containing EPSPS-E85N was significantly more resistant to glyphosate than the wild-type.

[0097] Example 7: Agrobacterium-mediated genetic transformation of rapeseed and identification of transgenic rapeseed

[0098] 1. Construction of rapeseed expression vector for mutant gene and Agrobacterium transformation

[0099] According to the coding region sequence of the rapeseed EPSPS gene (SEQ ID No. 8), rapeseed gene-specific primers (F: 5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGGCGCAATCTAGCAGAATCTGC-3'R:5'- GACTCCTCTTAGAATTCCCGGGGATCCTTAGTGCTTTGTGATACTTTCAAGGACTTGA AAG-3', the underlined part is the homology arm), using the rapeseed EPSPS site-directed mutant E76N vector constructed in Example 2 as a template, amplifying the gene sequence containing the corresponding mutant EPSPS-E76N protein, and constructing the corresponding mutation vector by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian) (using the pCAMBIA1390 vector as the backbone, Kan as the screening marker gene, and the expression cassette of the ZmUbi promoter-NOS terminator to drive the expression of the target gene. The complete sequence of the vector is shown in SEQ ID No. 4, and the insertion site is BamH I). The vector was aligned with the wild-type cotton EPSPS gene sequence using Vector NIT software to verify the correctness of the EPSPS-E76N gene mutation site and the promoter linker, and an expression vector of the mutant rapeseed EPSPS-E76N gene with the corresponding mutation site was constructed. The constructed plasmid vector was transformed into Agrobacterium EHA105 and the bacteria were cultured. The conventional Agrobacterium-mediated method was used to transform Westar rapeseed. The operation process was carried out according to the method described in the literature (Study on Agrobacterium-mediated OsWRKY45 gene transformation of rapeseed [J]. Molecular Plant Breeding, 2012, 10(05).).

[0100] Transgenic rapeseed seedlings obtained in the above steps were transplanted into nutrient soil. When the seedlings reached the three-leaf stage, leaves of the transgenic seedlings were harvested and DNA was extracted using the CTAB method for subsequent testing. The PCR products were amplified using the gene-specific primers described in this example, and the correct amino acid sequence at the mutation site was verified by sequencing to identify positive transgenic plants.

[0101] 2. Glyphosate treatment of transgenic rapeseed expressing mutant EPSPS-E76N

[0102] Transgenic rapeseed seedlings, identified through molecular testing and screening, were transplanted into large pots in the greenhouse and evenly distributed across the experimental area. Foliar spraying was performed at 4X the recommended concentration for glyphosate (840 g ae / ha is the generally accepted field concentration for glyphosate). Transgenic-positive plants were foliarly sprayed using a pressure sprayer, ensuring even distribution of droplets across the leaf surface. Transgenic recipient varieties served as controls. After one week of incubation, the growth of the corresponding plants was observed.

[0103] When the mutant rape plants and wild-type rape plants grew to the 3-4 leaf stage, they were sprayed with 0X and 4X respectively. The growth status of the plants in each group was observed after 7 days. Figure 7The results show that after spraying 0X glyphosate, both the mutant and wild-type rapeseed plants grew well. After spraying 4X glyphosate, the wild-type plants showed no resistance, with leaves significantly wilting and dying. The mutant rapeseed plants showed significant resistance to glyphosate at 4X and grew well. In summary, the rapeseed mutant containing EPSPS-E76N is significantly more resistant to glyphosate than the wild-type.

[0104] Example 8: Agrobacterium-mediated genetic transformation of corn and identification of transgenic positive plants

[0105] 1. Construction of corn expression vector for mutant gene and Agrobacterium transformation

[0106] Based on the coding region sequence of the maize EPSPS gene (SEQ ID No. 9), gene-specific primers (F: 5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGGCGGCCATGGCGAC-3'R:5'- GA CTCCTCTTAGAATTCCCGGGGATCC TTAATTCTTGACGAAAGTGCTCAGCACAT-3', the underlined part is the homology arm), using the maize EPSPS site-directed mutant E67N vector constructed in Example 2 as a template, amplifying the gene sequence containing the corresponding mutant EPSPS-E67N gene, and constructing the corresponding mutation vector (with pCAMBIA1390 vector as the backbone, Bar as the screening marker gene, and the expression cassette of the ZmUbi promoter-NOS terminator to drive the expression of the target gene by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian) by homologous recombination (ClonExpress II One Step Cloning Kit, Norwegian). The complete sequence of the vector is shown in SEQ ID ID No. 4, and the insertion site is BamH I. The vector is aligned with the wild-type maize EPSPS gene sequence using Vector NIT software to verify the correctness of the EPSPS-E67N gene mutation site and the promoter linker, and an expression vector of the mutant maize EPSPS-E67N gene corresponding to the mutation site is constructed. The constructed plasmid vector is transformed into Agrobacterium EHA105 and the bacteria are cultured. The conventional Agrobacterium-mediated transformation method was used to transform the KN5585 variety of corn. The operation process was carried out according to the method described in the reference (Study on the transfer of Bar gene into corn inbred lines using Agrobacterium-mediated zygotic embryo transformation. Corn Science, 2017, 25(4).).

[0107] The transgenic maize seedlings obtained in the above steps were transplanted into nutrient soil. When the seedlings reached the three-leaf stage, leaves of the transgenic seedlings were harvested and DNA was extracted using the CTAB method for subsequent testing. The PCR products were amplified using the gene-specific primers described in this example, and the correctness of the amino acid sequence at the mutation site was verified by sequencing to identify positive transgenic plants.

[0108] 2. Glyphosate treatment of transgenic corn expressing mutant EPSPS-E67N protein

[0109] Transgenic corn seedlings obtained through molecular detection and screening were transplanted into large pots in the greenhouse and evenly distributed in the same experimental area. The leaves were sprayed at 4X the recommended concentration (840 g ae / ha is the recognized recommended field concentration for glyphosate). A pressure sprayer was used to spray the leaves of the transgenic positive plants, so that the droplets were evenly distributed on the leaf surface. The transformed recipient variety was used as a control. After continuing to culture for 1 week, the growth of the corresponding plants was observed. The mutant corn plants and wild-type corn plants were sprayed with 0X and 4X respectively and observed after 10 days. The growth status of the plants in each group was recorded. Figure 8 The results show that after spraying 0X glyphosate, both the mutant and wild-type corn plants grew well. After spraying 4X glyphosate, the wild-type plants showed no resistance and died. The mutant corn plants showed significant resistance to glyphosate at 4X and grew well. In summary, corn plants containing the EPSPS-E67N mutant protein are significantly more resistant to glyphosate than the wild-type.

Claims

1. An EPSPS mutant protein, characterized in that The mutant protein is the following protein: The amino acid position 75 of the wild-type rice EPSPS protein or the corresponding homologous site of other plant EPSPS proteins is mutated, so that the protein has higher 5-enolpyruvylshikimate-3-phosphate synthase activity and / or is glyphosate-resistant. The amino acid sequence of the wild-type rice EPSPS protein is shown in SEQ ID No. 1; the amino acid sequence of the EPSPS mutant protein is a mutation from E to K, S, G, M, Y, N, A, V, C, W, T, D, F, I, P, Q, R, L or H at amino acid position 75 relative to the wild-type rice EPSPS protein; The other plant is wheat, cotton, soybean, rape or corn; when the plant is corn, the 67th amino acid of the corn wild-type EPSPS protein is mutated from E to N, when the plant is wheat, the 70th amino acid of the wheat wild-type EPSPS protein is mutated from E to N, when the plant is soybean, the 85th amino acid of the soybean wild-type EPSPS protein is mutated from E to N, when the plant is cotton, the 81st amino acid of the cotton wild-type EPSPS protein is mutated from E to N, when the plant is rape, the 76th amino acid of the rape wild-type EPSPS protein is mutated from E to N; Wherein, the coding sequence of the wild-type wheat EPSPS protein is EPSPS The gene sequence is shown in SEQ ID No. 5, encoding the cotton wild-type EPSPS protein EPSPS The gene sequence is shown in SEQ ID No. 6, encoding the soybean wild-type EPSPS protein EPSPS The gene sequence is shown in SEQ ID No. 7, encoding the rapeseed wild-type EPSPS protein EPSPS The gene sequence is shown in SEQ ID No. 8, encoding the corn wild-type EPSPS protein EPSPS The gene sequence is shown in SEQ ID No.

9.

2. An EPSPS mutant protein, characterized in that The amino acid sequence of the EPSPS mutant protein is mutated at the 75th amino acid site and the 177th amino acid site of the wild-type rice EPSPS protein; or the amino acid site 75th amino acid site, the 173rd amino acid site and the 177th amino acid site of the wild-type rice EPSPS protein are mutated; the amino acid site 75 of the EPSPS mutant protein is mutated from E to N, the amino acid site 173rd amino acid site is mutated from T to I, and the amino acid site 177th amino acid is mutated from P to S. The amino acid sequence of the wild-type rice EPSPS protein is shown in SEQ ID No.

1.

3. An EPSPS mutant gene, characterized in that: It encodes the EPSPS mutant protein according to any one of claims 1 to 2.

4. An expression cassette, a recombinant vector or a recombinant bacterium containing the EPSPS Mutant gene.

5. The EPSPS mutant protein according to any one of claims 1 to 2, or the EPSPS mutant protein according to claim 3 EPSPS Use of the mutant gene, the expression cassette, the recombinant vector or the recombinant bacteria according to claim 4 in cultivating glyphosate-resistant plants.

6. The use according to claim 5, characterized in that The application includes obtaining plants with glyphosate resistance through gene editing, transgenic, hybridization, backcrossing or asexual propagation methods.

7. The use according to claim 5, characterized in that The glyphosate-resistant plant comprises the plant of claim 3 EPSPS Mutant gene.

8. The use according to claim 5, characterized in that The glyphosate-resistant plant expresses the EPSPS mutant protein according to any one of claims 1 to 2.

Images