A strain of *Pseudomonas niger* Z01 and its application

Abstract

This invention discloses a species of *Epicoccumnigrum* Z01 and its applications in the field of microbial technology. The accession number for *Epicoccumnigrum* Z01 is CCTCC NO: M2024967. *Epicoccumnigrum* Z01 of this invention can be used in the preparation of carriers for treating or preventing infections of polymyxa infections, thereby preventing and inhibiting the infection of aquatic animals by pathogenic *Saprolegnia* in freshwater aquaculture.

Description

Technical Field

[0001] This invention relates to a type of *Acetobacter nigricans* Z01 and its applications, belonging to the field of microbial technology. Background Technology

[0002] In freshwater aquaculture, saprolegniasis (caused by fungi of the genus Saprolegnia) is a prevalent fungal disease that poses a significant threat to aquatic animals, especially fish. This disease is not highly selective in its host composition, capable of infecting aquatic animals at all life stages. Particularly during cold seasons, its morbidity and mortality rates increase significantly, becoming one of the leading causes of fish mortality. The infection mechanism of Saprolegnia is complex; through its unique effector protein transport system, it can penetrate host cells, interfering with and inhibiting the host's defense response, ultimately leading to epidermal cell damage and tissue decay, severely impacting the health and survival rate of farmed fish.

[0003] Grass carp (Ctenopharyngodon idella), as the leading freshwater fish among my country's four major domestic fish species, is valued not only for its widespread aquaculture base and high economic value, but also because, as a representative scaled fish, it is often chosen as a model organism for studying the infection mechanism of saprolegniasis. However, with the expansion of aquaculture scale and the increasing complexity of the aquaculture environment, saprolegniasis is increasingly harming grass carp and other freshwater fish, seriously affecting the sustainable development of the aquaculture industry.

[0004] Traditionally, the control of saprolegniasis has relied on chemical drugs such as malachite green, but these drugs often have residue problems and pose a potential threat to human health, so their use is strictly limited or even banned.

[0005] Therefore, this invention proposes a strain of *Pseudomonas niger* Z01 and its applications. Summary of the Invention

[0006] The purpose of this invention is to provide a *Saccharomyces niger* Z01 and its application, which can prevent and inhibit the infection of aquatic animals by pathogenic fungi *Saprolegnia* in freshwater aquaculture.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] On one hand, the present invention provides a *Epicoccumnigrum* Z01, the preservation number of which is CCTCC NO: M2024967.

[0009] Furthermore, the *Pseudomonas niger* Z01 exists in the form of living cells.

[0010] On the other hand, the present invention provides the application of Epicoccumnigrum Z01 in the preparation of a carrier for the treatment or prevention of Saprolegnia multifiliis infection, wherein the accession number of Epicoccumnigrum Z01 is CCTCCNO: M2024967.

[0011] Furthermore, the fungus is Saprolegnia.

[0012] Furthermore, the carrier is feed and / or medicine.

[0013] Furthermore, the form of the drug includes liquid, tablet, granule, pill, or capsule.

[0014] Furthermore, the liquid includes Epicoccumnigrum Z01 or its culture broth or fermentation broth.

[0015] Furthermore, the OD600 of the culture medium of *Pseudomonas niger* Z01 is 1.2-1.5, and the OD430 of the fermentation broth of *Pseudomonas niger* Z01 is 0.268.

[0016] Furthermore, the tablets, granules, pills, or capsules include lyophilized Pseudomonas niger Z01 powder.

[0017] Furthermore, the spore concentration of the *Pseudomonas niger* Z01 lyophilized powder is 1.0-8.0 × 10⁻⁶. 8 per g.

[0018] Compared with the prior art, the beneficial effects of the present invention include at least the following:

[0019] The Epicoccumnigrum Z01 of this invention can prevent and inhibit the infection of aquatic animals by pathogenic fungi in freshwater aquaculture, avoiding a series of environmental, animal health and pathogen resistance problems caused by the large-scale use of chemical pesticides, avoiding the harm of drug residues to farmed animals and humans, and more importantly, promoting the green and ecological sustainable development of freshwater fisheries. Attached Figure Description

[0020] Figure 1 This is a photograph of a dying grass carp, an embodiment of the present invention.

[0021] Figure 2 This is a photograph of *Saccharomyces niger* Z01 in the *Saprolegnia* culture medium of an embodiment of the present invention.

[0022] Figure 3 This is an agarose gel electrophoresis image of Saprolegnia multifiliis CY01 and Acori niger Z01 according to an embodiment of the present invention.

[0023] Figure 4This is a phylogenetic tree of the 16S rDNA sequences of Saprolegnia multifiliis CY01, Acori nigricans Z01 and related species in embodiments of the present invention.

[0024] Figure 5 These are the experimental group and blank control group of the first-generation flat plate confrontation experiment of the present invention.

[0025] Figure 6 This is a graph showing the inhibitory effect of the fermentation broth of *Gnaphalium affine* Z01 on *Saprolegnia* using the agar dilution method according to an embodiment of the present invention.

[0026] Figure 7 This is a graph showing the inhibitory effect of the fermentation broth of *Gnaphalium affine* Z01 on *Saprolegnia* using the liquid dilution method according to an embodiment of the present invention.

[0027] Figure 8 This is a safety evaluation diagram of the effect of *Streptococcus niger* Z01 culture medium on the blood of grass carp according to an embodiment of the present invention.

[0028] Figure 9 This is another safety evaluation diagram of the effect of *Pseudomonas niger* Z01 culture medium on the blood of grass carp according to an embodiment of the present invention.

[0029] Figure 10 This is a safety evaluation diagram of the effect of *Streptococcus niger* Z01 culture medium on grass carp tissues according to an embodiment of the present invention.

[0030] Figure 11 This is a diagram illustrating the preventive effect of *Saccharomyces niger* Z01 culture medium from this invention on grass carp infected with *Saprolegnia multifiliis* CY01.

[0031] Figure 12 This is a diagram illustrating another preventative effect of *Saccharomyces niger* Z01 culture medium from an embodiment of the present invention on grass carp infected with *Saprolegnia multifiliis* CY01.

[0032] Figure 13 This invention relates to the effects of Saprolegnia CY01 and Acetobacter nigricans Z01 on grass carp tissues. Detailed Implementation

[0033] Exemplary embodiments will now be described more fully with reference to the accompanying drawings. However, these exemplary embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, they are provided to make the invention more comprehensive and complete, and to fully convey the concept of the exemplary embodiments to those skilled in the art. The same reference numerals in the drawings denote the same or similar structures, and therefore repeated descriptions of them will be omitted.

[0034] The terms used to express position and direction in this invention are illustrated with reference to the accompanying drawings, but changes can be made as needed, and all such changes are included within the scope of protection of this invention.

[0035] This application includes a description of the strains, drugs, and instruments involved:

[0036] Potato glucose agar medium was purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd.

[0037] Potato glucose broth culture medium was purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd.

[0038] Giemsa staining solution was purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0039] The sterile gauze is gauze that has been sterilized at high temperature. The gauze was purchased from Caoxian Hualu Sanitary Materials Co., Ltd., with production batch number 23082501 and specifications of 21s x 32s.

[0040] The Ezup column-type fungal genomic DNA extraction kit was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0041] Epicoccumnigrum Z01 was collected from the laboratory of the Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, and deposited at the China Center for Type Culture Collection, Luojia Mountain, Bayi Road, Wuchang District, Wuhan, Hubei Province, China, with accession number CCTCCNO: M2024967 and deposit date of May 16, 2024.

[0042] This invention uses Giemsa staining to observe blood cell morphology, including:

[0043] Boil the slide with soap or laundry detergent for 20 minutes, then rinse repeatedly with hot water and tap water. Finally, rinse 3 to 5 times with distilled water, or soak in 95% alcohol for 1 hour and then wipe or dry. Draw blood from the back of a grass carp and drop the blood onto one end of a prepared slide about 4-5 mm deep. Use a spreader to evenly spread the blood onto the slide, forming a thin and uniform blood film. After the blood film dries, fix it with anhydrous methanol for 3 minutes, then stain with Giemsa staining solution at room temperature for 15 minutes. Finally, slowly rinse the slide with distilled water from one end, air dry, and examine under a microscope.

[0044] The method for calculating the number of white blood cells in this invention includes (generally, counting in parallel 5 times and taking the average):

[0045] White blood cell count = A / N × M1 × 10 × 10 6

[0046] In the formula, N is the number of squares observed under the microscope, and N is 4 in this invention; M1 is the magnification of the blood smear, and M1 is 20 in this invention; A is the total number of white blood cells in the N squares observed under the microscope.

[0047] The preparation of paraffin sections according to the present invention includes:

[0048] After collecting skin, liver, spleen, mid-kidney, intestine, and muscle tissue from grass carp, the tissues were immediately fixed in Born's solution. After 20 hours of fixation, the tissues were transferred to an alcohol solution for dehydration, followed by paraffin embedding, sectioning, hematoxylin-eosin staining, and neutral resin mounting. The tissues were then observed and photographed under a microscope (Olympus BX51).

[0049] (I) Separation and Identification

[0050] 1.1 Isolation of Saprolegnia pathogen and antagonistic fungal strains:

[0051] Grass carp with wounds on their bodies were collected from aquaculture ponds in Jingzhou, Hubei Province, and labeled as Grass Carp A. For application, refer to... Figure 1 Grass carp A had congestion around its eyes and at the base of its pelvic fins, and some scales were missing from its body surface. Grass carp A was then transported to the laboratory of the Yangtze River Fisheries Research Institute of the Chinese Academy of Fishery Sciences.

[0052] Spray the body surface of grass carp A with alcohol, remove the eyes of grass carp A, puncture the lens with sterile tweezers, and place the punctured lens on potato dextrose agar medium. Incubate at 25°C for 3 days, and mycelia will grow on the potato dextrose agar medium.

[0053] Using a sterile scalpel, cut a 5mm x 5mm rectangular piece covered with mycelium. Invert the 5mm x 5mm rectangular piece covered with mycelium onto a fresh potato dextrose agar medium (with the mycelium facing the agar medium) and incubate at 25°C for 3 days. Repeat this step until a single strain grows on the potato dextrose agar medium. The white strain with mycelium is the pathogen of Saprolegnia.

[0054] For the single pale yellow strain (with an inhibition zone) on potato dextrose agar medium, a 5mm x 5mm rectangular piece was cut using a sterile scalpel. This 5mm x 5mm rectangular piece was then inverted onto a fresh potato dextrose agar medium (with the pale yellow strain facing the agar medium) and incubated at 25°C for 3 days. This process was repeated until a single strain grew on the potato dextrose agar medium. 1.2 Purification of Saprolegnia pathogen and antagonistic superbug strains

[0055] After typical colonies appear on potato dextrose agar, select single white colonies exhibiting the colony characteristics of standard Saprolegnia, standard Epicoccus nigrum colonies, and single yellow colonies producing inhibition zones (inhibiting the Saprolegnia pathogen), respectively, for reference. Figure 2 .

[0056] The two selected single colonies were cultured three times consecutively. The colony morphology in the culture medium was consistent, and the cell morphology of the strain was uniform. This yielded a pure strain of the Saprolegnia pathogen and a pure strain of the antagonistic true strain.

[0057] 1.3 Biological identification of pathogenic bacteria and antagonistic fungal strains:

[0058] The specific method refers to the instructions of the Fungal Extraction Kit (Ezup Column-Based Fungal Genomic DNA Extraction Kit) for extracting DNA from Saprolegnia pathogens and antagonistic fungal strains.

[0059] ITS rDNA analysis

[0060] The universal primers ITS1 and ITS4 for the fungal ITS region were used to identify pathogenic bacteria and antagonistic fungal strains: primer ITS1: 5'-TCCGTAGGTGAACCTGCGG-3'; primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3').

[0061] PCR reaction system: Using the extracted genome as a template, the total system volume is 50 μl: 25 μl ExTaq enzyme, 2 μl primer ITS1, 2 μl primer ITS4, 2 μl template, and double-distilled water to bring the volume to 50 μl.

[0062] PCR amplification conditions: Pre-denaturation at 95℃ for 3 min. 35 reaction cycles: denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min. Final extension at 72℃ for 10 min. Terminate the reaction at 4℃.

[0063] After amplification, 5 μl of the PCR product was subjected to 1% agarose gel electrophoresis, and the amplified product was sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The sequencing results were aligned using GenBank blast, and a phylogenetic tree was constructed using the neighbor-joining method with MEGA 5.0 software.

[0064] Figure 3 In the diagram, M represents the standard template; 1, 2, 3, and 4 are pathogenic bacteria; and 5 and 6 are antagonistic fungal strains. (Reference) Figure 3 It can be seen that the 16S rDNA sequence length of the pathogen is 708 bp, while the 16S rDNA sequence length of the antagonistic euphemism is 527 bp. (Reference) Figure 4 The pathogen clustered with *Saprolegnia ferax* (accession number: AY270032.1). Based on morphological and molecular biological characteristics, the pathogen was identified as *Saprolegnia ferax* and named *Saprolegnia ferax* CY01. (Reference) Figure 4The antagonistic euphratica strain showed 100% homology with Epicoccumnigrum and clustered with Epicoccumnigrum (accession number: OQ555113.1). Based on morphological and molecular biological characteristics, the antagonistic euphratica strain was identified as Epicoccumnigrum and named Epicoccumnigrum Z01.

[0065] The nucleotide sequence of *Streptococcus niger* Z01 is as follows:

[0066] GGGTGACCTGCGGAAGGATCATTACCTAGAGTTTGTAGACTTCGGTCTGCTACCTCTT

[0067] ACCCATGTCTTTTGAGTACCTTCGTTTCCCTCGGCGGGTCCGCCCGCCGATTGGACAAC

[0068] ATTCAAACCCTTTGCAGTTGCAATCAGCGTCTGAAAAAACATAATAGTTACAACTTTC

[0069] AACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTA

[0070] GTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTG

[0071] GTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGT

[0072] TGGGGTTTTGTCTCGCCTCTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCG

[0073] TATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGGCGACGTCCAAA

[0074] AGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT

[0075] ATCT

[0076] The nucleotide sequence of Saprolegnia multifiliis CY01 is as follows:

[0077] GAAGGATCATTACCACACCAAAAAACACCCCACGTGAATGTACTCTTTATGAGGCTTG

[0078] CGCTGCCCTTGTGGCGGCTAGCCGAAGGTTTCGCAAGAAGCCGATGTCAATTTGAATC

[0079] CTTTTTAAACTACGACTGATCAAAACTGCAGATAGAAATGTCTGCATGCAATTGAAATA

[0080] CAACTTTCAACAGTGGATGTCTAGGCTCGCACACCGATGAAGAACGCTGCGAACTGC

[0081] GATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCAAAATTTTGAACGCATATTGCA

[0082] CTTCCGGGTTAGTCCTGGGAGTATGTTTGTATCAGTGTCCGTGAACACAACCTTGTTTC

[0083] ATTTCTTGATTGAGATGGAGCAGAATGTGAAGGTCTTGTAATTACAAGTCCTTTTAAAC

[0084] GACGGTACCTATGCGTCCTCGTGAGATGTATTATTTAAAGGTATGCCTGCGCTTCTTTC

[0085] GAGAGTTTTGTGTGGCGGCACACAGCATTCAAAGAGAGAGCAAATCGCGGTAGTTTT

[0086] GCTTGTATTTCGGTACGAGTGGACACATATTGCTTTTTGTGATTTCTGCGAGTCTGTTG

[0087] TTTAAGCACAGGACACGTAAGGAGAGTGAGTATGCTGGTGCATTTCTTGGCGCATGGA

[0088] GGCAAATTGGGAATTCAATCCAATTTGGACCTGATATCAAACAAGACTACCCGCTGAA

[0089] CTTAAGCA

[0090] (II) Antagonistic activity and passage stability of antagonistic fungi

[0091] The primary *Saprolegnia multifiliis* CY01 purified in section 1.2 was used as the test strain, and the primary *Achnatherum niger* Z01 purified in section 1.2 was used as the antagonistic superbug strain. The plate confrontation experiment was performed using the agar transfer method.

[0092] 2.01 Generation Flat Panel Standoff Experiment

[0093] Experimental group: A 6mm diameter Saprolegnia glutinosa CY01 agar block was placed upside down in the center of potato dextrose agar medium, with the side with Saprolegnia hyphae in close contact with the surface of potato dextrose agar medium. At the same time, a 5mm x 5mm Nephrolepis exigua Z01 agar block was placed upside down on both sides of the Saprolegnia glutinosa CY01 agar block.

[0094] Blank control group: An inverted piece of Saprolegnia glutinosa CY01 agar block with a diameter of about 6 mm was placed in the center of potato dextrose agar medium, with the side with Saprolegnia hyphae in close contact with the surface of potato dextrose agar medium.

[0095] Both the experimental group and the blank control group were incubated upside down in a 25°C incubator for 3 days. The results were observed and referenced. Figure 5 , where a is the blank control group and b is the experimental group.

[0096] 2.02 Second-generation flat-plate confrontation experiment

[0097] Experimental group: The difference between the experimental group and the experimental group of the first-generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was removed from the experimental group of the first-generation plate confrontation experiment using a sterile scalpel.

[0098] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0099] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0100] 2.03 Third-generation flat-plate confrontation experiment

[0101] Experimental group: The difference between the experimental group and the experimental group of the first-generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was removed from the experimental group of the second-generation plate confrontation experiment using a sterile scalpel.

[0102] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0103] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0104] 2.04 Fourth-generation flat-plate confrontation experiment

[0105] Experimental group: The difference between the experimental group and the experimental group of the first generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was taken from the experimental group of the third generation plate confrontation experiment using a sterile scalpel.

[0106] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0107] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0108] 2.05 Fifth-Generation Flat Panel Standoff Experiment

[0109] Experimental group: The difference between the experimental group and the experimental group of the first generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was taken from the experimental group of the fourth generation plate confrontation experiment using a sterile scalpel.

[0110] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0111] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0112] 2.06 Sixth Generation Flat Panel Standoff Experiment

[0113] Experimental group: The difference between the experimental group and the experimental group of the first generation plate confrontation experiment is that the agar block of *Pseudomonas niger* Z01 was taken from the experimental group of the fifth generation plate confrontation experiment using a sterile scalpel.

[0114] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0115] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0116] 2.07 Seventh Generation Flat Panel Standoff Experiment

[0117] Experimental group: The difference between the experimental group and the experimental group of the first generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was taken from the experimental group of the sixth generation plate confrontation experiment using a sterile scalpel.

[0118] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0119] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0120] 2.08 Eighth-generation flat-panel confrontation experiment

[0121] Experimental group: The difference between the experimental group and the experimental group of the first generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was taken from the experimental group of the seventh generation plate confrontation experiment using a sterile scalpel.

[0122] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0123] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0124] 2.09 Ninth Generation Flat Panel Standoff Experiment

[0125] Experimental group: The difference between the experimental group and the experimental group of the first generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was taken from the experimental group of the eighth generation plate confrontation experiment using a sterile scalpel.

[0126] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0127] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0128] 2.10 Tenth-Generation Flat Panel Standoff Experiment

[0129] Experimental group: The difference between the experimental group and the experimental group of the first generation plate confrontation experiment is that the Z01 agar block of *Acetobacter nigricans* was removed from the experimental group of the ninth generation plate confrontation experiment using a sterile scalpel.

[0130] Blank control group: the same as the experimental group in the first-generation plate confrontation experiment.

[0131] Other culture conditions were the same as those in the first-generation plate confrontation experiment.

[0132] Each experiment was conducted in triplicate. The changes in the antagonistic activity of *Pseudomonas nigricans* Z01 in each generation of plate confrontation experiments were observed, and its stability was determined by measuring the size of the inhibition zone of *Pseudomonas nigricans* Z01. See Table 1 for details.

[0133] Table 1. Inhibitory effect of *Gnaphalium affine* Z01 on *Saprolegnia*.

[0134]

[0135] Note: The data in Table 1 are mean ± standard deviation.

[0136] After ten passages, the diameter of the inhibition zone of *Pseudomonas niger* Z01 narrowed slightly, indicating a slight decrease in antagonistic activity. This may be because the culture conditions did not reach the optimal growth state for *Pseudomonas niger* Z01, inducing the appearance of degenerate spores, promoting their rapid reproduction and degeneration. When the number of degenerate spores was much greater than that of normal cells, the antibacterial activity of *Pseudomonas niger* Z01 decreased. There was no significant difference in antibacterial effect between the subcultured strains and the primary strains of *Pseudomonas niger* Z01 (P>0.05). In conclusion, the antagonistic activity of *Pseudomonas niger* Z01 is generally stable and does not disappear with increasing passage numbers.

[0137] (III) The inhibitory effect of antagonistic fungal culture broth and fermentation broth on water mold.

[0138] 3.1 Preparation of *Pseudomonas nigricans* Z01 culture medium and *Pseudomonas nigricans* Z01 fermentation broth

[0139] 3.1.1 Preparation of *Pseudomonas niger* Z01 culture medium

[0140] The purified primary *Pseudomonas nigricans* Z01 strain from step 1.2 was inoculated into 200 mL of potato dextrose broth and cultured in a shaker at 175 rpm and 25°C for 5 days. Then, the culture was filtered through three layers of sterile gauze to obtain the *Pseudomonas nigricans* Z01 culture medium. The OD600 of the *Pseudomonas nigricans* Z01 culture medium was 1.2–1.5.

[0141] 3.1.2 Preparation of Fermentation Broth of *Pseudomonas niger* Z01

[0142] The filtrate was centrifuged at 10,000 rpm for 10 min to remove solid impurities from the *Pseudomonas nigricans* Z01 culture, yielding a supernatant. The supernatant was then filtered through a 0.22 μm filter membrane to obtain the *Pseudomonas nigricans* Z01 fermentation broth. The OD430 of the *Pseudomonas nigricans* Z01 fermentation broth was 0.268.

[0143] 3.2 Inhibitory effect of *Gnaphalium affine* Z01 fermentation broth on *Saprolegnia*

[0144] 3.2.1 Agar dilution method

[0145] Experimental group: Before plating, the fermentation broth of *Gnaphalium affine* Z01 (OD430 = 0.268) was mixed with potato dextrose agar medium at certain ratios (1:9, 2:8, 3:7, 4:6, 5:5), and then poured into plates to obtain mixed plates of 1:9, 2:8, 3:7, 4:6, and 5:5. Then, the primary *Saprolegnia multifiliis* CY01 purified in section 1.2 was inoculated onto each mixed plate and incubated at 25℃ for 3 days. The mycelial growth of *Saprolegnia multifiliis* CY01 on each mixed plate was observed.

[0146] Blank control group: The primary Saprolegnia glutinosa CY01 purified in 1.2 was inoculated on 100% potato dextrose agar medium and incubated at 25℃ for 3 days. The mycelial growth of Saprolegnia glutinosa CY01 on 100% potato dextrose agar medium was observed.

[0147] Three parallel experiments were set up for each experimental group and the blank control group.

[0148] refer to Figure 6 Mixed plates containing *Saccharomyces niger* Z01 fermentation broth significantly inhibited the growth of *Saprolegnia multifiliis* CY01. When the ratio of *Saccharomyces niger* Z01 fermentation broth to potato dextrose agar medium was greater than 3:7, the growth of *Saprolegnia multifiliis* CY01 was completely inhibited.

[0149] 3.2.2 Liquid dilution method

[0150] The experiment was conducted in 24-well plates. A 5mm x 5mm agar block confluent with *Saprolegnia multiflora* CY01 was placed in each well. 2 mL, 1 mL, 0.5 mL, 0.25 mL, 0.1 mL, and 0 mL (blank group) of *Saprolegnia niger* Z01 fermentation broth were added, respectively, and the volume was brought to 2 mL with potato dextrose broth. Each treatment was replicated in triplicate, and the plates were incubated at 25°C for 48 h. Mycelial growth of *Saprolegnia multiflora* CY01 was monitored under an optical microscope.

[0151] refer to Figure 7 In the control group, due to the absence of *Pseudomonas niger* Z01 fermentation broth, *Saprolegnia multifiliis* CY01 hyphae were robust, and *Saprolegnia multifiliis* CY01 spores were active and continuously germinated. In the experimental group, although 0.1 mL of *Pseudomonas niger* Z01 fermentation broth was added, the concentration of *Pseudomonas niger* Z01 fermentation broth was too low, and only a very small number of *Saprolegnia multifiliis* CY01 spores could still be observed germinating under an optical microscope. In other experimental groups, due to the high concentration of *Pseudomonas niger* Z01 fermentation broth, no germinating *Saprolegnia multifiliis* CY01 spores were observed. In addition, compared to the control group, the *Saprolegnia multifiliis* CY01 hyphae in the experimental group were more slender. (IV) Application of antagonistic fungal culture medium on fish

[0152] 4.1 Safety evaluation of *Pseudomonas nigricans* Z01 culture medium for grass carp

[0153] Grass carp weighing 70-100g were temporarily raised for 14 days and then divided into a blank control group and a safety evaluation group. Each experiment was set up in triplicate, with 20 grass carp in each parallel.

[0154] Safety evaluation group: *Pseudomonas nigricans* Z01 culture medium was added to the aquaculture water, and the final *Pseudomonas nigricans* Z01 spore concentration was 2.0 × 10⁻⁶. 8 Spores / mL, cultured at 25℃ for 7 days.

[0155] Blank control group: Sterile potato glucose broth medium was added to the aquaculture water and cultured at 25°C for 7 days.

[0156] The volume of sterile potato glucose broth culture medium added to the blank control group was the same as the volume of *Pseudomonas nigricans* Z01 culture medium added to the safety evaluation group.

[0157] Blood was collected from grass carp for white blood cell count and hemoglobin level testing; the collected blood was stained with Giemsa to observe blood cell morphology. Simultaneously, liver, spleen, mid-kidney, and intestine were prepared for paraffin sectioning.

[0158] No deaths occurred in the grass carp in either the control group or the safety evaluation group during the 7-day observation period. Furthermore, such as... Figure 8 As shown, the number of white blood cells in the safety evaluation group was significantly increased compared with the control group (P<0.05), and the hemoglobin level of the fish significantly increased after immersion in culture medium Z01. (Reference) Figure 9 Under a microscope, it was observed that the blood cells showed no change in morphology after Giemsa staining, and were in good condition and of moderate size.

[0159] Figure 10 Pathological sections were prepared from the liver, spleen, mid-kidney, and intestine of grass carp that had been soaked in *Acetobacter nigricans* Z01 culture medium. (Reference) Figure 10 It was observed that in the liver tissue, the hepatic plates were distributed in a radiating pattern centered on the central vein; the hepatocytes were irregular polygons with sparse, vacuolated cytoplasm. The spleen was mainly composed of densely packed red blood cells, with numerous brownish granular substances visible. The mesonephric tissue showed clear renal tubular structures, with a small amount of brownish granular substances and no obvious inflammatory cell infiltration. The intestinal villi epithelium showed hyperplasia, with irregular cell arrangement and occasional punctate epithelial necrosis, but no obvious inflammatory cell infiltration. Therefore, after 7 days of immersion in *Achnatherum gracile* Z01 culture medium, the grass carp remained safe and undamaged.

[0160] 4.2 Application of *Gnaphalium affine* Z01 culture medium in preventing grass carp infection with *Saprolegnia multifiliis* CY01

[0161] Sixty grass carp of uniform size (70-100g) were randomly divided into four aquariums: a positive control group, an immersion group, a gavage group, and an injection group. Prior to the experiment, identical wounds of the same size were artificially created on the same part of each grass carp in the positive control group, immersion group, gavage group, and injection group, and the fish were infected with Saprolegnia glutinosa CY01 (for details, refer to the method of infection described in Xu Jialu's 2012 paper "Construction and Application of Fish Saprolegnia Disease Model" published in the Journal of Shanghai Ocean University).

[0162] Immersion group: *Pseudomonas nigricans* Z01 culture medium was added to the aquaculture water, resulting in a final concentration of *Pseudomonas nigricans* Z01 spores of 1.0 × 10⁻⁶. 8 Z01 spores / mL, and maintain the water temperature at 18℃.

[0163] Injection group: The concentration of *Pseudomonas niger* Z01 spores was 1.0 × 10⁻⁶. 8 200 μl of *Pseudomonas niger* Z01 culture medium with spores / mL was injected into the muscle of grass carp, and the water temperature was maintained at 18℃.

[0164] Gavage group: The concentration of *Pseudomonas niger* Z01 spores was 1.0 × 10⁻⁶. 8 200 μl of *Pseudomonas niger* Z01 culture medium with spores / mL was injected into the abdomen of grass carp, and the water temperature was maintained at 18℃.

[0165] Positive control group: Potato glucose broth culture medium was added to the culture water and the water temperature was maintained at 18℃.

[0166] The volume of potato dextrose broth added to the positive control group was the same as the volume of *Saprolegnia niger* Z01 culture medium added to the immersion group. The infection rate of *Saprolegnia* was calculated based on the presence of hyphae on the grass carp's body surface. Simultaneously, blood was collected from the grass carp, and Giemsa staining was used to observe blood cell morphology.

[0167] refer to Figure 11 The cumulative infection rates of the injection group, immersion group, and gavage group compared with the positive control group at 7 days were significantly different (P<0.05). Specifically, the cumulative infection rate at 7 days was 80% in the positive control group, 30% in the injection group, 20% in the immersion group, and 40% in the gavage group. This indicates that *Gnaphalium affine* Z01 can significantly reduce the infection rate of grass carp when they are threatened by *Saprolegnia multifiliis* CY01 infection.

[0168] Figure 12 In the diagram, a represents the positive control group; b represents the immersion group; c represents the injection group; and d represents the gavage group. (Reference) Figure 12 Compared to the positive control group, the hemocytology of grass carp in the injection, immersion, and gavage groups remained unchanged, but the white blood cell count in each group increased slightly, with a significant difference between the immersion group and other groups. After infection with Saprolegnia, the hemoglobin levels in all groups decreased significantly, but there was no significant difference between the immersion, injection, and gavage groups and the positive control group. Therefore, *Gnaphalium affine* Z01 has no safety impact on the tested grass carp.

[0169] 4.3 Application of *Gnaphalium affine* Z01 culture medium in grass carp infected with *Saprolegnia multifiliis* CY01

[0170] Thirty grass carp successfully infected with Saprolegnia glutinosa CY01 (with visible hyphae at the wound sites on the fish's body) were divided into a treatment group and an infection group, with three parallel groups in each group.

[0171] Treatment group: *Pseudomonas nigricans* Z01 culture medium was added to the aquaculture water, resulting in a final *Pseudomonas nigricans* Z01 spore concentration of 2.0 × 10⁻⁶. 8 Spores / mL, soaked continuously for 3 days, each soaking time was 1 hour, and the soaking temperature was 25℃.

[0172] Infection group: Potato glucose broth culture medium was added to the aquaculture water and soaked continuously for 3 days, with each soaking time lasting 1 hour and the soaking temperature being 25℃.

[0173] The volume of potato dextrose broth culture medium added to the infection group was the same as the volume of *Pseudomonas nigricans* Z01 culture medium added to the treatment group. Observations were conducted for 7 consecutive days. Blood samples were collected for white blood cell count and hemoglobin level testing. Intestinal, skin, muscle, and liver samples were also collected for paraffin sectioning.

[0174] Compared to healthy grass carp, the white blood cell count of the infected grass carp fluctuated less, but the hemoglobin content was significantly reduced.

[0175] refer to Figure 13 Compared to healthy grass carp, the infected group of grass carp showed varying degrees of lesions in their skin, muscles, intestines, and liver. Under water mold treatment, the grass carp's epidermis was slightly thinned; a significant reduction in pigment was observed in the pigment layer; numerous muscle cells showed necrosis, cytoplasmic fragmentation, and irregular cell arrangement in the muscle tissue; irregularly shaped intestinal villi were occasionally observed in the intestinal tissue; the mucosal epithelium remained intact, but a large number of cells in the lamina propria were reduced, and the mucosal epithelium separated from the lamina propria; the liver tissue showed diffuse hydropic degeneration of hepatocytes, with loose and pale cytoplasm, which were the earliest changes observed in cell damage.

[0176] Compared to healthy grass carp, no significant differences were observed in the skin of the grass carp in the treatment group; a slight reduction in pigmentation was observed in the pigment layer, with uneven distribution; a decrease in the number of cells in the lamina propria of the intestinal villi was occasionally observed in the intestinal tissue; diffuse ballooning degeneration of hepatocytes was observed in the liver tissue, with cells showing edema, cytoplasmic vacuolation, and swelling like balloons in severe cases.

[0177] In the infected group, grass carp infected with Saprolegnia showed a significant reduction in pigment in the skin's pigment layer, while in the treatment group, treatment with *Nematocystis niger* Z01 culture medium resulted in a significant increase in pigment in the grass carp's pigment layer. The infected group also experienced severe damage to muscle tissue with significant muscle cell necrosis. In the treatment group, treatment with *Nematocystis niger* Z01 culture medium showed a trend towards an increase in the number of lamina propria cells. However, compared to healthy grass carp, there were no significant changes in the liver tissue of either the infected or treatment groups.

[0178] Therefore, the *Saccharomyces niger* Z01 and its culture and fermentation broth of the present invention can be used in the preparation of carriers for treating or preventing fungal infections (e.g., *Saprolegnia multifiliis*). The carriers include feed and drugs. The drugs can be in the form of liquids, tablets, granules, pills, or capsules. When applied, the tablets, granules, pills, or capsules include *Saccharomyces niger* Z01 lyophilized powder. The bacterial concentration of the *Saccharomyces niger* Z01 lyophilized powder is 1.0-8.0 × 10⁻⁶ spores. 8 per g.

[0179] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the invention without departing from the principles and spirit of the invention, and all such changes should fall within the protection scope of the claims of the present invention.

Claims

1. A type of *Pseudomonas nigricans* Z01, characterized in that, The preservation number of Epicoccumnigrum Z01 is CCTCC NO: M2024967.

2. The *Pseudomonas nigricans* Z01 according to claim 1, characterized in that, The *Pseudomonas niger* Z01 exists in the form of living cells.

Images