Olfactory receptor for methyl eugenol in Bactrocera dorsalis and its application
By identifying and regulating the olfactory receptor BdorOR94b1 of the citrus fruit fly and constructing an insensitive strain, the problem of unclear effect of methyl eugenol in the prevention and control of the citrus fruit fly was solved, an efficient and safe prevention and control method was achieved, the mating success rate and offspring quality were improved, and it is suitable for male sterility technology.
Patent Information
- Application Number
- CN202411112235.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-14
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-08-14
AI Technical Summary
In the existing technology, the effects of methyl eugenol in the prevention and control of the citrus fruit fly are unclear, the key olfactory receptors have not been identified, and there are safety issues. As a result, the trapping technology lacks effective molecular mechanisms and the chemical communication mechanisms have not been resolved, and the existing attractants have certain cell carcinogenicity.
Through functional genomics, electrophysiology and behavioral methods, we identified BdorOR94b1, the key olfactory receptor for male Bactrocera dorsalis to recognize methyl eugenol, and constructed BdorOR94b1 inhibitors and insensitive strains to regulate the sensitivity of Bactrocera dorsalis to methyl eugenol. We also used the CRISPR/Cas system for gene editing to develop new control methods.
The genome coding region sequence of BdorOR94b1 was successfully identified, providing a new and efficient prevention and control approach, developing a safe and effective product for the control of the citrus fruit fly, improving the mating success rate and offspring quality, and realizing the construction of a strain insensitive to methyl eugenol, which is suitable for the prevention and control system of male sterility technology.
Smart Images

Figure BDA0004992567620000081 
Figure BDA0004992567620000091 
Figure BDA0004992567620000111
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to an olfactory receptor for the fruit fly Bactrocera dorsalis that senses methyl eugenol and an application thereof. Background Art
[0002] Methyl eugenol (ME, cas: 93-15-12) is a phenylpropanoid compound first discovered in citronella essential oil and exhibiting attractant activity against fruit flies. Subsequent long-term trapping experiments revealed that ME attracts males of various Bactrocera fruit flies, including the fruit fly Bactrocera dorsalis. ME exhibits male-specific, long-range attraction, attracts even minute amounts, exhibits strong feeding activity, and is not repellent at high concentrations. Upon ingestion, ME is converted into derivatives in the fruit fly's rectal glands and serves as a component of its sex pheromone, thereby increasing its mating success rate. These potent attractant properties have made ME a crucial component in controlling fruit fly populations. Field applications of ME in combination with various attractant compounds, food attractants, and insecticides have demonstrated excellent control effectiveness against the fruit fly, leading to the development of a male annihilation technique (MAT) based on ME.
[0003] Although there have been many reports on the attractiveness of ME and the behavioral functions of its derivatives, the molecular mechanisms behind these effects and their ecological significance remain unclear. First, the role of ME derivatives in improving mating success is not fully understood, especially the advantages of male insects in the classic courtship aggregation behavior "courtship gathering" (professionally known as lek behavior), and the benefits that female insects can obtain. Secondly, the key olfactory receptors for recognizing ME have not yet been identified, and the chemical communication mechanism has not yet been resolved. In addition, ME has achieved certain results in the prevention and control of citrus fruit flies, but it still has defects, such as ME being proven to have certain cell carcinogenicity. Therefore, more detailed research is still needed on the ecological significance of ME and its olfactory mechanism, and more safe and effective attractants need to be explored to improve trapping technology, such as finding more effective structural analogs. Summary of the Invention
[0004] This study utilizes functional genomics, electrophysiology, behavioral, and traditional chemical ecology methods to comprehensively analyze the role of ME in the mating behavior of the fruit fly (Bactrocera dorsalis), as well as the key olfactory receptors that males use to recognize ME. The study also identified the key receptor for methyl eugenol in male Bactrocera dorsalis and its detailed gene sequence information. Furthermore, a strain insensitive to methyl eugenol was constructed using this key receptor. Furthermore, the ecological significance of lek during courtship was determined, and the importance of ME consumption in the reproduction of the fruit fly was determined.
[0005] The first aspect of the present invention aims to provide the use of odorant receptor BdorOR94b1 as a target.
[0006] The second aspect of the present invention aims to provide a use of a BdorOR94b1 inhibitor in controlling Bactrocera dorsalis and / or in preparing a product for controlling Bactrocera dorsalis.
[0007] The third aspect of the present invention aims to provide a method for regulating the sensitivity of Bactrocera dorsalis to methyl eugenol.
[0008] The fourth aspect of the present invention aims to provide a method for constructing a strain insensitive to methyl eugenol.
[0009] In order to achieve the above object, the technical solution adopted by the present invention is:
[0010] The first aspect of the present invention provides the use of odorant receptor BdorOR94b1 as a target in at least one of a1) to a5):
[0011] a1) Control of the fruit fly;
[0012] a2) Screening or preparing products for controlling the citrus fruit fly;
[0013] a3) Regulating the lek behavior of the oriental fruit fly;
[0014] a4) preparing a behavior regulator for the fruit fly lek;
[0015] a5) Regulate the sensitivity of the oriental fruit fly to odor molecules.
[0016] The term "lek behavior" refers to the male insect courtship gathering behavior "courtship meeting".
[0017] In some embodiments of the present invention, the odorant receptor BdorOR94b1 is used as a target to regulate the olfactory sensitivity of Bactrocera dorsalis to stimulating odor molecules.
[0018] In some embodiments of the present invention, the odor stimulating molecules include plant odors and their derivatives or insect sex pheromones and their analogs.
[0019] In some embodiments of the present invention, the odor stimulating molecule comprises methyl eugenol or a derivative thereof.
[0020] In some embodiments of the present invention, the derivatives include trans-coniferyl alcohol ((E)-coniferylalcohol, ECF) and 4,5-dimethoxy-2-(2-propenyl)phenol (2-Allyl-4,5-dimethoxy phenol, DMP).
[0021] In some embodiments of the present invention, the nucleotide sequence of the odorant receptor BdorOR94b1 is shown in SEQ ID NO:31, and the amino acid sequence thereof is shown in SEQ ID NO:32.
[0022] The second aspect of the present invention provides use of a BdorOR94b1 inhibitor in controlling Bactrocera dorsalis and / or preparing a product for controlling Bactrocera dorsalis.
[0023] In some embodiments of the present invention, the BdorOR94b1 inhibitor is at least one of a substance that inhibits the activity of BdorOR94b1, a substance that degrades BdorOR94b1, or a substance that reduces the expression level of BdorOR94b1.
[0024] In some embodiments of the present invention, the substance that reduces the expression level of BdorOR94b1 includes at least one of b1) to b13):
[0025] b1) at least one of siRNA, dsRNA, miRNA, ribozyme, shRNA, and CRISPR / Cas system targeting BdorOR94b1;
[0026] b2) a nucleic acid molecule encoding b1);
[0027] b3) an expression cassette containing the nucleic acid molecule described in b2);
[0028] b4) a recombinant vector containing the nucleic acid molecule described in b2);
[0029] b5) a recombinant vector containing the expression cassette described in b3);
[0030] b6) a recombinant cell containing the nucleic acid molecule described in b2);
[0031] b7) a recombinant cell containing the expression cassette described in b3);
[0032] b8) a recombinant cell containing the recombinant vector described in b4);
[0033] b9) a recombinant cell containing the recombinant vector described in b5);
[0034] b10) a recombinant microorganism containing the nucleic acid molecule described in b2);
[0035] b11) a recombinant microorganism containing the expression cassette described in b3);
[0036] b12) a recombinant microorganism containing the vector described in b4);
[0037] b13) A recombinant microorganism containing the vector described in b5).
[0038] In some embodiments of the present invention, the CRISPR / Cas system includes an sgRNA targeting BdorOR94b1 or biological materials associated with the sgRNA;
[0039] The biological material associated with the sgRNA includes at least one of c1) to c12):
[0040] c1) a nucleic acid molecule encoding an sgRNA;
[0041] c2) an expression cassette containing the nucleic acid molecule described in c1);
[0042] c3) a recombinant vector containing the nucleic acid molecule described in c1);
[0043] c4) a recombinant vector containing the expression cassette described in c2);
[0044] c5) a recombinant cell containing the nucleic acid molecule described in c1);
[0045] c6) a recombinant cell containing the expression cassette described in c2);
[0046] c7) a recombinant cell containing the recombinant vector described in c3);
[0047] c8) a recombinant cell containing the recombinant vector described in c4);
[0048] c9) a recombinant microorganism containing the nucleic acid molecule described in c1);
[0049] c10) a recombinant microorganism containing the expression cassette described in c2);
[0050] c11) a recombinant microorganism containing the recombinant vector described in c3);
[0051] c12) A recombinant microorganism containing the recombinant vector described in c4).
[0052] In some embodiments of the present invention, the nucleotide sequence of the sgRNA is shown as SEQ ID NO: 23 to SEQ ID NO: 26.
[0053] In some embodiments of the present invention, the CRISPR / Cas system further comprises a Cas protein and / or biological materials associated with the Cas protein;
[0054] The biological material associated with the Cas protein includes at least one of d1) to d12):
[0055] d1) a nucleic acid molecule encoding a Cas protein;
[0056] d2) an expression cassette containing the nucleic acid molecule described in d1);
[0057] d3) a recombinant vector containing the nucleic acid molecule described in d1);
[0058] d4) a recombinant vector containing the expression cassette described in d2);
[0059] d5) a recombinant cell containing the nucleic acid molecule described in d1);
[0060] d6) a recombinant cell containing the expression cassette described in d2);
[0061] d7) a recombinant cell containing the recombinant vector described in d3);
[0062] d8) a recombinant cell containing the recombinant vector described in d4);
[0063] d9) a recombinant microorganism containing the nucleic acid molecule described in d1);
[0064] d10) a recombinant microorganism containing the expression cassette described in d2);
[0065] d11) a recombinant microorganism containing the recombinant vector described in d3);
[0066] d12) A recombinant microorganism containing the recombinant vector described in d4).
[0067] In some embodiments of the present invention, the recombinant vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a phage, a cosmid, an F cosmid, or an artificial chromosome.
[0068] In some embodiments of the present invention, the plasmid vector may be an optional plasmid, the viral vector may be an optional virus, and the cell vector does not include propagation materials.
[0069] In some embodiments of the invention, the Cas protein is selected from Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d and Cas14, including any recombinant variants thereof, and in particular selected from Cas9, including any recombinant variants thereof.
[0070] The third aspect of the present invention provides a method for regulating the sensitivity of the fruit fly to methyl eugenol, comprising the step of knocking down / knocking out the fruit fly odor receptor BdorOR94b1 using gene editing technology.
[0071] In some embodiments of the present invention, the gene editing technology includes ZFNs, TALENs or CRISPR / Cas9 technology.
[0072] In some embodiments of the present invention, CRISPR / Cas9 technology is used to knock down / knock out the odorant receptor BdorOR94b1, comprising the following steps: injecting sgRNA and Cas9 protein into Bactrocera dorsalis embryos.
[0073] In some embodiments of the present invention, the nucleotide sequence of the sgRNA target site in the exon of the BdorOR94b1 gene is shown as SEQ ID NO: 23 to SEQ ID NO: 26.
[0074] In some embodiments of the present invention, the nucleotide sequence of the sgRNA is shown as SEQ ID NO: 23 to SEQ ID NO: 26.
[0075] The fourth aspect of the present invention provides a method for constructing a strain insensitive to methyl eugenol, comprising the following steps: performing gene editing on the citrus fruit fly using the method of the third aspect of the present invention, then hybridizing and passaged the G0 generation individuals that survived to adulthood after embryo injection with wild-type individuals, and screening for mutants to obtain a strain insensitive to methyl eugenol.
[0076] In some embodiments of the present invention, the specific method for screening mutants is: injecting embryos into G0 generation individuals that survive to adulthood, detecting the gene editing status of the G0 generation, retaining the successfully edited G0 generation and hybridizing them with the wild type to produce the G1 generation individuals, detecting the gene editing status of the G1 generation, and hybridizing the successfully edited G1 generation individuals with the wild type to produce the G2 generation, self-pollinating the G2 generation individuals with the same genotype, and screening homozygous mutants in the G3 generation.
[0077] The beneficial effects of the present invention are:
[0078] This study utilizes functional genomics, electrophysiology, behavioral science, and traditional chemical ecology to comprehensively analyze the role of ME in the mating behavior of the fruit fly and the key olfactory receptors used by males to recognize ME. For the first time, the key odorant receptor BdorOR94b1 for methyl eugenol recognition in the fruit fly was identified, and its genomic coding region sequence and transcribed amino acid sequence information were obtained. This not only provides an important foundation for the subsequent screening of more stable and efficient structural analogs targeting this gene, but also for the development of nucleic acid pesticides. This provides a reliable molecular target for the development of new, highly effective female or bisexual attractants for the fruit fly, offering a new and feasible approach for its control. This is of great significance for understanding the molecular mechanisms and ecological value of plant secondary metabolites in regulating insect sexual behavior, and is also of great value for screening more stable and efficient structural analogs targeting genes.
[0079] The method provided by the present invention can successfully obtain ME-insensitive strains, which can be applied to the sterile insect technique (SIT) control system of the fruit fly to achieve the control of the fruit fly.
[0080] Determine the ecological value of ME to the oriental fruit fly. The present invention compares the difference in attractiveness of artificial lek groups of male insects to female insects in the fed and unfed states. The experiment found that the attraction of fed male insects to female insects was significantly stronger than that of unfed male insects, and proved that this difference in attraction was affected by the rectal glands of the oriental fruit fly. GC-MS analysis of rectal gland extracts showed that after feeding, ME would derive 4,5-dimethoxy-2-(2-propenyl)phenol (2-Allyl-4,5-dimethoxyphenol, DMP) and trans-coniferyl alcohol ((E)-coniferyl alcohol, ECF) in the body. Among them, ECF is the key compound that enhances the attraction to female insects.
[0081] The significance of the classic courtship behavior of the citrus fruit fly, lek, in population reproduction was determined. The differences in the courtship and mating behaviors of the citrus fruit fly in groups and individual cases were compared to determine the advantages of the group effect in the reproduction of the citrus fruit fly. The results showed that courtship and mating behaviors were more likely to occur in groups than in individual cases. To further study the role of lek behavior in offspring quality, the present invention provided male insects with different growth conditions in the group, including four different types: normal, malnourished, white-eyed, and white pupae. The choice of female insects was evaluated through competitive mating, and the quality of the offspring of these four male insects was compared. It was found that in the lek group, female insects were more inclined to choose strong male insects. And the number and quality of offspring produced by strong male insects were better. These results demonstrate the important role of lek behavior in initiating mating and providing health advantages for females, which helps to improve the quality and quantity of offspring of the citrus fruit fly. BRIEF DESCRIPTION OF THE DRAWINGS
[0082] Figure 1 Olfactory receptors (ORs) expressed on antennae mediate the attraction of ME to male Bactrocera dorsalis; a is a schematic diagram of the three trap experiments; b is a comparison of the attraction rate of ME to male and female Bactrocera dorsalis; c is a comparison of the attraction rate of ME to WT and BdorOrco - / - Comparison of male insect trapping rate; d is the ME to WT and BdorIR8a - / -Comparison of the attraction rate of male flies; e is a schematic diagram of the four-arm olfactometer; f is a comparison of the tendency of WT males, WT males with mandibular palps removed, and WT males with antennae removed to ME in the four-arm olfactometer, time 8:00-9:00, ME dose was 10 μg; N=5 for all the above behavioral experiments, 30 citrus fruit flies per replicate, data results are expressed as mean ± standard error, data differences were analyzed using unpaired t-test, * indicates P < 0.05, ** indicates P < 0.01, **** indicates P < 0.0001, ns indicates no significant difference.
[0083] Figure 2 For BdorOrco - / - 、BdorIR8a - / - Examples of mutant construction and behavioral testing devices; a is a schematic diagram of the BdorOrco gene structure and guide RNA (sgRNA) target location; b is gDNA amplification and sgRNA synthesis of the BdorOrco target region. In the figure, b1: BdorOrco target region gDNA amplification, b2: PCR assembly of BdorOrco sgRNA in vitro transcription template, b3: BdorOrco sgRNA in vitro transcription and purification product detection; c is wild-type BdorOrco + / + Target region sequence peak diagram; d is the mutant heterozygote BdorOrco + / - Target region sequence peak diagram; e is the homozygous mutant BdorOrco - / - Target region sequence peak diagram; f is a schematic diagram of the BdorIR8a gene structure and the position of the sgRNA target site; g is amplification of the BdorIR8a target region gDNA and synthesis of sgRNA. In the figure, g1: amplification of the BdorIR8a target region gDNA, g2: PCR assembly of the BdorIR8a sgRNA in vitro transcription template, g3: in vitro transcription of BdorIR8a sgRNA and detection of the purified product; h is the wild-type BdorIR8a + / + Target region sequence peak diagram; i is wild type BdorIR8a + / + and mutant heterozygotes BdorIR8a + / - , homozygous BdorIR8a - / - Comparison of target region amplification gel images; j is the homozygous mutant BdorIR8a - / - Target area sequence peak diagram; k is a trap experiment example, with the trap experiment device on the left and the trap bottle result statistics on the right; l is an example of a four-arm olfactometer behavioral experiment, which shows the distribution status of fruit flies at 0, 1, and 5 minutes of recording respectively.
[0084] Figure 3Figure 3 shows that BdorOR94b1 is a specific receptor for methyl eugenol (ME); a is a schematic diagram of the receptor screening process based on changes in mRNA expression after stimulation; b is a comparison of the expression levels of antennal odorant receptors (ORs) before and after ME stimulation; c is the temporal changes in BdorOR94b1 expression under ME stimulation, n=3, data are expressed as mean ± standard error, and data were analyzed by one-way analysis of variance with Tukey's multiple comparison test (differences are represented by different letters, α=0.05); d is the expression level of BdorOR94b1 in different peripheral sensory organs of male and female flies; e is a schematic diagram of the heterologous expression system using Drosophila ab3A null neurons; f is the expression of BdorOR94b1 in Drosophila ab3A neurons to 2-heptanone and ethyl hexanoate Figure 5. Representative single sensillum recording (SSR) responses to hexanoate and ME. g: Quantitative analysis of the Drosophila ab3A sensillum response to ME in the presence or absence of BdorOR94b1. In the figure, "+" and "-" indicate the presence and absence of OR22abGAL4 and UAS-BdorOR94b1, respectively. Data are presented as mean ± standard error (SDE). N = 10-14 per group. Differences were statistically analyzed using an unpaired t-test (**** indicates P < 0.0001). h: SSR responses of BdorOR94b1 to 64 compounds (100 μg each, N = 9). i: Dose-response curve of BdorOR94b1 to ME (N = 9). Data are presented as mean ± SDE.
[0085] Figure 4Supplementary data for the evaluation of ME-stimulated transcriptome data and SSR responses of transgenic fruit flies; a is a box plot of expression distribution of ME-stimulated transcriptome samples, which shows the FPKM value distribution of gene expression levels in all RNA samples; b is a correlation plot between ME-stimulated transcriptome samples, which depicts the Pearson correlation between all RNA samples, and the color scale represents the Pearson correlation coefficient, red indicates high correlation, and blue indicates low correlation; c is a principal component analysis (PCA) plot between ME-stimulated transcriptome samples, which shows the differences between the treated group and the control group; d is a heat map of all differentially expressed genes in ME-stimulated transcriptome, which shows the differentially expressed genes between the ME-treated group and the control group, the rows represent genes with significant expression differences between the two groups, and the columns correspond to individual samples in each group, the color scale represents gene expression levels, red represents high expression, and blue represents low expression; e is the expression of 2-heptanone and ethyl hexanoate in the ab3A sensor of the UAS-BdorOR94b1 fruit fly strain hexanoate) and ME; f is OR22ab Gal4 Representative SSR responses of ab3A sensilla in the UAS-BdorOR94b1 Drosophila strain to different doses of ME.
[0086] Figure 5 The detailed knockout process of the BdorOR94b1 mutant and the supplementary data of the SSR response of the knockout strain to ME are shown in Figure 1. (a) The gene structure of BdorOR94b1, with the target site location shown on the figure; (b) The synthesis process of BdorOR94b1 sgRNA; (c) The wild-type BdorOR94b1 + / + Target region sequence peak diagram; d is wild type BdorOR94b1 + / + and mutant heterozygote BdorOR94b1 + / - , homozygous BdorOR94b1 - / - Comparison of target region amplification gel images; e is the homozygous mutant BdorOR94b1 - / - Target region sequence peak diagram; f is a schematic diagram of the SSR record of Bactrocera dorsalis; g is the quantification of the SSR response to 64 different odorants by s, BdorOR94b1 - / - Summary of the SSR responses of male cone sensilla (S. basiconica) to 64 odorants. Neurons were divided into Neuron Group 1 and Neuron Group 2 based on their response characteristics; h is the SSR dose-response curve of BdorOR94b1 neurons to ME, data are expressed as mean ± standard error, N = 6 sensilla; i is the representative SSR response of male cone sensilla to different concentrations of ME.
[0087] Figure 6 BdorOR94b1 is the key receptor that mediates the attraction behavior of methyl eugenol (ME); a is a schematic diagram of the EAG response of Bactrocera dorsalis to ME; b is a diagram of the wild type (WT) and BdorOR94b1 stimulated by different concentrations of ME - / - Representative EAG responses of males; c: WT and BdorOR94b1 - / - Figure 3 EAG dose-response histogram of male insects to ME. N = 12 responses were recorded for each male insect. Data are presented as mean ± standard error. d is a schematic diagram of single sensillum recordings (SSRs) of B. dorsalis. e is a representative SSR response of trichoid (N = 109) and basiconica (N = 26) of B. dorsalis to ME. f is a representative SSR response of WT and BdorOR94b1 - / - Representative SSR responses of cone sensilla (S. basiconica) to ME, 4,5-dimethoxy-2-(prop-2-en-1-yl)phenol (DMP), and heptanal; g represents WT and BdorOR94b1 - / - Summary of the SSR responses of male cone sensilla to ME and DMP. Data are presented as mean ± standard error, with N values of 14, 48, 14, and 48, respectively; h is a schematic diagram of the four-arm olfactometer; i is a diagram of WT and BdorOR94b1 - / - Behavioral responses of males to ME, N = 5, 30 Bactrocera dorsalis in each replicate. Data are expressed as mean ± standard error. Statistical analysis was performed using unpaired t-test. *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.
[0088] Figure 7The ECF derivative of methyl eugenol enhances the attraction of male lek to females. Figure a shows the basic design of the experiment. The rectangular behavior chamber is divided into two sides, A and B, with a small cage loaded with an attractant placed on each side. There are 30 freely moving WT females in the behavior chamber. During the experiment, the density of males in the cages was 10 or no males. The rectal gland extract was directly applied to the outer wall of the ventilation holes. Figure b shows the competitive attraction of WT females to males fed with or without ME. Figure c shows the competitive attraction of WT females to rectal gland extracts of males fed with or without ME (males in the cage). Figure d shows the competitive attraction of WT females to rectal gland extracts of males fed with or without ME. Figure e shows the GCMS analysis of rectal gland extracts after feeding ME. Figure f shows the results of the experiment with or without the addition of trans-coniferyl alcohol ((E)-coniferyl g is the competitive attraction of male rectal gland extracts with or without 4,5-dimethoxy-2-(2-propenyl)phenol (4,5-dimethoxy-2-(prop-2-en-1-yl)phenol, DMP) to WT females; h is the competitive attraction of males fed with or without ME to BdorOrco - / - Competitive attraction of female insects; N=5 for all experiments in Figures b, c, d, e, f, g, and h, with 30 fruit flies per replicate. The data are expressed as mean ± standard error.
[0089] Figure 8 Figure 5. GC-MS analysis of rectal gland compounds after feeding on ME. (a) Schematic diagram of the artificial LEK attraction test device. (b) Photograph of a male fruit fly feeding on ME. (c) The actual device for testing the attraction of artificial LEK. (d) Photograph of the rectal gland of a male fruit fly. (e) Females attracted to a trap. (f) GCMS analysis of rectal gland extracts from males fed and not fed on ME, including (E)-coniferyl alcohol (ECF) and 4,5-dimethoxy-2-(prop-2-en-1-yl)phenol (DMP). (g) Total ion GC-MS chromatogram of DMP. (h) Total ion GC-MS chromatogram of ECF.
[0090] Figure 9is the value of lek behavior to the reproduction of Bactrocera dorsalis population; a is the comparison of the number of matings between group mating (leks) and individual mating (individual), with the number of matings counted in each time period from 16:30 to 18:30; b is the comparison of the wing-beating frequency of group males (leks) and individual males (individual), with the number of wing-beatings counted in each time period from 16:30 to 18:30; c is the comparison of the wing-beating frequency of normally fed males (Normal) and males with weak competitiveness (malnutrition, Bdorwhite - / - , BdorWP - / - ) is a competitive mating experimental design scheme. The competitive mating experiment was set up with female:male = 1 (WT):4 (2 normal males and 2 males with weaker competitiveness). The number of male types selected by females in each experiment was counted, and each group was repeated 10 times; d and e are the experimental designs for evaluating the offspring of normal males and poorly grown males. 10 healthy wild-type females were provided to 10 normal males and 10 poorly grown males, respectively. After sufficient mating, the number of eggs laid and the hatching rate of eggs were counted; N = 5 for all experiments in Figures a, b, c, d, and e. The above data are expressed as mean ± standard error. The data differences were analyzed using unpaired t-test. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.
[0091] Figure 10 Figure 3. Effects of malnutrition on body size, pupal weight, egg production, and hatching rate of Bactrocera dorsalis; a is the construction process of malnourished males; b is the comparison of body size of adults and pupae between wild-type and malnourished males; c is the comparison of pupal weight between wild-type and malnourished males; d is the comparison of egg production between wild-type and malnourished males; e is the comparison of hatching rate of offspring eggs between wild-type and malnourished males; in the figure, ** indicates P < 0.01, and *** indicates P < 0.005. DETAILED DESCRIPTION
[0092] The present invention is further described in detail below through specific examples.
[0093] It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention.
[0094] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.
[0095] The features and performance of the present invention are further described in detail below with reference to the embodiments.
[0096] Example
[0097] Experimental methods:
[0098] 1. Construction of functional deletion strains of odorant receptor co-receptor BdorOrco and ionotropic receptor co-receptor BdorIR8a
[0099] (1) Construction of BdorOrco and BdorIR8a mutants using CRISPR / Cas9
[0100] Olfactory receptor mutant construction includes sgRNA synthesis, embryo injection, and mutant screening.
[0101] The full-length structures of BdorOrco and BdorIR8a were predicted using the genome of the fruit fly (National Center for Bioinformation, GSA database, PRJCA020830), which was previously sequenced and assembled in our laboratory. We extracted gDNA from 10 male and 10 female spores, and designed specific primers for PCR amplification of the target region (primers and conditions are shown in Table 1). The PCR product was cloned into a blunt vector and tested in bacterial plaques to identify conserved regions. Based on this conserved region, we used sgRNAcas9-AI to design a 20-bp target region for sgRNAs containing three base sequences, either NGG or CCN, adjacent to the sgRNAs. sgRNAs were synthesized using a commercial kit (GeneArt gRNA Kit, Thermo Fisher).
[0102] The target region sequence of BdorOrco (the entire sequence is very long, and only the sequences of exons 1 to 3 are used in the target region herein) is shown in SEQ ID NO: 29, and the target region sequence of BdorIR8a (the entire sequence is very long, and only the sequences of exons 4 to 7 are used in the target region herein) is shown in SEQ ID NO: 30. ATGCAGCCCAGCAAATATGTGGGCCTTGTGGCCGACTTGATGCCCAATATTCGTCTTATGAAATACTCGGGCTTATTTATGCACAATTTTACCGGCGGTTCAGGGCTCTTCAAGAAGATTTACTCGTCCGTACACTTGGTGCTGGTTCTGGTGCAATTTCTATTGATACTGGTGAATTTGGCGTTGAATGCGGAGGAGGTGAATGAGTTGTCCGGCAACACGATTACGGTGCTCTTCTTTACACATAGCATAACGAAATTCATCTATCTGGCCGTGAGTCAGAAGAACTTCTACAGGTGAGTGCCAAACAACAACTTTTAATTTAGCATACTACTAT ATATTAGCGGACTGGTGGCCAGCAGCTGTAACACTAAATGGATTAGCTGAGTTGTATGTATAAATTTTTGTAATTG CGAAATAATGCGAACTGGTGGCTTCAATTGACGGCACCACCGGGAGCTAATCGTAAGAAATAATCCGAGCATTTCA ATGGCGAACTCGCTTGGTTGAAATGAAATGGCGCATGACACAGCAGGAGCGGTGAGTGGCGCTTCCGGCGACGCGT GAACTCGTTTAATTAGCCGCACAATCAAGCGCTGCGCCTCCGCGCTGCTTCCAATCCCGCCGCCGCCAGCCGGTTA TGGCTTATTGTGCGCGTGTGCGCCCACTTTAATTGCTTGCTATAAAATTCATTGCATTTTAATTGCAG AACATTGAATATCTGGAATCAGGTAAACTCGCATCCATTGTTCGCCGAGTCGGACGCACGCTACCATGCGATCGCCCTCGCCAAGATGCGCAAACTATTCACCTTGGTGATGCTGACGACCGTCGCCTCGGCTGTGG GTGAGTGTCGCATCGGCACAAAA GAATTTTTGATTAGTTTTCGCTTAATTTCTATGGATTTCAG CTTGGACCACCATCACCTTCTTTGGCGAGAGTGTGAAGTTTGCTTTTGAGAAGGAGACCAATTCGACCATCACCGTGGAAATCCCGCGTTTGCCCATCAAGTCGTTCTATCCATGGAATGCCGGCGCGGGCATGTTTTATATTATAAGCTTCGCTTTTCAGTGCTACTATCTGCTTTTCTCCATGGTGCATGCGAACTTGTGCGATGTACTTTTTTGCTCATGGCTGATTTTCGCCTGCGAACAGCTGCAACATCTGAAAGGCATTATGAAGCCATTAATGGAGCTGTCAGCCTCGCTGGACACCTATCGGCCAAATTCGGCGGCACTCTTTCGTTCATTATCCGCCAACTCGAAGTCGGAATTAATCAACAATGAG(SEQ ID NO:29)。
[0103] GACACTGAGGAAGCTATAATACAAATCGTCGAAGGCTATCCCTTCCGCAGTTTGATAATGAATGCATTTGATAATAAACAAGATTTTATAAAGCGCCTACGAAAAATCCGACCTATGCCTTCGTGTTATGCAATATTTGCCGACGGCACAGCGATGAACAGCATTTTTGATAGG GTAAGTCTAAAGAGGATTACTTATTTTTCTAAAATTTATATGTATA TTTCTCACGTTTAGATTTCAAAGGCCAACTTCTTTGAACGACCACGTGAATGGCATTTCGTTTATTTGGATCCACGAGATCGTGTCTTTAAATTTAAGAAGCAAGTGGATTATGCGACGAAATTCACAATCAATCCGAAGACACTATGCAGGGCACTAAGGAAGAAGGACACATACTGCCTCAGTGGCTTCTCG GTAAATTCATTGAACTCGTTTTATCTGCTTAGGA AAATATTTAGTTTATAATTCCGGTACAG TTTCAGCGCGCAATGATTTTGGAAATCTTACGCGGCTTAATCGAACTGAAACAAGCCAATTTGTATTGGTTGCAGTCTTTTGTAATGGAATGCAATGCCACAAGCCCCATTGAGAACGGAACAGCGGGTTTGGATATTTTGGAACAATTTCCGATGAGTGAGTTTTTGGACCTTACAACCGATGTCACTTTCCCCAACGACGAATTCGAACACGTGCCACGCCTCACTTATACACCGACGATCAACATAAATCTCTACTCCAGCGAACACGATGCTGTGACCGAGTTGGCCATTTGGCAAAATGATAATCTGCGCAAAATAAATGAGACCATCAGTCCGCCGCGAAGATTTTTTCGCATAGGTACTGTGGAG GTATCTACGTTCCACACATTCCTTACAGCGAAATTGGTAGACAATTATTTCCATTA CTGCTTGCAGGCCATACCATGGAATTACATGAAACGTGACCCGAAAACTGATGAACTAATACTCGACTCTTTTTGGCAACCCGATTTGGGAGGGTTTCTGCATTGACTCTATACAAAAGCTGTCGGAGCGTTTAAAT TTCGGCTACATGCTGGTGCCACCGACTTCCGGTGAGTTTGGTCGTCGCGATGTTGTTAACGATGTCTGGGATGGCATTGTGGGCGATCTGGTTACTGGTGAGACGGACTTTGCTGTTACCGCGCTGA AAATGTACTCAGAACGTGAGGAAGTTATTGACTATATAGCGCCGTATTTTGAGCAAACTGGCATTTCCATTGTAATGCGTAAACCGGTGCGACAGACATCACTTTTCAAATTCATGACTGTGTTGCG GGTGGAAGTGTGGTTTAGCATTATTGCGGCGTTGGTGGGTAGCGCACTTATGATTTGGTTGCTTGATAAGTATTCGCCCTACAGCTATAGAAATAATCGTGCGGCCTATCAGTATCCTTGTCG(SEQ ID NO:30).
[0104] Note: The underlined parts are introns, and the ununderlined parts are exons.
[0105] Fresh embryos were collected for injection. The working concentration of sgRNA (sequences are shown in Table 1 for target locations) was 300 ng / μL, and the concentration of Cas9 protein was 150 ng / μL. The above reagents were mixed and then injected into the embryos using the FemotoJet and Inject Man4 systems (Eppendorf, Hamburg, Germany). The injected embryos were placed in an incubator at 26.5°C and 60% humidity to wait for hatching. Hatched larvae were picked with a soft brush and fed with feed for feeding.
[0106] Extract gDNA from the midfoot tissue of the mutant adult for genome detection and amplification (primers and conditions are shown in Table 1). The PCR product was sequenced by Sanger sequencing, and the individuals with obvious overlapping peaks near the target site were edited. After the G0 generation emerged from adulthood, the genome was amplified and sequenced, and the individuals with obvious overlapping peaks were retained and paired with the wild type. The G1 generation adults obtained by pairing were genotyped, and the strains were preserved according to the above requirements and hybridized with the wild type again. The G2 generation adults obtained by hybridization were selected from the heterozygotes to self-pollinate to homozygous. Homozygous G3 generation BdorOrco - / -、BdorIR8a - / - The remaining works are used for seed preservation and for conducting experiments.
[0107] Table 1 PCR primers, conditions and target locations
[0108]
[0109] 2BdorOrco - / - 、BdorIR8a - / - Comparison of behavioral responses of males with and without antennae and maxillary palps to ME
[0110] The BdorOrco was tested using a trap experiment commonly used in fruit flies (see behavioral experiment for details). - / - 、BdorIR8a - / - In the behavioral responses of male flies to ME, we found that odorant receptors (ORs) are the primary receptors for ME in the fruit fly. Subsequently, by removing the antennae and maxillary palps, we demonstrated in a four-arm olfactometer that the primary peripheral olfactory tissue for ME perception is the antennae. These results suggest that antennal ORs are crucial for ME perception in the fruit fly.
[0111] (1) Odor stimulation, transcriptome sequencing, and qPCR validation
[0112] Odor stimulation experiments were conducted in small cages measuring 18 cm × 12.5 cm × 14 cm. Unmated, sexually mature males (12 days old) were used. 100 males were included in each of the Me treatment and control groups. During odor stimulation, the 100 males were divided into two small cages, each containing 50 males, to ensure adequate exposure to Me. The stimulating compound, Me, was dissolved in paraffin oil (100 μg / μL). Clean filter paper with 20 μL of 100 μg / μL Me was placed in each cage, while the control cage was filled with paraffin oil. Antennae were collected 5 hours later (consistently between 9:00 and 14:00), snap-frozen in liquid nitrogen, and stored in a -80°C freezer for RNA extraction and transcriptome sequencing. Three replicates were performed for both treatment and control groups.
[0113] RNA sequencing was performed on an Illumina Novaseq 6000 sequencing platform. Raw data were filtered using Trimmomatic v0.39 software to remove adapters and low-quality sequences (sequence quality scores below 20 or sequence lengths less than 40 bp) to obtain high-quality sequencing data. High-quality sequencing data were aligned to a reference genome (NCBI project number: PRJCA020830) available in the laboratory using Hisat2 v2.2.1 software. The odorant receptor genes identified were quantified using FeatureCounts v2.0.1 software to generate raw expression matrices, FPKM matrices, and TPM matrices for the aligned genes.
[0114] The R language ggplot2 v3.4.2 package was used to draw a box plot of the FPKM value matrix, and the similarity of expression patterns among samples was determined based on whether the central trend of gene FPKM values in different samples was uniform. The R language hclust function was used to perform hierarchical clustering of different samples based on the FPKM value matrix, and the correlation between samples was determined based on the distance between each sample. The R language cor function was used to calculate the correlation coefficient between samples based on the FPKM value matrix, and the strength of the correlation between samples was determined by the size of the correlation coefficient. The R language FactoMineR v2.8 package and factoextra v1.0.7 package were used to perform principal component analysis on the FPKM value matrix to determine the size of the difference between the ME treatment group and the control group.
[0115] Quantitative real-time PCR (qRT-PCR) was used to verify the differential expression of key odorant receptors for transcriptome analysis. According to the above stimulation method, the stimulation gradient was set to 0h, 2.5h, 5h, and 24h. Total RNA was extracted from different stimulation groups using TriZol (Invitrogen, Carlsbad, CA, USA). Approximately 1μg of total RNA was used as a template to synthesize cDNA. Specific qPCR primers were designed (Table 2) for qRT-PCR experiments. The PCR system totaled 10μL, including 5μL 2×Taq Pro Universal SYBRqPCR Master Mix (Vazyme, Nanjing, China), 0.5μL of each primer (10μM), 1μL cDNA, and 3μL RNase-free water. The qPCR instrument used was a CFX96 real-time PCR detector (Bio-Rad, Hercules, CA, USA). Primer sequences and PCR conditions are shown in Table 1. Dissociation curve analysis was performed before the main experiment to confirm the specificity of the amplification. Three biological replicates were performed. 2 -ΔΔCT Calculate relative expression levels.
[0116] Table 2 qRT-PCR primers and conditions
[0117]
[0118] (2) Construction of transgenic Drosophila strains
[0119] Total RNA from male antennae was extracted using TriZol (Invitrogen, Carlsbad, CA, United States). cDNA was then reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). The resulting cDNA was diluted to 300 ng / μL and stored at −20°C for use as a cloning template. It was amplified using primers specific for BdorOR94b1 (primers and conditions are shown in Table 1) using a cycle of 98°C for 3 min, 98°C for 10 s, 60°C for 15 s, 35×, 72°C for 1 min 30 s, and an extension at 72°C for 10 min. The product was purified and cloned into the pUAST-attB vector, and the recombinant plasmid was extracted and purified using the Qiagen midiprep kit. The plasmid was injected into undifferentiated fertilized eggs of Drosophila flies with a y[1]M{vas-int.Dm}ZH-2A w[*];P{CaryP}attP2 background. G0 generation flies were crossed with a balancer strain and screened for multiple generations using white as a marker to construct the W;sp / Cyo;UAS-BdorOR94b1 / TM2 effector strain. W;sp / Cyo;UAS-BdorOR94b1 / TM2 was then crossed with the null neuron strain W;22abGAL4 / 22abGAL4;TM2 / TM6B. The resulting homozygous individuals, W;22abGAL4 / 22abGAL4;UAS-BdorOR94b1 / UAS-BdorOR94b1, were ultimately used for recording from single sensilla.
[0120] 3. Analysis of the Antennae Transcriptome in Response to ME Odor Stimulation
[0121] By stimulating the antennal transcriptome with ME odor, we identified an odorant receptor gene, BdorOR94b1, that was downregulated following stimulation. Subsequently, bioinformatics techniques were used to obtain the complete genomic sequence of its coding region and its encoded amino acid sequence. The specific sequence is as follows:
[0122] The BdorOR94b1 genomic sequence is 1611 bp in length, with 4 exons (the ununderlined part in SEQ ID NO: 31), 3
[0123] An intron (the underlined portion of SEQ ID NO: 31) has a nucleotide sequence as shown in SEQ ID NO: 31 and an amino acid sequence as shown in SEQ ID NO: 32.
[0124] ATGGCGGTCAAAAAGTGGTCACCACGCAACACGTCCTCAATGTCGAGAACCGCTTCAGCGAACATCATTATTGCTGTGCTGAAGGCACTGGGCTATTGGCAATGGACAAGAGACCCACGCCAACCATACATCGAAAAAGTCGAACGTGCATACCGCATTGTGCTGCACACAACGTTTCCATTCACTTTCATTGCGTTAATGTTGACGGGTGTGTTATTATCGCGGGATCTCGATGAGATCGGCAGTATACTACACGTATTGCTAACCGAATTCTCCTTGATCGTAAAGACATTGCATATTTGGCGAAAAGGTGGCGTAGCCTGGCGCTTTATGCACGAAGTGGCCAACGATCCCATATACGATTTGCGCCAACAATCCGAGTGGACCAAATGGCAGCAGGCCCAGCGTTCGTTTGCCATCGTTTCGAACACATATTTTGTGGCCGCGACCACCGTTGTCGTGTTCGCTTGCATCGGTGCCATGATGACACCAGCCGATGTCTATGTTTTGCCAATGAACATTTATGTGCCCTTCGATTGGCATCATCCGCGTAGGTATTGGTATGCATGGACCTATAACACCATTGCCTCATTGATGACAGCCACCGCCAATGCTATGTTGGACTTGGTAAACTGCTACTTTATGTTTCATCTGTCGTTGTTGTACAAATTGATTGGTTGGCGCCTGAGCGCTTTACGGCGAAGTGCAAACGAACCACCAGTGATTGAGCAAATGTCCGAGATCTTTCAAATGCATATGAAAGTAAGAAG GTACGGTACTTTATTAATCGCATAAGTTTCGAATATAGCAAATGAATTATTTTTTATT GAGTATCTTACCAG ATTGACGACTGAGTGCGAGACTTTGGTATCAATTCCGGTGTTTTCGCAAATTATTCTCAGCTCTTTCATACTCTGCTTTTGTGGCTATCGGCTGCAGCAA GTAAGTGATTGCAACACAAAATTTTAGTTTTTGTATCA AAAGTTTTTGCGAAGTTTTGAGACATAAAAGCGAAGAAAATTGACGAAACGTTCACAGAAATCCAAAACTCCGTAT ACGAACTTCGACTAAACGTAAACTTGATGTTTTATTCATTACTACTCTTCTATATATCTAGATGGAGATCATGGAAAATCTTAGCATGCTTTTTAGTACAGTTGAATTCGCCACAGTGATGGCTGTGCAAATCTTTTTGCCCTGCTACTTTGGCAATAAGGTAACCGAGTCCTCAGATGCTTTGACAGATGAGATCTTCAACTCGGATTGGACAACATTTGATGTGCCGACGCGCAGATTTATGATTTTATATATGGAACTTTTGAAAAAGCCAGCTAATTTGATGTCTGTCAACTATTTTATAATTGGCGTGGATATTTTTGCAAAG GTGAATATATGAATACCTATATATTCATATTATATTGGCTGTGGTATCAAAT ATGTCCAAGACTTTTTGGCTTCTGATTATATTAGATGTCTACCTGGCATATAATAAAAAGTACACATAAGGAAA ACAATGTTTCTAATTAAAATTCACTTTTATTTTTTTCATTTTTCAG ACCATGAAGAATGCCTACAGCATTTTTGCGTTAGTCCTCAACATGAATAATTAA(SEQ ID NO:31).
[0125] MAVKKWSPRNTSSMSRTASANIIIAVLKALGYWQWTRDPRQPYIEKVERAYRIVLHTTFPFTFIALMLTGVLLSRDLDEIGSILHVLLTEFSLIVKTLHIWRKGGVAWRFMHEVANDPIYDLRQQSEWTKWQQAQRSFAIVSNTYFVAATTVVVFACIGAMMTPADVYVLPMNIYVPFDWHHPRRYWYAWTYNTIASLMTATANAMLDLVNCYFMFHLSLLYKLIGWRLSALRRSANEPPVIEQMSEIFQMHMKVRRLTTECETLVSIPVFSQIILSSFILCFCGYRLQQMEIMENLSMLFSTVEFATVMAVQIFLPCYFGNKVTESSDALTDEIFNSDWTTFDVPTRRFMILYMELLKKPANLMSVNYFIIGVDIFAKTMKNAYSIFALVLNMNN(SEQ ID NO:32).
[0126] 4. Construction of a transgenic Drosophila melanogaster strain expressing BdorOR94b1 in vitro
[0127] Total RNA was extracted and reverse transcribed to obtain a cDNA template. The complete BdorOR94b1 sequence was cloned and a transgenic plasmid containing this sequence was constructed using the pUAST-attB plasmid as a template. Transgenic flies expressing BdorOR94b1 in vitro were constructed using the ab3A null neuron Drosophila strain, which lacks the endogenous receptor 22a. Single-sensillum recordings (SSR) were used to validate BdorOR94b1's response to ME in vitro.
[0128] 5. Construction of BdorOR94b1 Loss-of-Function Mutants
[0129] According to the genomic structure in 3, a knockout target was set on the BdorOR94b1 exon through CRISPR / Cas9-mediated knockout technology to obtain a deletion mutant with transcriptional frameshift termination, and then cultured to a homozygous strain. The specific process was the same as in 1 (3).
[0130] 6. Verify the behavioral response of mutants to ME by electrophysiology and behavior
[0131] The differences in the responses of the above mutant strains and the wild type to ME were compared through trend behavior experiments, electroantennogram recordings (EAG) and SSR technology to verify whether BdorOR94b1 is involved in the function of recognizing ME in vivo.
[0132] (1) Behavioral experiments
[0133] All insects used in trap and four-arm behavioral tests were unmated adults 12 days after eclosion. Before the experiment, they were housed in small insect cages (18 cm × 12.5 cm × 14 cm), with a controlled population of 40–45 insects per cage, and provided with ample feed and water. After reaching adulthood, healthy and active adults were selected for directional behavior experiments.
[0134] The trap experiment used artificial traps. Once adults enter the trap, they cannot escape. The traps were placed in large insect cages measuring 18 cm × 12.5 cm × 14 cm. Two traps were placed in each cage. Trap 1 served as the treatment group and contained the test odorant Me (100 μg / μL, added with 10 μL), while Trap 2 served as the control and contained the odorant solvent, paraffin oil. The experiment lasted from 9:00 AM to 10:00 AM, with light intensity maintained at 280–300 lux. The experimental environment was maintained at a temperature of (26 ± 1)°C and a relative humidity of (60 ± 5)%. After the experiment, the number of adults in the traps was recorded. Five replicates were performed per group, with 30 adults per replicate.
[0135] Fruit fly behavior was monitored in a custom-built four-arm olfactometer and recorded using an automated high-definition recording system. The four-arm olfactometer was cleaned before the experiment, and the air flow stability was tested in advance to ensure a stable flow rate of 0.4 L / min. During behavioral observation, adult flies were placed in the four-arm olfactometer. After ventilation, the flies were allowed to acclimate to the airflow and distribute evenly across the four quadrants. The airflow was then turned off again, and the test odorant, methyl eugenol (1 μg / μL, 10 μL), and control paraffin oil were added as quickly as possible. Two arms of the four-arm olfactometer were placed with the ME odor source, and the other arm was placed with paraffin oil. After ventilation, the adults' directional responses were recorded over a 10-minute period. Experiments were conducted from 8:00 AM to 9:00 AM, with light intensity set at 280–300 Lux. The behavior chamber temperature was (26 ± 1)°C and relative humidity (60 ± 5)%. After the experiment, videos were recorded and statistically analyzed. Five replicates were observed for each experiment, with 30 adults per replicate.
[0136] (2) Electrophysiological recording
[0137] EAG recording: The head of the male fruit fly was removed and one end of the antenna was cut off. Two glass electrodes were prepared and perfused with 0.1M KCl solution. The reference electrode was connected to the head incision, while the recording electrode was connected to the end of the antenna incision. Twelve 12-day-old unmated males of each genotype were recorded. Antennae potential recording was performed under a BX51 microscope (Olympus). Airflow stimulation was performed using a controller (CS-55, Syntech, Kirchzarten, Germany), with the stimulation airflow set to 1.4mL / min and the stimulation duration of 300ms. The signal was collected using a universal probe preamplifier and then converted by a digital-to-analog converter (IDAC-4-USB, Syntech, Netherlands). The collected signal was analyzed using EAG pro 2.0. The EAG reaction signal is the signal of the test compound minus the signal of paraffin oil.
[0138] SSR recordings: For fruit flies, the flies were immobilized in a 10μL pipette tip with the tip removed, and the head and antennae were extended and fixed with dental wax. Tungsten recording electrodes were inserted at the base of the sensilla. Ab3A null neurons were detected with the odor indicators 2-heptanone and hexyl acetate. A reference electrode was inserted into the compound eye. Recordings were made from 5–6 flies and 10–14 sensilla for GAL422ab / UAS-BdorOR94b1 and its GAL and UAS controls. Response profiles and dose responses of the BdorOR94b1 receptor were recorded from 6 flies and 9–11 sensilla. For the fruit fly, the flies were first immobilized in a 200μL pipette tip with the tip removed, the head extended and fixed with dental wax, and the antennae were fixed to a glass slide covered with double-sided tape. Recording electrodes with tungsten wire were inserted at the base of the sensilla, and reference electrodes, also made of tungsten wire, were inserted into the compound eye. Response profiles and dose responses of ME sensilla in wild-type males were recorded from 3–4 flies and 5–6 sensilla. Comparing BdorOR94b1 and wild-type strains, recordings were made from 3 males and 14 ME sensilla in the wild-type strain, while recordings were made from 5 males and 48 ME sensilla in the mutant strain. Sensor recordings were performed under a BX51 microscope (Olympus). Odor stimulation and signal acquisition were performed as described in EAG. The collected signals were processed using Autospike v3.9. Low-frequency filtering was performed at 300 Hz, and high-frequency filtering was performed at 2 kHz. Responses were calculated by counting the number of action potentials that increased 1 second after stimulation.
[0139] Experimental results
[0140] (1) Odor receptors expressed on the antennae mediate the attraction of ME to male Bactrocera dorsalis.
[0141] The response of Bactrocera dorsalis to ME showed sexual dimorphism, with males being strongly attracted to ME, while females showed no obvious reaction ( Figure 1 (a and b) By constructing the olfactory receptor co-receptor BdorOrco and the BdorIR8a deletion mutant BdorOrco - / - and BdorIR8a - / - (See Table 3 for screening details, Figure 2 a~j), it was found that ME had an effect on BdorOrco mutant ( Figure 2 ) male insects lost their attractant function, while knockout of BdorIR8a ( Figure 2 ) had no significant effect on the attractant effect ( Figure 1 Since the odor trap experiment cannot observe the search behavior of male B. dorsalis for ME in real time, we used an improved four-wall olfactometer ( Figure 1 Removal of the mandibular palp had little effect on the male's ME search, with only a very slight decrease. In contrast, removal of the antennae completely abolished the directional behavior ( Figure 1 f).
[0142] Table 3 Survival and mutation data in the construction of Bactrocera dorsalis mutants
[0143]
[0144] (2) Identification of BdorOR94b1 as a specific receptor for ME
[0145] The present invention discovered BdorOR94b1 (the only receptor down-regulated after ME stimulation) by using the stimulated transcriptome and qPCR technology. Figure 3 a~c, Figure 4 It is specifically expressed in the antennae of adult insects ( Figure 3 We further investigated the Drosophila ab3A null neuron system lacking endogenous 22a ( Figure 3 e) The cloned BdorOR94b1 gene was expressed, and single-sensillum recordings (SSR) showed that ME had a strong activation effect on BdorOR94b1 in ab3 sensillum ( Figure 3 middle f and g; Figure 4 The response of BdorOR94b1 is very specific. Among the 64 odors related to the oriental fruit fly tested, only ME and its analog DMP can activate this receptor. ME is the most responsive ligand and has a dose-response characteristic ( Figure 3 h and i in the middle, Figure 4 f).
[0146] (3) By constructing a deletion mutant of BdorOR94b1, we verified the important role of this receptor in mediating ME attraction behavior.
[0147] The present invention used CRISPR-Cas9 to construct a BdorOR94b1 deletion mutant (screening details are shown in Table 3, Figure 5 a~e), which has 124 bases missing in exon 1 ( Figure 5 Electroantennographic (EAG) results showed that BdorOR94b1 - / - The mutant strain basically lost the electrophysiological response to ME ( Figure 6 (a-c) SSR recording results show that the neurons that respond to ME are located in the cone sensilla (s. basiconica) ( Figure 6 d and e). This type of olfactory receptor neurons (ORNs) responded only to ME and DMP, with the strongest response to ME in a dose-dependent manner, which is consistent with the findings in the Drosophila null neuron system ( Figure 5f-i). When BdorOR94b1 was knocked out, this type of ORN no longer responded to ME and DMP, but only responded to another neuron in the same sensillum that sensed heptanal ( Figure 6 f and g). Four-arm olfactometer behavioral experiments also showed that BdorOR94b1 - / - The tendency toward ME is basically lost ( Figure 6 These results indicate that BdorOR94b1 is an essential OR for ME perception in B. dorsalis.
[0148] (4) To investigate whether ME affects the mating behavior of B. dorsalis by promoting lek localization, a series of behavioral experiments were conducted using artificial lek.
[0149] First, we compared the female preference for fed and unfed male leks. The results showed that females were more inclined to prefer males that had been fed with ME ( Figure 7 Further experiments have shown that ME can produce two compounds in male insects: trans-coniferyl alcohol (ECF) and 4,5-dimethoxy-2-(prop-2-en-1-yl)phenol (DMP), which are stored in the male insect's rectal glands. The key compound that enhances the attractiveness of male insects is ECF ( Figure 7 Middle c~g, Figure 8 ). And BdorOrco - / - Females lost their tendency to this compound ( Figure 7 These findings collectively indicate that ME-derived ECFs play a key role in mediating the localization of female Lek and that this process is also regulated by olfaction.
[0150] (5) To determine whether the lek-location behavior of B. dorsalis provides females with ample opportunities to select robust mates, thereby improving the quality of offspring and reproductive success, a series of competitive mating experiments were conducted.
[0151] Due to the mating behavior of the fruit fly ( Figure 9 a) and courtship behavior ( Figure 9 The incidence of (b) in groups is significantly higher than that in individual individuals, so we want to determine whether females can select male sexual partners based on quality, thereby improving the quality and survival rate of offspring. To test this hypothesis, the present invention introduced two normal fruit flies and two fruit flies with poor growth conditions (including three types, malnutrition ( Figure 10 ), white-eyed mutant strain Bdorwhite - / - and the white pupa mutant line Bdorwp - / -, the reproductive behavior of these strains was impaired to some extent), and then a female was provided to record her mating choice ( Figure 9 The results showed that females were more inclined to choose normal and strong males than the three reproductive defect strains ( Figure 9 The effect of this mating choice on fecundity was subsequently assessed, and it was found that mating with debilitated males resulted not only in a significantly lower number of eggs but also in a significantly lower hatching rate of larvae compared to mating with normal males ( Figure 9 These results suggest that lek behavior plays a crucial role in initiating mating and providing females with a fitness advantage, ultimately contributing to improved reproductive success and offspring quality in B. dorsalis.
[0152] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.
Claims
1. Odor receptors BdorOR94b1 Application of the invention as a target in regulating the olfactory sensitivity of the oriental fruit fly to an odor stimulating molecule, wherein the odor stimulating molecule is methyl eugenol or a derivative thereof, and the derivative is 4,5-dimethoxy-2-(2-propenyl)phenol; The modulation is by knocking out or knocking down the odor receptor BdorOR94b1 Reduce the olfactory sensitivity of the fruit fly to irritating odor molecules; The odorant receptor BdorOR94b1 The nucleotide sequence is shown in SEQ ID NO:
31.
2. BdorOR94b1 Use of an inhibitor in controlling the fruit fly and / or preparing a product for controlling the fruit fly; BdorOR94b1 Inhibitors to reduce BdorOR94b1 expression levels of substances; The reduction BdorOR94b1 The substances with expression levels include at least one of b1) to b13): b1) Targeting BdorOR94b1 CRISPR / Cas system; b2) a nucleic acid molecule encoding b1); b3) an expression cassette containing the nucleic acid molecule described in b2); b4) a recombinant vector containing the nucleic acid molecule described in b2); b5) a recombinant vector containing the expression cassette described in b3); b6) a recombinant cell containing the nucleic acid molecule described in b2); b7) a recombinant cell containing the expression cassette described in b3); b8) a recombinant cell containing the recombinant vector described in b4); b9) a recombinant cell containing the recombinant vector described in b5); b10) a recombinant microorganism containing the nucleic acid molecule described in b2); b11) a recombinant microorganism containing the expression cassette described in b3); b12) a recombinant microorganism containing the vector described in b4); b13) a recombinant microorganism containing the vector described in b5); The targeting BdorOR94b1 The CRISPR / Cas system includes targeting BdorOR94b1 sgRNA and Cas protein; the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 23 to SEQ ID NO: 26; described BdorOR94b1 The nucleotide sequence is shown in SEQ ID NO:
31.
3. A method for reducing the olfactory sensitivity of Bactrocera dorsalis to methyl eugenol, comprising knocking down / knocking out the odor receptor of Bactrocera dorsalis using gene editing technology BdorOR94b1 The odor receptor BdorOR94b1 The nucleotide sequence is shown in SEQ ID NO:
31.
4. The method according to claim 3, characterized in that The gene editing technology includes ZFNs, TALENs or CRISPR / Cas9 technology.
5. The method according to claim 4, characterized in that Knockdown / knockout of odorant receptors using CRISPR / Cas9 technology BdorOR94b1 , comprising the following steps: injecting sgRNA and Cas9 protein into Bactrocera dorsalis embryos.
6. The method according to claim 5, characterized in that The nucleotide sequences of the sgRNA are shown in SEQ ID NO: 23 to SEQ ID NO:
26.
7. A method for constructing a strain insensitive to methyl eugenol, comprising the following steps: The method according to any one of claims 3 to 6 is used to perform gene editing on the citrus fruit fly, and then the G0 generation individuals that survive to adulthood after embryo injection are hybridized with wild-type individuals, and the mutants are screened to obtain a strain insensitive to methyl eugenol.
Citation Information
Patent Citations
Recognition of benzothiazole by odorant receptor gene OR49b and application of odorant receptor gene OR49b in prevention and control of bactrocera dorsalis
CN117487815A