Preparation and application of a cerevisiae yeast INM3111 strain for improving the softness of whole-grain bread

Abstract

The present invention provides the preparation and application of a brewer's yeast strain INM3111 for improving the softness of whole-grain bread. Saccharomyces cerevisiae INM3111 was deposited with the Guangdong Provincial Microbiological Culture Collection on July 1, 2024, with accession number GDMCC NO: 64795. The deposit address is: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou. The advantage is that it effectively improves the ability of whole-grain dough to produce higher levels of maltooligosaccharides after fermentation.

Description

Technical Field

[0001] The invention relates to the preparation and application of a brewer's yeast INM3111 strain for improving the softness of whole-grain bread. Background Art

[0002] Whole-grain bread is made from wheat flour without the bran and germ removed, unlike conventional bread made from refined white flour (wheat kernels with the bran and germ removed). Because whole-grain bread is less processed, it retains most of its nutrients. It's rich in fiber, vitamin E, and B vitamins, as well as minerals like zinc and potassium. However, it has a rough texture, is generally hard, and lacks flavor.

[0003] Saccharomyces cerevisiae, also known as baker's yeast or budding yeast, is the yeast most commonly associated with humans, used to make foods such as bread and steamed buns, as well as to make wine. Saccharomyces cerevisiae cells are spherical or ovoid, and reproduce by budding. Saccharomyces cerevisiae shares many structures with animal and plant cells, which are also eukaryotic organisms. Saccharomyces cerevisiae is also easy to culture, making it a model organism for eukaryotic research. It is considered the most promising strain for large-scale production.

[0004] Maltooligosaccharides are made from high-quality starch through enzymes, refined through a series of processes including liquefaction, concentration, and drying. Maltooligosaccharides include linear maltooligosaccharides containing only α-1,4 glycosidic bonds and branched maltooligosaccharides containing α-1,6 glycosidic bonds (also known as isomaltooligosaccharides). Similar to water-soluble plant fiber, they are easily digestible, low in sweetness, and low in osmotic pressure. They can extend energy supply time, enhance endurance, and fight fatigue. Representative sugars for maltooligosaccharides with α-1,4 glycosidic bonds include maltose (G2), maltotriose (G3), maltotetraose (G4), malpentaose (G5), maltohexaose (G6), maltoheptaose (G7), maltooctaose (G8), maltononaose (G9), and maltodecaose (G10).

[0005] Studies have shown that maltooligosaccharides have moisturizing properties, preventing water from evaporating, effectively maintaining the moisture and quality of various foods. They can also inhibit the formation of sucrose and glucose crystals. Starch-based foods, such as bread and desserts, often harden after a short storage period. Adding maltooligosaccharides can prevent starch aging and extend the shelf life of foods.

[0006] Currently, there are various studies on the preparation of maltooligosaccharides. Patent: A method for preparing high-purity maltooligosaccharides - CN202011409682.3. This invention discloses a starch liquefaction liquid obtained by combined acid and enzyme liquefaction, which has a high degree of saccharification and good filterability. The amount of enzyme used is greatly reduced, and the purity of the prepared maltooligosaccharides can reach over 90%. However, it does not involve yeast fermentation to enhance the application of maltooligosaccharides in baking.

[0007] Patent: Mixed Sugar Composition Containing Maltooligosaccharides - CN201980055936.5. This invention relates to a mixed sugar containing maltooligosaccharides. Compared with existing maltooligosaccharides, glucose syrup, maltose syrup, and low-DE glucose syrup, it has a lower sugar content and lower calories, while achieving the same viscosity as existing starch syrups. However, it does not involve the use of yeast fermentation to improve the softness of whole-grain bread.

[0008] Patent: A process for preparing malto-oligosaccharide syrup with a high maltotetraose content - CN202010268214.2. This invention provides a process for preparing malto-oligosaccharide syrup with a high maltotetraose content. The process utilizes a two-step enzymatic saccharification process, first adding pullulanase and then maltotetrasaccharidase, to improve the maltotetraose conversion rate and simplify the process flow, resulting in a malto-oligosaccharide syrup with a maltotetraose content of ≥65%. This patent does not cover the production of multiple maltose sugars by yeast fermentation. Patent: A malto-oligosaccharide syrup and its preparation process - CN201811215213.0. This invention discloses a malto-oligosaccharide syrup and its preparation process. The liquefied liquid is saccharified in the form of a double enzyme compound. The mass percentage content of each component of the malto-oligosaccharide syrup is: maltodextrin 22-28%, maltotetraose 59-62%, maltotriose 8-12%, maltose 4-6%, and glucose 2-3%. However, it does not involve yeast fermentation and its application in baking.

[0009] While the aforementioned patents describe methods for producing maltooligosaccharides using enzymes or a combination of chemical and enzymatic methods, they do not address the impact of yeast fermentation on the texture of baked whole-grain products. Furthermore, they do not specify which oligosaccharide in maltooligosaccharides improves the softness of whole-grain bread. Therefore, developing a safe and effective strain that enhances the softness of whole grains and understanding the role of its key components holds great promise.

[0010] Although many studies have shown that oligomaltodextrin can effectively increase the content and types of maltodextrin, there are still some deficiencies in its practical application: (1) It has not been applied to whole-grain baked products; (2) The main components that affect the softness of whole-grain products have not been studied; and (3) There is a lack of research on a yeast strain that can be directly used to increase the content of oligomaltodextrin in the whole-grain fermentation stage. Summary of the Invention

[0011] In response to the above problems, the present invention provides a preparation and application of a brewer's yeast INM3111 for improving the softness of whole-grain bread. On the basis of not changing the existing process, a method for preparing a whole-grain product and improving the softness of the whole-grain product is achieved by fermenting dough with yeast. The method not only increases the oligosaccharide content of the whole-grain product, but also reveals the main component of oligosaccharide that affects the softness of the whole-grain product. The whole-grain product produced by using the preparation does not affect the overall process of the whole-grain product after fermentation, and not only improves the taste of the whole-grain product but also improves the nutritional value of the whole-grain product.

[0012] The object of the invention is achieved through the following scheme: A brewer's yeast, Saccharomyces cerevisiae INM3111, which improves the softness of whole-grain bread, was deposited in the Guangdong Provincial Microbiological Culture Collection Center on July 1, 2024, with the deposit number: GDMCC NO: 64795; the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0013] Furthermore, the colony characteristics of Saccharomyces cerevisiae are as follows: after culturing on solid malt extract plate medium for 48 hours, the colony diameter reaches 5-6 mm, the colony is milky white, the colony is raised and round, the surface is smooth, and the colony edge is neat.

[0014] A method for preparing brewer's yeast for improving the softness of whole-grain bread,

[0015] Step 1: Isolation of Saccharomyces cerevisiae: Isolate and screen yeast from fermented yogurt samples, make the yogurt product into a slurry, add it to sterile water, and dilute it to a concentration of 10 5 -10 6 , the dairy products of different dilution concentrations were evenly spread on the solid malt wort medium, placed in an incubator at 30°C for 48 hours, and then white colonies on the solid malt wort medium were selected, and the morphologically consistent brewer's yeast was screened;

[0016] Step 2: Saccharomyces cerevisiae screening: The obtained Saccharomyces cerevisiae was cultured to the logarithmic growth phase, and then inoculated with 1% of the strain at a final concentration of 1×10 6 cfu / mL, inoculated into the screening culture medium solution, placed in a static culture at 30℃ for 48h to obtain the fermentation liquid; the content and type of oligomaltose were measured.

[0017] Furthermore, the formula of the screening culture medium solution is as follows: 5 g of soluble starch and 1 g of yeast extract powder are dissolved in 1000 mL of distilled water, sterilized at 0.1 MPa and 121° C. for 15 min.

[0018] An application of brewer's yeast to improve the softness of whole grain bread, production application: according to the production process of whole grain products, in the fermented whole grain flour, the inoculation amount is 10 4 -10 8 cfu / mL of yeast, the fermentation time was 12h and the fermentation temperature was 37℃, and the content of oligosaccharides in the noodles and its sensory quality were detected.

[0019] The invention discloses an application of yeast fermented dough containing brewer's yeast for improving the softness of whole-grain bread.

[0020] Application of brewer's yeast whole grain flour fermentation to improve the softness of whole grain bread

[0021] The invention discloses an application of brewer's yeast for effectively improving the ability of whole-grain dough to produce higher maltooligosaccharides after fermentation.

[0022] The invention discloses an application of brewer's yeast for effectively increasing the content of main softening components of whole-grain dough after fermentation.

[0023] Advantages of the present invention: (1) The brewer's yeast of the present invention can effectively improve the ability of whole-grain dough to produce higher maltooligosaccharides after fermentation.

[0024] (2) The brewing yeast of the present invention can effectively increase the content of the main softening components of whole grain dough after fermentation, thereby improving the nutritional value.

[0025] (3) The brewing yeast of the present invention improves the aroma and taste characteristics of whole grain products.

[0026] (4) The screening method of brewer's yeast of the present invention is universal and can be widely used in screening strains for increasing the content of oligomaltose in whole grain products.

[0027] (5) The brewing yeast provided by the present invention has the ability to enhance the flavor of whole grains, and the whole grains after fermentation will not have any peculiar smell. It can be mixed with other grain flours in the later stage, that is, the nutrition and flavor of the whole grains are retained without any safety risks. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Flow chart of strain screening.

[0029] Figure 2 This is a morphological observation diagram of brewer's yeast.

[0030] Figure 3 This is a picture of brewer's yeast observed under a microscope.

[0031] Figure 4 It is a standard atlas of maltooligosaccharide types and maltooligosaccharide contents in whole grain flour.

[0032] Figure 5 This is a graph of the types and contents of maltooligosaccharides in whole grain flour after inoculation in Example 3. DETAILED DESCRIPTION

[0033] The present invention will be further described below with reference to specific embodiments:

[0034] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents, etc. used are all commercially available unless otherwise specified.

[0035] Example 1, with reference to Figure 1-5 A brewer's yeast that improves the softness of whole-grain bread, Saccharomyces cerevisiae INM3111, was deposited in the Guangdong Provincial Microbiological Culture Collection Center on July 1, 2024, with the deposit number: GDMCC NO: 64795; the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0036] A brewer's yeast strain that improves the softness of whole-grain bread has the following colony characteristics: after culturing on a solid malt extract plate medium for 48 hours, the colony diameter reaches 5-6 mm, the colony is milky white, the colony is raised and round, the surface is smooth, and the colony edges are neat.

[0037] A Saccharomyces cerevisiae strain for improving the softness of whole-grain bread has a 16S rDNA sequence as shown in SEQ ID NO: 1.

[0038] A method for preparing brewer's yeast to improve the softness of whole-grain bread: 1. Processing of raw materials: Take a yogurt sample from Ruoergai County, Sichuan Province, add sterile saline and dilute to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Concentration, make bacterial dilution, take 0.1mL from each concentration dilution and evenly spread it on malt juice solid culture medium plate, incubate at 30℃ for 48h, select single colonies with white colonies, raised colonies, smooth surface and neat colony edges, streak the colonies on malt juice solid culture medium for secondary purification, incubate at 30℃ for 48h, pick single colonies for glycerol storage, and name them ABY0301 to ABY0309 respectively. The screening process is as follows Figure 1 shown.

[0039] 2. Preliminary screening of bacterial strains

[0040] The 9 strains were inoculated into malt extract liquid culture medium at 1% inoculum and cultured at 30℃ with a shaker at 220 rpm / min for 24 hours. Then, the 9 strains were inoculated into screening culture medium at 1% inoculum and cultured at 30℃ for 24 hours until the final cell density reached 10 6 cfu / mL. Samples were taken from each tube and centrifuged at 10,000 rpm / min for 10 min. The supernatant was the sample and tested for maltooligosaccharide (test method GB / T20881-2017). The results are shown in Table 1.

[0041] The formula of the screening medium is as follows: 5 g of soluble starch and 1 g of yeast extract powder dissolved in 1000 mL of distilled water, sterilized at 0.1 MPa and 121°C for 15 min.

[0042] Table 1 Maltooligosaccharides produced by fermentation

[0043] Strain name <![CDATA[O.D 600 ]]> Maltooligosaccharide (type) Maltooligosaccharide content (mg / Kg) ABY0301 0.528 G2\G3\G4\G5\G6\G7 53.30 ABY0302 0.416 G2\G3\G4\G5 30.23 ABY0303 0.541 G2\G3\G4\G5\G6 55.78 ABY0304 0.407 G2\G4\G5\G6\G7 43.65 ABY0305 0.485 G2\G3\G4\G5 28.31 ABY0306 0.462 G2\G3\G4\G5\G6 35.41 ABY0307 0.532 G2\G3\G4\G6\G7 50.28 ABY0308 0.464 G2\G3\G4\G5 20.17 ABY0309 0.498 G2\G3\G4\G7 24.45

[0044] Note: Maltose (G2), maltotriose (G3), maltotetraose (G4), maltopentaose (G5), maltohexaose (G6), maltoheptaose (G7), maltooctaose (G8)

[0045] Strains ABY0301, ABY0303, and ABY0307, ​​which contain a wide variety of maltooligosaccharides and high maltooligosaccharide contents, were selected for rescreening.

[0046] 3. Strain rescreening

[0047] The yeast strains ABY0301, ABY0303 and ABY0307 selected in the initial screening were reactivated and cultured, and the inoculum was prepared according to the national standard GB / T14612-2008 method, with a cell concentration of 10 6 cfu / mL, fermentation time 12 h, fermentation temperature 30 ° C, made into whole grain bread for sensory evaluation, the results are shown in Table 2;

[0048] Table 2 Sensory analysis of fermented bread

[0049]

[0050]

[0051] Note: The maximum score for each indicator is 5 points, and the higher the score, the better the result.

[0052] As shown in Table 2, ABY0301 had the best sensory evaluation results. As the target strain for rescreening, the morphological observation of this strain on solid maltose plate medium was as follows: Figure 2As shown, the colony diameter is 4-5mm, the colony is milky white, the colony is raised, round, the surface is smooth, and the colony edge is neat. After Gram staining, the results are as follows: Figure 3 shown.

[0053] The ABY0301 obtained by the above screening was subjected to ITS sequencing identification. After comparative analysis, the 28SrRNA region sequence obtained from the strain of the present invention was 99.83% similar to that of Saccharomyces cerevisiae. It can be determined that the strain is a strain of Saccharomyces cerevisiae and can be used in the food fermentation industry. It is named Saccharomyces cerevisiae INM3111. The strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on July 1, 2024, with the deposit number: CGMCC64795. Therefore, INM3111 and ABY0301 refer to the same strain in this application. The ABY0301 strain of the present invention was genetically identified, and its gene sequence is as follows:

[0054] GACGGGCGGCATATAACCATTATGCCAGCATCCTTGACTTACGTCGCAGTCCTCAGTCCCAGC

[0055] TGGCAGTATTCCCACAGGCTATAATACTTACCGAGGCAAGCTACATTCCTATGGATTTATCCT

[0056] GCCACCAAAACTGATGCTGGCCCAGTGAAATGCGAGATTCCCCTACCCACAAGGAGCAGAGGG

[0057] CACAAAACACCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTC

[0058] TCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAAT

[0059] ATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTC

[0060] GAAGGCACTTTACAAAGAACCGCACTCCTCGCCACACGGGATTCTCACCCTCTATGACGTCCT

[0061] GTTCCAAGGAACATAGACGAGGAACGGCCCCAAAGTTGCCCTCTCCAAATTACAACTCGGGCA

[0062] CCGAAGGTACCAGATTTCAAATTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCC

[0063] CGGTTGGTTTCTTTTCCTC

[0064] Example 2, genetic stability detection of Saccharomyces cerevisiae INM3111

[0065] The Saccharomyces cerevisiae INM3111 in Example 1 was continuously propagated on the screening liquid medium for 10 generations. The 1st, 5th, and 10th generation samples were centrifuged at 10,000 rpm / min for 10 minutes to obtain the supernatant, which was used as the sample for physical and chemical index testing. The method for detecting the type and content of maltooligosaccharides was referred to Example 1. Sensory evaluation was also performed to determine its stability through propagation. The specific data are shown in Table 3.

[0066] Table 3 Results of passage stability test

[0067] Number of generations <![CDATA[O.D 600 ]]> Maltooligosaccharide (type) Maltooligosaccharide content (mg / Kg) INM3111 1st Generation 0.52 G2\G3\G4\G5\G6\G7 54.23±4.75 INM3111 5th generation 0.53 G2\G3\G4\G5\G6\G7 55.43±5.10 INM3111 10th generation 0.52 G2\G3\G4\G5\G6\G7 55.12±2.35

[0068] The results in Table 3 show that the fermentation performance of different generations of Saccharomyces cerevisiae INM3111 strains is normal, the content of maltooligosaccharide varies within 10%, the strains have good genetic stability and meet the requirements for production and use.

[0069] Example 3: Making bread with yeast INM3111

[0070] The brewer's yeast INM3111 was inoculated into the fermented dough to make whole grain flour and whole grain bread according to the national standard GB / T14612-2008. The inoculation concentration of the fermented bacteria was 10 4 -10 8 When the CFU / mL was 0.05, whole-grain bread was made respectively, and ABY0308 was used as the control strain. The content of oligomaltodextrose was determined by taking 10 g of whole-grain dough and dissolving it in 2 volumes of distilled water, water bathing at 80°C for 2 h, and passing it through a 0.45 μm filter membrane after centrifugation. The oligomaltodextrose content in the dough was detected by referring to Example 1. The results are shown in Table 4.

[0071] Table 4 Types and contents of maltooligosaccharides in whole grain flour

[0072]

[0073] Table 5 Sensory evaluation results of whole grain bread

[0074]

[0075]

[0076] Note: Each assessment has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0077] The results in Tables 4 and 5 show that the inoculation of Saccharomyces cerevisiae INM3111 in whole-grain bread can significantly increase the types and content of oligosaccharides in the dough, and the higher the inoculation amount, the higher the content of oligosaccharides and oligosaccharides. However, if the inoculation concentration of Saccharomyces cerevisiae INM3111 is too high or too low, the types and content of oligosaccharides will be significantly reduced. This is because the metabolism of oligosaccharides by Saccharomyces cerevisiae will affect the sourness, sweetness and taste of the bread. The most suitable inoculation concentration is 1.0×10 7 CFU / mL, this concentration can produce enough types and quantities of oligomaltodextrose, the results are shown in Figure 4 , and can enhance the flavor and taste of whole grain bread.

[0078] Example 4: Preparation of whole-grain toast using yeast strain INM3111

[0079] The final concentration of Saccharomyces cerevisiae INM3111 was 10 7 The whole-grain flour inoculation concentration was prepared at a dose of 100 CFU / mL, and then whole-grain toasts were prepared according to the national standard GB / T14612-2008 method. Another group of ABY0308 was inoculated as a control group. After the fermentation was completed, the type and content of oligosaccharides in the whole-grain toast were detected according to the method in Experimental Example 3. At the same time, professional appraisers were asked to perform a sensory evaluation on the flavor of the whole-grain toast. The results are recorded in Table 6.

[0080] Table 6 Whole grain noodle detection and toast sensory evaluation results

[0081]

[0082] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0083] The results in Table 6 show that when whole grains are inoculated for 10 7 CFU / mL of brewer's yeast INM3111 in making dough can significantly increase the types and content of oligosaccharides in the fermented dough; in addition, it can also improve the sensory evaluation of toast, increase the aroma of toast, and enhance the flavor and taste of toast, making the toast fragrant, sweet and sour.

[0084] Example 5: Making European Bread with Saccharomyces cerevisiae INM3111

[0085] The final concentration of Saccharomyces cerevisiae INM3111 was 10 7 The whole-grain flour inoculation concentration was prepared at a dose of CFU / mL, and then European bread was made according to the national standard GB / T14612-2008 method. Another group of ABY15 was inoculated as a control group. After the fermentation was completed, the type and content of oligosaccharides in the whole-grain flour were detected according to the method in Experimental Example 1. At the same time, professional appraisers were asked to conduct a sensory evaluation of the flavor of the whole-grain European bread. The results are recorded in Table 7.

[0086] Table 7 Whole grain noodle variety testing and sensory evaluation results of European bread

[0087]

[0088]

[0089] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0090] The results in Table 7 show that 10 7 CFU / mL brewer's yeast INM3111 is used to make dough, which can significantly increase the types and content of oligosaccharides in the fermented dough; in addition, it can also improve the sensory evaluation of whole-grain European bread, increase the aroma of whole-grain European bread, and enhance the flavor and taste of whole-grain European bread, making the whole-grain European bread fragrant, sweet and sour.

[0091] Example 6, making meal bags with yeast INM3111

[0092] The final concentration of Saccharomyces cerevisiae INM3111 was 10 7 The whole grain flour inoculation concentration was prepared at a dose of 100 CFU / mL, and another group was inoculated with ABY15 as the control group, and then meal packs were made according to the national standard GB / T14612-2008 method.

[0093] After the fermentation was completed, the type and content of maltooligosaccharides in the whole-grain flour were detected according to the method in Experimental Example 1. At the same time, professional tasters were asked to conduct a sensory evaluation of the flavor of the European bread. The results are recorded in Table 8.

[0094] Table 8 Sensory evaluation results of whole grain noodles and meal bags

[0095]

[0096]

[0097] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0098] From the results in Table 8, we can see that 10 7 CFU / mL of brewer's yeast INM3111 can significantly increase the types and content of oligosaccharides in the fermented dough; in addition, it can also improve the sensory evaluation of the meal bread, increase the aroma of the meal bread, and enhance the flavor and taste of the whole-grain meal bread, making the whole-grain meal bread fragrant, sweet and sour.

[0099] Based on the results of the above embodiments, the brewer's yeast (Saccharomyces cerevisiae) INM3111 provided by the present invention is applied to the fermentation of whole-grain noodles. On the basis of not changing the existing process, it can significantly increase the types and content of oligosaccharides in relevant whole-grain noodles, while also improving the aroma and taste of whole-grain products, significantly improving the quality of whole-grain products.

[0100] The above-described embodiments merely represent several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous modifications and improvements without departing from the scope of the present invention. Therefore, the scope of protection of the patent for this invention shall be subject to the appended claims.

Claims

1. A strain of Saccharomyces cerevisiae for improving the softness of whole-grain bread, characterized by: Saccharomyces cerevisiae ( Saccharomyces cerevisiae )INM3111, on July 1, 2024, was deposited in Guangdong Provincial Microbiological Culture Collection Center, with the accession number: GDMCC NO: 64795; the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. A production application of the brewer's yeast according to claim 1, characterized in that: According to the production process of whole grain products, in the fermented whole grain flour, the inoculation amount is 10 4 -10 8 cfu / mL is inoculated with the brewer's yeast of claim 1, and the fermentation time is 12h and the fermentation temperature is 37°C. After the fermentation is completed, the content of oligosaccharides in the noodle and the sensory quality thereof are detected.

Images