A genetically engineered bacterium that synthesizes protocatechuic acid and its application
By optimizing the metabolic pathway and introducing multiple protocatechuic acid synthesis pathways in Corynebacterium glutamicum, a recombinant Corynebacterium glutamicum was constructed, which solved the problem of low protocatechuic acid production efficiency in the existing technology and achieved efficient, safe and low-cost bio-fermentation production with a yield of 85.16 g/L.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-09
- Publication Date
- 2026-03-06
AI Technical Summary
Existing technologies for the production of protocatechuic acid suffer from low yield, low production efficiency, and low strain productivity. Furthermore, chemical synthesis methods are difficult to mass-produce, while biological fermentation methods involve complex and cumbersome steps.
The metabolic pathway in Corynebacterium glutamicum was optimized and modified by introducing endogenous and exogenous protocatechuic acid synthesis pathways, knocking out the pcaHG gene, expressing genes related to the shikimic acid pathway, DAHP pathway and 4-HBA pathway, constructing recombinant Corynebacterium glutamicum, and using glucose as a substrate for efficient fermentation to produce protocatechuic acid.
The method achieves efficient production of protocatechuic acid, with a maximum concentration of 85.16 g/L, which has promising prospects for industrial application. Furthermore, the strain is safe and non-toxic, and the production cost is low.
Smart Images

Figure CN119060929B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene recombination technology, and more specifically to a genetically engineered bacterium that synthesizes protocatechuic acid and its applications. Background Technology
[0002] Protocatechuic acid (PCA), also known as 3,4-dihydroxybenzoic acid, is a phenolic acid naturally found in plants such as fern leaves and holly leaves. It is also an effective active ingredient in many traditional Chinese medicines (such as salvia miltiorrhiza and hibiscus). It not only has pharmacological activities such as antiplatelet aggregation, reducing myocardial oxygen consumption, improving myocardial oxygen tolerance, slowing heart rate, and analgesia, but also has antibacterial, antioxidant, antitumor, tumor cell apoptosis-mediating, and neuroprotective effects.
[0003] Initially, the main source of protocatechuic acid was extraction from plants using chemical methods. Extraction from plant leaves using organic solvents was the most common and effective method. However, due to low yields and economic infeasibility, extracting protocatechuic acid from these plants may not be suitable for production and also causes some environmental damage. For example, the yield from *Scutellaria barbata* is only 64.09 μg / g, from clove only 0.0759 mg / g, and from *Spatholobus suberectus* only 0.623 mg / g. Furthermore, the chemical synthesis of protocatechuic acid requires high temperature, high pressure, and strong acid / alkali environments, which are difficult to control. Specialized reaction equipment is required, resulting in large investments and low equipment utilization, thus hindering large-scale production.
[0004] Based on the above, the production of protocatechuic acid using biological fermentation is a promising method, offering a more efficient way to obtain this compound from inexpensive sugars. Several publications have reported on the synthesis of protocatechuic acid using microbial fermentation, such as with Bacillus thuringiensis, Bacillus cereus, and Escherichia coli. However, these reported methods suffer from drawbacks such as low yield, low production efficiency, and low strain productivity. With further development in the research of biological protocatechuic acid synthesis, East China University of Science and Technology has conducted metabolic engineering on Pseudomonas putidae KT2440 as a host, achieving a maximum protocatechuic acid yield of 21.7 g / L using glucose as a substrate in fermentation tanks. This represents a significant increase in protocatechuic acid yield compared to previous studies, but there is still room for improvement. Currently, the highest yield of protocatechuic acid synthesized by microbial fermentation in published domestic patents is 33.3 g / L in Escherichia coli, while the highest yield in Saccharomyces cerevisiae is only 720 mg / L. While some patents report the use of *E. coli* to produce the protocatechuic acid precursor 3-dehydroshikimic acid and the quiC enzyme to achieve whole-cell catalysis from 3-dehydroshikimic acid to protocatechuic acid, achieving a protocatechuic acid concentration of 88.5 g / L at a substrate concentration of 98.9 g / L, the process is complex and cumbersome. Other patents describe a one-step bio-fermentation method using recombinant *E. coli* to produce protocatechuic acid, stably producing approximately 37.02 g / L. Although the process is relatively simple and easy to implement, the strain safety and yield are still not suitable for industrial production.
[0005] Therefore, providing a genetically engineered bacterium that synthesizes protocatechuic acid and its applications is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0006] In view of this, the present invention provides a genetically engineered bacterium for synthesizing protocatechuic acid and its application. This strain is safe and non-toxic, and can produce high yields of protocatechuic acid using microbial fermentation with low production costs.
[0007] Based on the commonly used protocatechuic acid synthesis pathway in previous studies, this invention further optimizes and modifies the metabolic pathway in the food-grade host *Corynebacterium glutamicum* and introduces another exogenous protocatechuic acid synthesis pathway (introducing the *ubiC* and *pobA* genes). The modified engineered strain can efficiently produce protocatechuic acid through fermentation using both endogenous and exogenous protocatechuic acid synthesis pathways, allowing more carbon flux to flow to the target product—protocatechuic acid.
[0008] To achieve the above objectives, the present invention adopts the following technical solution:
[0009] A genetically engineered bacterium that synthesizes protocatechuic acid.
[0010] The genetically engineered bacteria are based on Corynebacterium glutamicum ATCC13032, or are recombinant Corynebacterium glutamicum modified with chassis microorganisms, including the shikimic acid pathway; and / or the DAHP pathway; and / or the 4-HBA pathway.
[0011] The chassis microbial modification was carried out using Corynebacterium glutamicum ATCC13032 as the starting strain, with the pcaHG gene (protocatechuate 3,4-dioxygenase subunit beta(pcaH), protocatechuate 3,4-dioxygenase subunit alpha(pcaG)) knocked out.
[0012] The shikimic acid pathway expresses the 3-dehydroquinate synthase gene aroB, the 3-dehydroquinate dehydratase gene aroD, and the 3-dehydroshikimate dehydratase gene qsuB.
[0013] The DAHP pathway is either DAHP pathway 1 or DAHP pathway 2; DAHP pathway 1 expresses the transketolase 1 gene tktA and the 3-deoxy-7-phosphoheptulonate synthase gene aroG. fbr The DAHP path 2 expresses tktA and aroG. fbr The gene tal of transaldolase and the gene gapA of glyceraldehyde-3-phosphate dehydrogenase;
[0014] The 4-HBA pathway expresses the chorismate pyruvate lyase gene ubiC and the 4-hydroxybenzoic acid hydroxylase gene pobA.
[0015] Furthermore, the 3-dehydroquinic acid oxidase gene aroB includes the endogenous Corynebacterium glutamicum 3-dehydroquinic acid oxidase gene or the exogenous 3-dehydroquinic acid oxidase gene.
[0016] The 3-dehydroquinic acid dehydratase gene aroD includes the endogenous Corynebacterium glutamicum 3-dehydroquinic acid dehydratase gene or the exogenous 3-dehydroquinic acid dehydratase gene.
[0017] The 3-dehydroshikimate dehydratase gene qsuB includes the endogenous Corynebacterium glutamicum 3-dehydroshikimate dehydratase gene or the exogenous 3-dehydroshikimate dehydratase gene.
[0018] The transketolase gene tktA includes an endogenous Corynebacterium glutamicum transketolase gene or an exogenous transketolase gene.
[0019] The 3-deoxy-7-phosphate heptanolate synthase gene aroG includes the endogenous Corynebacterium glutamicum 3-deoxy-7-phosphate heptanolate synthase gene or the exogenous 3-deoxy-7-phosphate heptanolate synthase gene.
[0020] The transaldolase gene tal includes an endogenous Corynebacterium glutamicum transaldolase gene or an exogenous transaldolase gene.
[0021] The 3-phosphoglyceraldehyde dehydrogenase gene gapA includes the endogenous Corynebacterium glutamicum 3-phosphoglyceraldehyde dehydrogenase gene or the exogenous 3-phosphoglyceraldehyde dehydrogenase gene.
[0022] The cladoid acid pyruvate lyase gene ubiC is an exogenous cladoid acid pyruvate lyase gene.
[0023] The 4-hydroxybenzoic acid hydroxylase gene pobA includes the endogenous Corynebacterium glutamicum 4-hydroxybenzoic acid hydroxylase gene or the exogenous 4-hydroxybenzoic acid hydroxylase gene.
[0024] The nucleotide sequence of the endogenous Corynebacterium glutamate 3-dehydroquinic acidase gene is shown in SEQ ID NO.1;
[0025] The nucleotide sequence of the endogenous Corynebacterium glutamate 3-dehydroquinic acid dehydratase gene is shown in SEQ ID NO.2;
[0026] The nucleotide sequence of the endogenous Corynebacterium glutamicum 3-dehydroshikimate dehydratase gene is shown in SEQ ID NO. 3;
[0027] The nucleotide sequence of the endogenous Corynebacterium glutamate transaldolase gene is shown in SEQ ID NO.43;
[0028] The nucleotide sequence of the endogenous Corynebacterium glutamate 3-phosphoglyceraldehyde dehydrogenase gene is shown in SEQ ID NO. 44;
[0029] The nucleotide sequence of the endogenous Corynebacterium glutamate 4-hydroxybenzoic acid hydroxylase gene is shown in SEQ ID NO. 71.
[0030] Furthermore, the exogenous transketolase gene is derived from Escherichia coli K12;
[0031] The exogenous 3-deoxy-7-phosphate heptanolate synthase gene was derived from *Escherichia coli* K12; the gene *aroG* encoding 3-deoxy-7-phosphate heptanolate synthase was modified by mutating the A base at position 436 to a G base to resist feedback inhibition. fbr ;
[0032] The exogenous branching acid pyruvate lyase gene is a gene derived from Escherichia coli K12 or a gene derived from Escherichia coli K12 that has undergone codon optimization.
[0033] The exogenous 4-hydroxybenzoic acid hydroxylase gene is a gene derived from Pseudomonas aeruginosa or a gene derived from Pseudomonas aeruginosa that has undergone codon optimization.
[0034] The nucleotide sequence of the transketolase gene derived from Escherichia coli K12 is shown in SEQ ID NO.16;
[0035] The nucleotide sequence of the 3-deoxy-7-phosphate heptanone synthase gene derived from Escherichia coli K12 is shown in SEQ ID NO.17;
[0036] The nucleotide sequence of the branching acid pyruvate lyase gene derived from Escherichia coli K12 is shown in SEQ ID NO. 55.
[0037] The nucleotide sequence of the branched acid pyruvate lyase gene derived from Escherichia coli K12 and codon-optimized is shown in SEQ ID NO.63.
[0038] The nucleotide sequence of the 4-hydroxybenzoic acid hydroxylase gene derived from Pseudomonas aeruginosa is shown in SEQ ID NO. 56;
[0039] The nucleotide sequence of the codon-optimized 4-hydroxybenzoic acid hydroxylase gene derived from Pseudomonas aeruginosa is shown in SEQ ID NO. 64.
[0040] Furthermore, a method for synthesizing protocatechuic acid using genetically engineered bacteria includes the following steps:
[0041] (1) Using Corynebacterium glutamicum ATCC13032 as the starting strain, the pcaHG gene was knocked out to obtain modified Corynebacterium glutamicum.
[0042] (2) Express the shikimic acid pathway-related gene as described in claim 1; and / or the DAHP pathway-related gene; and / or the 4-HBA pathway-related gene in the starting strain or the modified Corynebacterium glutamicum.
[0043] Furthermore, the application of the genetically engineered bacteria or the method described herein in the production of protocatechuic acid.
[0044] Furthermore, the application of the genetically engineered bacteria or the method described herein in increasing protocatechuic acid production.
[0045] Furthermore, a method for producing protocatechuic acid involves fermentation using the genetically engineered bacteria or genetically engineered bacteria constructed by the method.
[0046] A biological method for synthesizing protocatechuic acid ( Figure 1 )as follows:
[0047] The transketolase tktA effectively enhances E4P synthesis in the HMP pathway, increasing DAHP production. Glyceraldehyde-3-phosphate dehydrogenase gapA facilitates the conversion of glycolysis to phosphoenolpyruvate (PEP). The genes tktA (encoding transketolase) and tal (encoding transaldolase) enhance the conversion of pentose phosphate to E4P, while gapA (encoding glyceraldehyde-3-phosphate dehydrogenase) promotes the conversion of EMP to PEP. 3-Deoxy-7-phosphate heptagenate synthase (aroG) aids in the synthesis of DAHP from PEP and E4P. 3-Deoxy-D-arabinohepenoyl-7-phosphate is converted to 3-dehydroquinic acid by the catalysis of 3-dehydroquinic acidase aroB; 3-dehydroquinic acid is then converted to 3-dehydroshikimic acid (DHS), an important precursor of protocatechuic acid, by the catalysis of 3-dehydroshikimic acid dehydratase aroD; 3-dehydroshikimic acid (DHS) is further converted to protocatechuic acid by the catalysis of 3-dehydroshikimic acid dehydratase qsuB. 3-Dehydroshikimic acid is converted to cladonic acid via the microbial endogenous shikimic acid pathway; cladonic acid is converted to 4-hydroxybenzoic acid by the catalysis of cladonic acid pyruvate lyase ubiC; and 4-hydroxybenzoic acid is converted to protocatechuic acid by the catalysis of 4-hydroxybenzoic acid hydroxylase pobA.
[0048] As can be seen from the above technical solution, compared with the prior art, this invention discloses a genetically engineered bacterium for synthesizing protocatechuic acid and its application. It modifies *Corynebacterium glutamicum*, including knocking out the protocatechuic acid catabolism pathway (involving pcaHG), the shikimic acid pathway, the DAHP pathway, and the 4-HBA pathway. Finally, a recombinant *Corynebacterium glutamicum* capable of efficiently synthesizing protocatechuic acid is constructed. The host *Corynebacterium glutamicum* selected in this invention is a food-grade microorganism, non-pathogenic to humans and animals, and exhibits better growth advantages under the same culture conditions, accumulating higher concentrations of protocatechuic acid than other strains. Repeated experiments show that the highest concentration of protocatechuic acid obtained by fermentation of the recombinant *Corynebacterium glutamicum* constructed in this invention can reach 85.16 g / L, which is the highest yield of protocatechuic acid synthesized de novo by biological methods reported in related studies to date. This has great industrial application prospects for high-yield protocatechuic acid production by biological methods. The genetically engineered bacterium constructed in this invention is safe and non-toxic, capable of efficiently producing protocatechuic acid using glucose as a substrate through microbial fermentation, with a simple culture medium composition, batch stability, and low production cost. Attached Figure Description
[0049] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0050] Figure 1 The attached figure shows the metabolic pathway of the genetically engineered bacteria constructed in this invention synthesizing protocatechuic acid de novo using glucose as a substrate;
[0051] Figure 2 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-aroB-aroD-qsuB constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0052] Figure 3 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-tkt-aroG constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0053] Figure 4 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-enhanced dual module constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0054] Figure 5 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-aroB-aroD-qsuB constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0055] Figure 6 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-tkt-aroG constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0056] Figure 7 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-enhanced dual module constructed in this invention at different time points using glucose as a substrate in shake-flask fermentation.
[0057] Figure 8 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-enhanced dual-module-tal-gap constructed in this invention at different time points using glucose as a substrate in shake-flask fermentation.
[0058] Figure 9 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-double01 constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0059] Figure 10 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-double02 constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0060] Figure 11 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-double03 constructed in this invention through shake-flask fermentation with glucose as a substrate at different time points.
[0061] Figure 12 The attached figure shows the yield of protocatechuic acid synthesized by the genetically engineered strain Cg-ΔpcaHG-double03 constructed in this invention through fermentation on glucose as a substrate at different time points. Detailed Implementation
[0062] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0063] LBHIS liquid medium: peptone 5.0 g / L, yeast extract 2.5 g / L, NaCl 5.0 g / L, brain and heart extract (BHI) 18.5 g / L, sorbitol 91.0 g / L. The corresponding LBHIS solid medium is supplemented with 1.8%-2% agar. LBHIS medium is mainly used for culturing Corynebacterium glutamicum in test tubes and on solid plates.
[0064] EPO medium: peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, glycine 30.0 g / L, Tween 80 10.0 g / L. EPO medium is mainly used for the preparation of competent Corynebacterium glutamicum cells.
[0065] 30% sucrose medium: peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, sucrose 300.0 g / L.
[0066] 20% sucrose solid medium: peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, sucrose 200.0 g / L, agar 15.0 g / L.
[0067] LB-suc medium: peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, sucrose 100.0 g / L, agar 15.0 g / L. LB-suc medium is mainly used for homologous recombination screening in Corynebacterium glutamicum gene knockout experiments.
[0068] LBG liquid medium: peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, glucose 20.0 g / L. LBG liquid medium is mainly used as a seed culture medium for the fermentation of Corynebacterium glutamicum.
[0069] Fermentation medium in the upper tank: glucose 30.0 g / L, urea 5.0 g / L, corn extract powder 8.0 g / L, biotin 4 × 10⁻⁶ -4 g / L, Vitamin B1 4×10 g / L -4 g / L, K2HPO4 1.0 g / L, KH2PO4 1.0 g / L, CaCl2·2H2O 29.4 mg / L, MgSO4·7H2O 1.2325 g / L, trace element solution 0.2%.
[0070] Shake-flask fermentation medium: glucose 100 g / L, urea 5.0 g / L, corn extract 8.0 g / L, biotin 4 × 10⁻⁶ - 4 g / L, Vitamin B1 4×10 g / L-4 g / L, K2HPO4 1.0 g / L, KH2PO4 1.0 g / L, CaCl2·2H2O 29.4 mg / L, MgSO4·7H2O 1.2325 g / L, trace element solution 0.2%.
[0071] Preparation method of trace element solution: Weigh 1g FeSO4·7H2O, 1g MnSO4·H2O, 0.1g ZnSO4·7H2O, 0.2g CuSO4, and 0.002g NiCl2·6H2O, add water to make up to 100mL, then add 100μl concentrated hydrochloric acid to adjust the pH, and then sterilize by membrane filtration.
[0072] Example 1
[0073] 1.1 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0074] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroB fragment (as shown in SEQ ID NO.1) was amplified using primers aroB-F / R to obtain the Corynebacterium glutamicum-derived aroB fragment with a seamless cloning homologous arm linked to the plasmid vector pXMJ19 and RBS.
[0075] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroD fragment (as shown in SEQ ID NO.2) was amplified using primers aroD-F / R to obtain the aroD fragment from Corynebacterium glutamicum with a seamless clonal homologous arm linked to aroB and RBS.
[0076] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the fragment qsuB (as shown in SEQ ID NO.3) was amplified using primers qsuB-F / R to obtain the Corynebacterium glutamicum-derived qsuB fragment with a seamless cloning homologous arm linked to aroD and plasmid vector pXMJ19 and RBS.
[0077] The primer sequences are:
[0078] aroB-F: 5'-TTAAGCTTGCATGCCTGCAGGTCGACAAGGAGGATATACAT ATGAGCGCAGTGCA GATTTT -3';SEQ ID NO.4;
[0079] aroB-R: 5'-GAGGAGAATTTTTCCAGGCATATGTATATCCTCCTT TTAGTGGCTGATTGCCTCAT AAGC-3';SEQ ID NO.5;
[0080] aroD-F:5'- ATGCCTGGAAAAATTCTCCTCCT -3';SEQ ID NO.6;
[0081] aroD-R: 5'- CTACTTTTTGAGATTTGCCAGGATATCG -3';SEQ ID NO.7;
[0082] qsuB-F: 5'-CCTGGCAATCTCAAAAAGTAGAAGGAGGATATACAT ATGCGTACATCCATTGCC AC -3';SEQ ID NO.8;
[0083] qsuB-R: 5'- CTAGTTTGGGATTCCCCGCT -3';SEQ ID NO.9.
[0084] Gene amplification system: Primestar (Takara) 25 μL, forward and reverse primers 2 μL each, template 1 μL, ddH2O 20 μL.
[0085] Gene amplification program: 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 10 seconds / kb, 35 cycles; 72℃ extension for 10 minutes.
[0086] After agarose gel electrophoresis and product recovery, the PCR products yielded gene products aroB, aroD, and qsuB from different sources.
[0087] The plasmid vector pXMJ19 was linearized using primers px-F and px-R to obtain the pxmj vector. The primer sequences are as follows:
[0088] px-F: 5'-CGGGGAATCCCAAACTAGtctagaggatccccgggt-3'; SEQ ID NO.10;
[0089] px-R: 5'-tgcaggcatgcaagcttaattaattc-3'; SEQ ID NO. 11.
[0090] Add 1.5 μl aroB, 1.5 μl aroD, 3.0 μl qsuB, 4.0 μl pxmj vectors from different sources, and 10.0 μl Gibson enzyme to the PCR tube.
[0091] The connection temperature was 50℃, the connection time was 15 min, and the total volume was 20 μL.
[0092] The total 20 μl Gibson-ligated culture was transformed into commercial E. coli Trans10 competent cells for culture and preservation. Transformation was performed strictly according to the manufacturer's instructions. After incubation at 37°C for 1 hour, the cells were plated onto LB agar plates (containing 5 μg / mL chloramphenicol) and incubated at 37°C for another 12 hours. Approximately 10-20 single colonies were then selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were:
[0093] Pxmj-F: 5'-CTGTGGTATGGCTGTGCAGGTC-3'; SEQ ID NO.12;
[0094] Pxmj-R: 5'-ATGCCTGGCAGTTCCCTACT-3'; SEQ ID NO. 13.
[0095] Select a correct single colony and name it Escherichia coli WJ101. After propagation and plasmid extraction, obtain the Escherichia coli WJ101 plasmid.
[0096] 2.0 μl of Escherichia coli WJ101 plasmid was electroporated into wild-type Corynebacterium glutamicum ATCC13032 competent cells.
[0097] The preparation of competent *Corynebacterium glutamicum* ATCC13032 cells was as follows: *Corynebacterium glutamicum* ATCC13032 glycerol-preserved culture was streaked onto LBHIS plates and incubated at 30℃ for approximately 24-30 hours. Colonies were then picked from the plates and inoculated into test tubes containing LBHIS liquid medium and incubated for 12 hours. Finally, a specific inoculum was added to 20 ml of EPO medium to allow initial OD to develop. 600 The OD value is around 0.3. After incubation in a shake flask at 30°C for approximately 3-5 hours, the OD value will increase. 600 When the concentration reaches approximately 0.9, transfer the bacterial culture to a centrifuge tube and incubate on ice for 15 minutes to cool the cells to 0°C. Centrifuge at 4°C and 4500 rpm for 10 minutes to collect the cells (allocate to 1.5 mL centrifuge tubes), discard the supernatant, and resuspend the cells in 100 μL of pre-cooled 10% glycerol (mix three tubes of cells into one tube). Repeat the above step three times. After washing, resuspend the cells in 100 μL of sterile 10% glycerol and aliquot for direct use in electroporation.
[0098] The electroporation method is as follows: Add 2-4 μL of plasmid to each tube of competent cells, mix well, and incubate on ice for 5-10 min; transfer the mixture to a pre-chilled 0.2 cm electroporation cuvette, electroporate at 1.8 kV for 5 ms, 50 μF, and 100 Ω. Immediately after electroporation, add 800 μL of LBHIS liquid medium, mix gently, and transfer to a 1.5 mL centrifuge tube. Incubate at 46°C in a water bath or metal bath for 6 min, then incubate at 30°C for 2-3 h; centrifuge at 8000 rpm for 1.5 min, discard the supernatant, and retain approximately 100-200 μL of bacterial culture. Mix well and spread onto LBHIS solid medium plates containing 5 μg / mL chloramphenicol, and incubate at 30°C for 24-36 h.
[0099] Single colonies grown on the plates were selected for verification of the cm gene. Only colonies that could grow on chloramphenicol-resistant plates and amplify the cm gene were identified as the target strain and named *Corynebacterium glutamicum* Cg-aroB-aroD-qsuB. The verification primers are as follows:
[0100] Cm-R: 5'-CCTGCCACTCATCGCAGTAC-3'; SEQ ID NO.14;
[0101] Cm-F: 5'-ATGGAGAAAAAAATCACTGGATATACCACC-3'; SEQ ID NO. 15.
[0102] The genetically engineered strain of Corynebacterium glutamicum, “Corynebacterium glutamicum Cg-aroB-aroD-qsuB”, was used for fermentation verification in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0103] The fermentation of Corynebacterium glutamicum Cg-aroB-aroD-qsuB involves three steps:
[0104] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum Cg-aroB-aroD-qsuB stored at -80℃ and transfer it to a test tube containing 4 mL of LBHIS liquid medium (containing 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0105] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-less conical flask containing 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0106] Inoculation with shake-flask fermentation medium: The seed volume was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The mixture was incubated at 30℃ and 200 rpm for 48 h (0.8 mM IPTG was added for induction after 3 h of incubation). Sampling was performed every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of the content of products and other metabolites: The content of protocatechuic acid and other metabolites in the fermentation product was determined by high performance liquid chromatography (HPLC). The detection method was as follows: the mobile phase included phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). The chromatographic column used was a ZORBAX SB-C18 reverse chromatographic column, the column temperature was set to 28℃, the flow rate of the mobile phase was set to 1.0 mL / min, and the detection was performed using a UV detector with a UV absorption wavelength set to 260 nm. Finally, the content of products and other metabolites was calculated based on the data peak diagrams of different fermentation samples according to the standard curve drawn from the standard samples. The peak time of the HPLC detection result of the protocatechuic acid standard was 11.380 min, and the peak time of the HPLC detection result of the engineered strain fermentation sample and its fermentation culture product was 11.363 min. The peak time of the engineered strain fermentation sample was consistent with the peak time of the protocatechuic acid standard, proving that the fermentation product of the engineered strain was the target product - protocatechuic acid. The results of shake-flask fermentation of protocatechuic acid by the original strain ATCC13032(Cg) and the engineered strain Cg-aroB-aroD-qsuB of Corynebacterium glutamicum are shown in Table 1 and 2. Figure 2 .
[0107] Table 1
[0108]
[0109] 1.2 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0110] Using E. coli K12 genomic DNA as a template, the tktA fragment (as shown in SEQ ID NO. 16) was amplified using primers tktA-F / R to obtain the E. coli K12-derived tktA fragment with a seamless cloning homologous arm linked to the plasmid vector pEC-XK99E and an RBS (ribosome binding site).
[0111] aroG derived from E. coli K12, synthesized by BGI Genomics, has anti-feedback inhibition properties.fbr Using a gene fragment (as shown in SEQ ID NO. 17) as a template, the aroG fragment was amplified using primers aroG-F / R. fbr AroG derived from E. coli K12 was obtained with seamless clonal homologous arms linked to tktA and plasmid vector pEC-XK99E and RBS. fbr Excerpt.
[0112] The primer sequences are:
[0113] tktA-F: 5'-GGATATACATATGTCCTCACGTAAAGAGCTTGC-3'; SEQ ID NO. 18;
[0114] tktA-R: 5'-tctagaggatccccgggtaccgagctcTTACAGCAGTTCTTTTGCTTTCGC-3'; SEQ ID NO.19;
[0115] aroG-F: 5'-ATACATatgaattatcagaacgacgatttacgc-3'; SEQ ID NO. 20;
[0116] aroG-R: 5'-ACGTGAGGACATATGTATATCCTCCTTttacccgcgacgcgctttta-3'; SEQ ID NO. 21.
[0117] The gene amplification system and gene amplification procedure are the same as above.
[0118] After agarose gel electrophoresis and product recovery, the PCR products yielded the corresponding gene products tktA and aroG from different sources. fbr .
[0119] The plasmid vector pEC-XK99E was linearized using primers pec-F and pec-R to obtain the pec vector. The primer sequences are as follows:
[0120] pec-F: 5'-tacccggggatcctctagagtcgacctgcaggc-3'; SEQ ID NO. 22;
[0121] pec-R: 5'-cgtcgttctgataattcatATGTATATCCTCCTTgaattccatggtctgtttcctgtg-3'; SEQ ID NO. 23.
[0122] The amplification system and procedure are the same as those for gene amplification.
[0123] Add 3.5 μl of tktA and 2.5 μl of aroG from different sources to the PCR tube. fbr 4.0 μl of PEC vector and 10.0 μl of Gibson enzyme.
[0124] The connection temperature was 50℃, the connection time was 15 min, and the total volume was 20 μL.
[0125] The total 20 μl Gibson-ligated culture was transformed into commercial E. coli Trans10 competent cells for culture and preservation. Transformation was performed strictly according to the manufacturer's instructions. After incubation at 37°C for 1 hour, the cells were plated onto LB agar plates (containing 50 μg / mL kanamycin) and incubated at 37°C for another 12 hours. Approximately 10-20 single colonies were then selected for colony PCR amplification and DNA sequencing verification. Primers for colony PCR amplification and DNA sequencing were:
[0126] Pec-F1: 5'-GGCTGTGCAGGGTCGTAAATCAC-3'; SEQ ID NO. 24;
[0127] Pec-R1: 5'-AGTTCCCTACTCTCGCATGGG-3'; SEQ ID NO. 25.
[0128] Select a correct single colony and name it Escherichia coli WJ201. After propagation and plasmid extraction, obtain the Escherichia coli WJ201 plasmid.
[0129] Electroporate 2.0 μl of *Escherichia coli* WJ201 plasmid into wild-type *Corynebacterium glutamicum* ATCC13032 competent cells. The preparation and electroporation of competent cells were the same as above. The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and incubated at 30°C for 24–36 h.
[0130] Single colonies grown on the plates were selected for kanamycin gene verification. Only colonies that could grow on kanamycin-resistant plates and amplify the kana gene were identified as the target strain and named *Corynebacterium glutamicum* Cg-tkt-aroG. The verification primers are as follows:
[0131] kana-F: 5'-ATGATTGAACAAGATGGATTGCACG-3'; SEQ ID NO. 26;
[0132] kana-R: 5'-TCAGAAGAACTCGTCAAGAAGGC-3'; SEQ ID NO. 27.
[0133] The genetically engineered strain of Corynebacterium glutamicum, “Corynebacterium glutamicum Cg-tkt-aroG”, was used for fermentation verification in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0134] The fermentation of Corynebacterium glutamicum Cg-tkt-aroG involves three steps:
[0135] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum Cg-tkt-aroG stored at -80℃ and transfer it to a test tube containing 4 mL of LBHIS liquid medium (containing 50 μg / mL kanamycin). Incubate at 30℃ for 12-14 h.
[0136] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-less conical flask containing 50 μg / mL kanamycin), and incubate in a constant temperature shaker at 30℃ and 200 rpm for 12-14 hours.
[0137] Inoculation with shake-flask fermentation medium: The seed volume was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The mixture was incubated at 30℃ and 200 rpm for 48 h (0.8 mM IPTG was added for induction after 3 h of incubation). Sampling was performed every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600(2) Determination of the content of products and other metabolites: The content of protocatechuic acid and other metabolites in the fermentation product was determined by high performance liquid chromatography (HPLC). The detection method was as follows: the mobile phase included phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). The chromatographic column used was a ZORBAX SB-C18 reverse chromatographic column, the column temperature was set to 28℃, the flow rate of the mobile phase was set to 1.0 mL / min, and the detection was performed using a UV detector with a UV absorption wavelength set to 260 nm. Finally, the content of products and other metabolites was calculated based on the data peak diagrams of different fermentation samples according to the standard curve drawn from the standard samples. The peak time of the HPLC detection result of the protocatechuic acid standard was 11.380 min, and the peak time of the HPLC detection result of the engineered strain fermentation sample and its fermentation culture product was 11.363 min. The peak time of the engineered strain fermentation sample was consistent with the peak time of the protocatechuic acid standard, proving that the fermentation product of the engineered strain was the target product - protocatechuic acid. The results of shake-flask fermentation of protocatechuic acid by the original strain ATCC13032 and the engineered strain Cg-tkt-aroG of Corynebacterium glutamicum are shown in Table 2 and 3. Figure 3 .
[0138] Table 2
[0139]
[0140] 1.3 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0141] Using the constructed *E. coli* WJ101 and WJ201 plasmids, 2.0 μl of each plasmid was simultaneously electroporated into wild-type *Corynebacterium glutamicum* ATCC13032 competent cells. The preparation and electroporation of competent cells were the same as described above. The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol, and incubated at 30°C for 24–36 h.
[0142] Single colonies grown on the plates were selected for verification of the kana and cm genes. Only colonies that could grow on both kana and chloramphenicol-resistant plates and amplify the kana and cm genes were identified as the target strain and named Corynebacterium glutamicum "Cg-enhanced dual module". The verification primers were kana-F / R and Cm-F / R (primer sequences as above).
[0143] The genetically engineered strain of Corynebacterium glutamicum, “Cg-enhanced dual module”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0144] The fermentation of Corynebacterium glutamicum "Cg-enhanced dual-module" consists of three steps:
[0145] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum "Cg-enhanced dual module" stored at -80℃ and transfer it to a test tube containing 4 mL LBHIS liquid medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0146] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-free conical flask containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0147] Inoculation with shake-flask fermentation medium: The seed stock was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The culture was carried out at 30℃ and 200 rpm in a constant temperature shaker for 48 h (0.8 mM IPTG was added for induction after 3 h of culture). Sampling points were taken every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of protocatechuic acid concentration in fermentation broth: Protocatechuic acid in fermentation broth was detected using an UltiMate 3000 high-performance liquid chromatograph (HPLC, Thermo Fisher Scientific). The mobile phase consisted of phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). A ZORBAX SB-C18 reverse-phase column was used, with a column temperature of 28℃ and a flow rate of 1.0 mL / min. A UV detector was used, with an UV absorption wavelength of 260 nm. Finally, the content of products and other metabolites was calculated based on the peak data of different fermentation samples using a standard curve plotted from standard samples. The results are shown in Table 3 and... Figure 4 .
[0148] Table 3
[0149]
[0150] Example 2
[0151] 2.1 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0152] Using Corynebacterium glutamicum ATCC13032 genomic DNA as a template, pcaHG-L was amplified using primers pcaHG-L-up / pcaHG-L-down (as shown in SEQ ID NO.28), and pcaHG-R was amplified using primers pcaHG-R-up / pcaHG-R-down (as shown in SEQ ID NO.29), obtaining the upstream and downstream homologous arms of the completely deleted pcaHG (gene sequence shown in SEQ ID NO.30).
[0153] The primer sequences are:
[0154] pcaHG-L-up: 5'-ATGATTACGCCATCGCATTGCCGAAAAGC-3'; SEQ ID NO.31;
[0155] pcaHG-L-down: 5'-GGTCAATGCGAGACCTTTCTGCGTC-3'; SEQ ID NO.32;
[0156] pcaHG-R-up: 5'-AAAGGTCTCGCATTGACCCGATCTTTATACTCCGAC-3'; SEQ ID NO.33;
[0157] pcaHG-R-down: 5'-CTCAACGTTGACGGTGATGCCA-3'; SEQ ID NO. 34.
[0158] Gene amplification system: Primestar (Takara) 25 μL, forward and reverse primers 2 μL each, template 1 μL, ddH2O added to 20 μL.
[0159] Gene amplification program: 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 10 seconds / kb, 35 cycles; 72℃ extension for 10 minutes.
[0160] The PCR products were subjected to agarose gel electrophoresis and product recovery to obtain gene fragments pcaHG-L and pcaHG-R.
[0161] The plasmid vector pk18mobsacb was linearized using primers pk-pcaHG-F and pk-pcaHG-R to obtain the pk-pcaHG vector. The primer sequences are as follows:
[0162] pk-pcaHG-F: 5'-ATCACCGTCAACGTTGAGCTCGGTAGATCCTCTAGAGT-3'; SEQ ID NO.35;
[0163] pk-pcaHG-R: 5'-AATGCGATGGCGTAATCATGTCATAGCTGTTTCCTG-3'; SEQ ID NO. 36.
[0164] Add 3 μL pcaHG-L, 3 μL pcaHG-R, 4 μL pk-pcaHG vector, and 10.0 μL Gibson ligase to a PCR tube; the ligation temperature is 50℃, the ligation time is 15 min, and the total volume is 20 μL.
[0165] The total 20 μl Gibson-ligated culture was transformed into commercial E. coli Trans10 competent cells (Beijing TransGen Biotechnology) for culture and preservation. Transformation was performed strictly according to the manufacturer's instructions. After incubation at 37°C for 1 hour, the cells were plated onto LB agar plates (containing 50 μg / mL kanamycin) and incubated at 37°C for 12 hours. Approximately 10-20 single colonies were selected for colony PCR amplification and DNA sequencing verification. Primers for colony PCR amplification and DNA sequencing were:
[0166] Pklj-F: 5'-GCGGATAACAATTTCACACAGGA-3'; SEQ ID NO.37;
[0167] Pklj-R: 5'-CGGGCCTCTTCGCTATTAC-3'; SEQ ID NO. 38.
[0168] A single colony was selected and named *Escherichia coli* WJ001. After propagation and plasmid extraction, the WJ001 plasmid was obtained. The *E. coli* WJ001 plasmid was then electroporated into *Corynebacterium glutamicum* ATCC13032 competent cells.
[0169] Competent cells were prepared and electroporated as described above (Example 1). The mixture was spread evenly onto LBHIS solid medium plates containing 50 μg / mL kanamycin and incubated at 30°C for 24-36 h.
[0170] Single colonies grown on the plates were selected for sacB gene verification. Only colonies that could grow on kanamycin-resistant plates and amplify the sacB gene (band size 999 bp) were considered to have undergone the first homologous recombination. The verification primers are as follows:
[0171] sac-F: 5'-CCCATATTACACGCCATGATATGCT-3'; SEQ ID NO.39;
[0172] sac-R: 5'-GCATGTAAATATCGTTAGACGTAATGCCG-3'; SEQ ID NO. 40.
[0173] Select the correctly verified bacterial strains and inoculate them into 30% sucrose medium and incubate for 24 hours. After the bacterial culture becomes turbid, streak it onto 20% sucrose solid medium. Select single colonies from the plates and perform colony PCR for the sacB gene. For single colonies that do not amplify the sacB gene, perform a second colony PCR using the verification primers. The pcaHG verification (band size 3376 bp) primers are as follows:
[0174] pcaHG-verification-F: 5'-CGCGACTTGCCATCACATC-3'; SEQ ID NO.41;
[0175] pcaHG-verification-R: 5'-GTCAAGCAGGCTAAACCGGAG-3'; SEQ ID NO.42.
[0176] Based on the knockout principle of Corynebacterium glutamicum, after the second homologous recombination, the entire knockout plasmid will detach from the genome, thus achieving the knockout purpose. Therefore, the colonies that have undergone secondary recombination will no longer contain the sacB gene. After verifying the successful knockout with the validation primers, the cells were inoculated into LBHIS liquid medium for culture and streaked onto LBHIS solid medium plates for purification and re-validation. After confirming that there were no errors, the bacteria could be preserved for use. cgATCC13032ΔpcaHG was named Corynebacterium glutamicum Cg-ΔpcaHG.
[0177] Subsequently, using the engineered strain Cg-ΔpcaHG as the chassis host, a genetically engineered bacterium was constructed to synthesize protocatechuic acid de novo using glucose as a substrate, as detailed below:
[0178] 2.2 Using the *E. coli* WJ101 plasmid constructed above (see 1.1 of Example 1), 2.0 μl of the *E. coli* WJ101 plasmid was electroporated into competent cells of the engineered strain Cg-ΔpcaHG. The preparation and electroporation of competent cells were the same as above (Example 1). The mixture was spread onto LBHIS solid medium plates containing 5 μg / mL chloramphenicol and incubated at 30°C for 24–36 h.
[0179] Single colonies grown on the plate were selected for verification of the cm gene. Only colonies that could grow on chloramphenicol-resistant plates and amplify the cm gene were the target species, named Corynebacterium glutamicum Cg-ΔpcaHG-aroB-aroD-qsuB, and the verification primers were Cm-F / R (primer sequences as above).
[0180] The genetically engineered strain of Corynebacterium glutamicum, “Corynebacterium glutamicum Cg-ΔpcaHG-aroB-aroD-qsuB”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0181] The fermentation of Corynebacterium glutamicum Cg-ΔpcaHG-aroB-aroD-qsuB involves three steps:
[0182] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum Cg-ΔpcaHG-aroB-aroD-qsuB stored at -80℃ and transfer it to a test tube containing 4 mL of LBHIS liquid medium (containing 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0183] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-less conical flask containing 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0184] Inoculation with shake-flask fermentation medium: The seed volume was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The mixture was incubated at 30℃ and 200 rpm for 48 h (0.8 mM IPTG was added for induction after 3 h of incubation). Sampling was performed every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600(2) Determination of the content of products and other metabolites: The content of protocatechuic acid and other metabolites in the fermentation product was determined by high performance liquid chromatography (HPLC). The detection method was as follows: the mobile phase included phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). The chromatographic column used was a ZORBAX SB-C18 reverse chromatographic column, the column temperature was set to 28℃, the flow rate of the mobile phase was set to 1.0 mL / min, and the detection was performed using a UV detector with a UV absorption wavelength set to 260 nm. Finally, the content of products and other metabolites was calculated based on the data peak diagrams of different fermentation samples according to the standard curve drawn from the standard samples. The peak time of the HPLC detection result of the protocatechuic acid standard was 11.380 min, and the peak time of the HPLC detection result of the engineered strain fermentation sample and its fermentation culture product was 11.363 min. The peak time of the engineered strain fermentation sample was consistent with the peak time of the protocatechuic acid standard, proving that the fermentation product of the engineered strain was the target product - protocatechuic acid. The results of protocatechuic acid shake-flask fermentation of engineered strains Cg-aroB-aroD-qsuB and Cg-ΔpcaHG-aroB-aroD-qsuB are shown in Table 4 and 5. Figure 5 .
[0185] Table 4
[0186]
[0187] 2.3 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0188] Using the *E. coli* WJ201 plasmid constructed above (see 1.2 of Example 1), 2.0 μl of the *E. coli* WJ201 plasmid was electroporated into competent cells of the engineered strain Cg-ΔpcaHG. The preparation and electroporation of competent cells were the same as above (Example 1). The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and incubated at 30°C for 24–36 h.
[0189] Single colonies grown on the plate were selected for verification of the kana gene. Only colonies that could grow on kanamycin-resistant plates and amplify the kana gene were the target strains, named Corynebacterium glutamicum Cg-ΔpcaHG-tkt-aroG, and the verification primers were kana-F / R (primer sequences as above).
[0190] The genetically engineered strain of Corynebacterium glutamicum, “Corynebacterium glutamicum Cg-ΔpcaHG-tkt-aroG”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0191] The fermentation of Corynebacterium glutamicum Cg-ΔpcaHG-tkt-aroG involves three steps:
[0192] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum Cg-ΔpcaHG-tkt-aroG stored at -80℃ and transfer it to a test tube containing 4 mL of LBHIS liquid medium (containing 50 μg / mL kanamycin). Incubate at 30℃ for 12-14 h.
[0193] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-less conical flask containing 50 μg / mL kanamycin), and incubate in a constant temperature shaker at 30℃ and 200 rpm for 12-14 hours.
[0194] Inoculation with shake-flask fermentation medium: The seed volume was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The mixture was incubated at 30℃ and 200 rpm for 48 h (0.8 mM IPTG was added for induction after 3 h of incubation). Sampling was performed every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of the content of products and other metabolites: The content of protocatechuic acid and other metabolites in the fermentation product was determined by high performance liquid chromatography (HPLC). The detection method was as follows: the mobile phase included phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). The chromatographic column used was a ZORBAX SB-C18 reverse chromatographic column, the column temperature was set to 28℃, the flow rate of the mobile phase was set to 1.0 mL / min, and the detection was performed using a UV detector with a UV absorption wavelength set to 260 nm. Finally, the content of products and other metabolites was calculated based on the data peak diagrams of different fermentation samples according to the standard curve drawn from the standard samples. The peak time of the HPLC detection result of the protocatechuic acid standard was 11.380 min, and the peak time of the HPLC detection result of the engineered strain fermentation sample and its fermentation culture product was 11.363 min. The peak time of the engineered strain fermentation sample was consistent with the peak time of the protocatechuic acid standard, proving that the fermentation product of the engineered strain was the target product - protocatechuic acid. The results of protocatechuic acid shake-flask fermentation of engineered strains Cg-tkt-aroG and Cg-ΔpcaHG-tkt-aroG are shown in Table 5. Figure 6 .
[0195] Table 5
[0196]
[0197] 2.4 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0198] Using the *E. coli* WJ101 and WJ201 plasmids constructed above (see 1.1 and 1.2 of Example 1), 2.0 μl of each plasmid was simultaneously electroporated into competent cells of the engineered strain Cg-ΔpcaHG. The preparation and electroporation of competent cells were the same as described above (Example 1). The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol and incubated at 30°C for 24–36 h.
[0199] Single colonies grown on the plates were selected for verification of the kana and cm genes. Only colonies that could grow on both kana and chloramphenicol-resistant plates and amplify the kana and cm genes were identified as the target strain and named Corynebacterium glutamicum “Cg-ΔpcaHG-enhanced dual module”. The verification primers were kana-F / R and Cm-F / R (primer sequences as above).
[0200] The genetically engineered strain of Corynebacterium glutamicum, “Cg-ΔpcaHG-enhanced dual module”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0201] The fermentation of Corynebacterium glutamicum "Cg-ΔpcaHG-enhanced dual-module" consists of three steps:
[0202] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum "Cg-ΔpcaHG-Enhanced Dual Module" stored at -80℃ and transfer it to a test tube containing 4 mL LBHIS liquid medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0203] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-free conical flask containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0204] Inoculation with shake-flask fermentation medium: The seed stock was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The culture was carried out at 30℃ and 200 rpm in a constant temperature shaker for 48 h (0.8 mM IPTG was added for induction after 3 h of culture). Sampling points were taken every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of protocatechuic acid concentration in fermentation broth: Protocatechuic acid in fermentation broth was detected using an UltiMate 3000 high-performance liquid chromatograph (HPLC, Thermo Fisher Scientific). The mobile phase consisted of phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). A ZORBAX SB-C18 reverse-phase column was used, with a column temperature of 28℃ and a flow rate of 1.0 mL / min. A UV detector was used, with an UV absorption wavelength of 260 nm. Finally, the content of products and other metabolites was calculated based on the peak data of different fermentation samples using a standard curve plotted from standard samples. The results are shown in Table 6 and... Figure 7 .
[0205] Table 6
[0206]
[0207] Example 3
[0208] A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate includes the following steps:
[0209] Using E. coli K12 genomic DNA as a template, the tktA fragment (as shown in SEQ ID NO. 16) was amplified using primers tktA2-F / R to obtain the E. coli K12-derived tktA fragment with a seamless cloning homologous arm linked to the plasmid vector pEC-XK99E and an RBS (ribosome binding site).
[0210] aroG derived from E. coli K12, synthesized by BGI Genomics, has anti-feedback inhibition properties. fbr Using a gene fragment (as shown in SEQ ID NO. 17) as a template, the aroG fragment was amplified using primers aroG2-F / R. fbr AroG derived from E. coli K12 with a seamless clonal homologous arm linked to tktA and RBS was obtained. fbr Excerpt.
[0211] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the fragment tal (as shown in SEQ ID NO.43) was amplified using primers tal-F / R to obtain the band with aroG. fbr The seamless clonal homologous arm and the tal fragment of Corynebacterium glutamicum from RBS were linked.
[0212] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the gapA fragment (as shown in SEQ ID NO.44) was amplified using primers gapA-F / R to obtain the Corynebacterium glutamicum-derived gapA fragment with a seamless cloning homologous arm linked to tal and plasmid vector pEC-XK99E and RBS.
[0213] The primer sequences are:
[0214] tktA2-F: 5'-GGATATACATATGTCCTCACGTAAAGAGCTTGC-3'; SEQ ID NO.45;
[0215] tktA2-R: 5'-CAAGATCATCAATGTGAGACATATGTATATCCTCCTTTTACAGCAGTTTCTTTTGCTTTCGC-3'; SEQ ID NO.46;
[0216] aroG2-F: 5'-ggaaacagaccatggaattcAAGGAGGATATACATatgaattatcagaacgacgatttacgc-3'; SEQ ID NO.47;
[0217] aroG2-R: 5'-ACGTGAGGACATATGTATATCCTCCTTttacccgcgacgcgctttta-3'; SEQ IDNO.48;
[0218] tal-F: 5'-ATGTCTCACATTGATGATCTTGCAC-3'; SEQ ID NO.49;
[0219] tal-R: 5'-ACCAACACGAATGGTCATATGTATATCCTCCTTCTACTTCAGGCGAGCTTCCAT-3'; SEQ ID NO.50;
[0220] gapA-F: 5'-ATGACCATTCGTGTTGGTATTAACG-3'; SEQ ID NO.51;
[0221] gapA-R: 5'-tctagaggatccccgggtaccgagctcTTAGAGCTTGGAAGCTACGAGCTC-3'; SEQ ID NO.52;
[0222] The gene amplification system and gene amplification procedure are the same as above.
[0223] After agarose gel electrophoresis and product recovery, the PCR products yielded the corresponding gene products tktA and aroG from different sources. fbr ,tal and gapA.
[0224] The plasmid vector pEC-XK99E was linearized using primers pec2-F and pec2-R to obtain the pec vector. The primer sequences are as follows:
[0225] pec2-F: 5'-tacccggggatcctctagagtc-3'; SEQ ID NO.53;
[0226] pec2-R: 5'-gaattccatggtctgtttcctgtg-3'; SEQ ID NO. 54.
[0227] The amplification system and procedure are the same as those for gene amplification.
[0228] Add 2.0 μl of tktA and 1.0 μl of aroG from different sources to the PCR tube. fbr 1.5 μl tal, 1.5 μl gapA, 4.0 μl pec vector, 10.0 μl Gibson enzyme.
[0229] The connection temperature was 50℃, the connection time was 15 min, and the total volume was 20 μL.
[0230] The total 20 μl Gibson-ligated culture was transformed into commercial E. coli Trans10 competent cells for culture and preservation. Transformation was performed strictly according to the manufacturer's instructions. After incubation at 37°C for 1 hour, the cells were plated onto LB agar plates (containing 50 μg / mL kanamycin) and then incubated at 37°C for another 12 hours. Approximately 10-20 single colonies were selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were Pec-F1 / R1 (primer sequences as above).
[0231] Select a correct single colony and name it Escherichia coli WJ301. After propagation and plasmid extraction, obtain the Escherichia coli WJ301 plasmid.
[0232] Using the *E. coli* WJ101 plasmid constructed above (see 1.1 of Example 1) and the *E. coli* WJ301 plasmid, 2.0 μl of each plasmid was simultaneously electroporated into competent cells of the engineered strain Cg-ΔpcaHG. The preparation and electroporation of competent cells were the same as in Example 1. The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol, and incubated at 30°C for 24–36 h.
[0233] Single colonies grown on the plates were selected for verification of the kana and cm genes. Only colonies that could grow on both kana and chloramphenicol-resistant plates and amplify the kana and cm genes were identified as the target strain and named Corynebacterium glutamicum “Cg-ΔpcaHG-enhanced dual-module-tal-gap”. The verification primers were kana-F / R and Cm-F / R (primer sequences as above).
[0234] The genetically engineered strain of Corynebacterium glutamicum, “Cg-ΔpcaHG-enhanced dual-module-tal-gap”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0235] The fermentation of Corynebacterium glutamicum "Cg-ΔpcaHG-enhanced dual-module-tal-gap" consists of three steps:
[0236] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum “Cg-ΔpcaHG-enhanced dual module-tal-gap” stored at -80℃ and transfer it to a test tube containing 4 mL LBHIS liquid medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0237] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-free conical flask containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0238] Inoculation with shake-flask fermentation medium: The seed quantity was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The culture was carried out at 30℃ and 200 rpm in a constant temperature shaker for 96 h (0.8 mM IPTG was added for induction after 3 h of culture). Sampling points were taken every 24 h to detect OD. 600And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of protocatechuic acid concentration in fermentation broth: Protocatechuic acid in fermentation broth was detected using an UltiMate 3000 high-performance liquid chromatograph (HPLC, Thermo Fisher Scientific). The mobile phase consisted of phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). A ZORBAX SB-C18 reverse-phase column was used, with a column temperature of 28℃ and a flow rate of 1.0 mL / min. A UV detector was used, with an UV absorption wavelength of 260 nm. Finally, the content of products and other metabolites was calculated based on the peak data of different fermentation samples using a standard curve plotted from standard samples. The results are shown in Table 7 and... Figure 8 .
[0239] Table 7
[0240]
[0241] Example 4
[0242] 4.1 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0243] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroB fragment (as shown in SEQ ID NO.1) was amplified using primers aroB-F / R to obtain the Corynebacterium glutamicum-derived aroB fragment with a seamless cloning homologous arm linked to the plasmid vector pXMJ19 and RBS.
[0244] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroD fragment (as shown in SEQ ID NO.2) was amplified using primers aroD-F / R to obtain the aroD fragment from Corynebacterium glutamicum with a seamless clonal homologous arm linked to aroB and RBS.
[0245] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the fragment qsuB (as shown in SEQ ID NO.3) was amplified using primers qsuB-F / R to obtain the Corynebacterium glutamicum-derived qsuB fragment with a seamless clonal homologous arm linked to aroD and RBS.
[0246] Using E. coli K12 genomic DNA as a template, the fragment ubiC (as shown in SEQ ID NO. 55) was amplified using primers ubiC-F / R to obtain the E. coli K12-derived ubiC fragment with a seamless cloning homologous arm linked to qsuB and an RBS (ribosome binding site).
[0247] Using the pobA gene fragment from Pseudomonas aeruginosa synthesized by BGI as a template, the pobA fragment (as shown in SEQ ID NO.56) was amplified using primers pobA-F / R to obtain a pobA fragment from Pseudomonas aeruginosa with a seamless cloning homologous arm linked to ubiC and plasmid vector pXMJ19 and an RBS.
[0248] The primer sequences are:
[0249] aroB-F / R, aroD-F / R, and qsuB-F / R are the same as above.
[0250] ubiC-F: 5'-CGGGGAATCCCAAACTAGAAGGAGGATATACATATGTCACAACCCCGCGTTAAC-3'; SEQ ID NO.57;
[0251] ubiC-R: 5'-TTAGTACAACGGTGACGCCG-3'; SEQ ID NO.58;
[0252] pobA-F: 5'-GCGTCACCGTTGTACTAAAAGGAGGATATACATATGAAGACTCAAGTCGCCATCA-3'; SEQ ID NO.59;
[0253] pobA-R: 5'-CTACTCGATTTCCTCGTAGGGC-3'; SEQ ID NO. 60.
[0254] The gene amplification system and gene amplification procedure are the same as above.
[0255] After agarose gel electrophoresis and product recovery, the PCR products yielded gene products aroB, aroD, qsuB, ubiC, and pobA from different sources.
[0256] The amplification system and procedure are the same as those for gene amplification.
[0257] The plasmid vector pXMJ19 was linearized using primers px-F2 and px-R2 to obtain the pxmj vector. The primer sequences are as follows:
[0258] px-F2: 5'-CCTACGAGGAAATCGAGTAGtctagaggatccccgggt-3'; SEQ ID NO.61;
[0259] px-R2: 5'-tgcaggcatgcaagcttaattaattc-3'; SEQ ID NO. 62.
[0260] Add 1.0 μl of aroB, 1.0 μl of aroD, 2.0 μl of qsuB, 1.0 μl of ubiC, 1.0 μl of pobA, 4.0 μl of pxmj vector, and 10.0 μl of Gibson enzyme from different sources to the PCR tube.
[0261] The connection temperature was 50℃, the connection time was 15 min, and the total volume was 20 μL.
[0262] The total 20 μl Gibson-ligated culture was transformed into commercial E. coli Trans10 competent cells for culture and preservation. Transformation was performed strictly according to the manufacturer's instructions. After incubation at 37°C for 1 hour, the cells were plated onto LB agar plates (containing 5 μg / mL chloramphenicol) and incubated at 37°C for another 12 hours. Approximately 10-20 single colonies were then selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were Pxmj-F / R (primer sequences as above).
[0263] Select a correct single colony and name it Escherichia coli WJ401. After propagation and plasmid extraction, obtain the Escherichia coli WJ401 plasmid.
[0264] Using the *E. coli* WJ301 plasmid (see Example 3) and *E. coli* WJ401 plasmid constructed above, 2.0 μl of each plasmid was simultaneously electroporated into competent cells of the engineered strain Cg-ΔpcaHG. The preparation and electroporation of competent cells were the same as in Example 1. The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol, and incubated at 30°C for 24–36 h.
[0265] Single colonies grown on the plates were selected for verification of the kana and cm genes. Only colonies that could grow on both kana and chloramphenicol-resistant plates and amplify the kana and cm genes were identified as the target strain and named Corynebacterium glutamicum “Cg-ΔpcaHG-double01”. The verification primers were kana-F / R and Cm-F / R (primer sequences as above).
[0266] The genetically engineered strain of Corynebacterium glutamicum, “Cg-ΔpcaHG-double01”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0267] The fermentation of Corynebacterium glutamicum “Cg-ΔpcaHG-double01” consists of three steps:
[0268] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum “Cg-ΔpcaHG-double01” stored at -80℃ and transfer it to a test tube containing 4 mL LBHIS liquid medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0269] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-free conical flask containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0270] Inoculation with shake-flask fermentation medium: The seed quantity was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The culture was carried out at 30℃ and 200 rpm in a constant temperature shaker for 96 h (0.8 mM IPTG was added for induction after 3 h of culture). Sampling points were taken every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of protocatechuic acid concentration in fermentation broth: Protocatechuic acid in fermentation broth was detected using an UltiMate 3000 high-performance liquid chromatograph (HPLC, Thermo Fisher Scientific). The mobile phase consisted of phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). A ZORBAX SB-C18 reverse-phase column was used, with a column temperature of 28℃ and a flow rate of 1.0 mL / min. A UV detector was used, with an UV absorption wavelength of 260 nm. Finally, the content of products and other metabolites was calculated based on the peak data of different fermentation samples using a standard curve plotted from standard samples. The results are shown in Table 8 and... Figure 9 .
[0271] Table 8
[0272]
[0273] 4.2 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0274] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroB fragment (as shown in SEQ ID NO.1) was amplified using primers aroB-F / R to obtain the Corynebacterium glutamicum-derived aroB fragment with a seamless cloning homologous arm linked to the plasmid vector pXMJ19 and RBS.
[0275] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroD fragment (as shown in SEQ ID NO.2) was amplified using primers aroD-F / R to obtain the aroD fragment from Corynebacterium glutamicum with a seamless clonal homologous arm linked to aroB and RBS.
[0276] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the fragment qsuB (as shown in SEQ ID NO.3) was amplified using primers qsuB-F / R to obtain the Corynebacterium glutamicum-derived qsuB fragment with a seamless clonal homologous arm linked to aroD and RBS.
[0277] ubiC derived from E. coli K12 synthesized by BGI Genomics and optimized with codons opt Using a gene fragment (as shown in SEQ ID NO. 63) as a template, the ubiC2-F / R primer was used to amplify the ubiC2-F / R gene fragment. opt UbiC derived from E. coli K12 with a seamless clonal homologous arm linked to qsuB and RBS was obtained. opt Excerpt.
[0278] pobA derived from Pseudomonas aeruginosa and synthesized by BGI Genomics with optimized codons opt Using a gene fragment (as shown in SEQ ID NO. 64) as a template, the pobA fragment was amplified using primers pobA2-F / R. opt PobA derived from Pseudomonas aeruginosa, with a seamless clonal homologous arm linked to ubiC and plasmid vector pXMJ19 and RBS, was obtained. opt Excerpt.
[0279] The primer sequences are:
[0280] aroB-F / R, aroD-F / R, and qsuB-F / R are the same as above.
[0281] ubiC2-F: 5'-CGGGGAATCCCAAACTAGAAGGAGGATATACATATGAGCCACCCGGCG-3'; SEQ IDNO.65;
[0282] ubiC2-R: 5'-TTAGTACAGCGGAGAAGCCG-3'; SEQ ID NO.66;
[0283] pobA2-F: 5'-GGCTTCTCCGCTGTACTAAAAGGAGGATATACATATGAAAACCCAGGTTGCGAT-3'; SEQ ID NO.67;
[0284] pobA2-R: 5'-TTATTCAATTTCTTCATACGGCAGACC-3'; SEQ ID NO. 68.
[0285] The gene amplification system and gene amplification procedure are the same as above.
[0286] After agarose gel electrophoresis and product recovery, the PCR products yielded the corresponding gene products aroB, aroD, qsuB, and ubiC from different sources. opt and pobA opt .
[0287] The amplification system and procedure are the same as those for gene amplification.
[0288] The plasmid vector pXMJ19 was linearized using primers px-F3 and px-R3 to obtain the pxmj vector. The primer sequences are as follows:
[0289] px-F3: 5'-CTGCCGTATGAAGAAATTGAATAAtctagaggatccccgggt-3'; SEQ ID NO.69;
[0290] px-R3: 5'-tgcaggcatgcaagcttaattaattc-3'; SEQ ID NO. 70.
[0291] Add 1.0 μl of aroB, 1.0 μl of aroD, 2.0 μl of qsuB, and 1.0 μl of ubiC from different sources to the PCR tube. opt 1.0 μl pobA opt 4.0 μl pxmj vector, 10.0 μl Gibson enzyme.
[0292] The connection temperature was 50℃, the connection time was 15 min, and the total volume was 20 μL.
[0293] The total 20 μl Gibson-ligated culture was transformed into commercial E. coli Trans10 competent cells for culture and preservation. Transformation was performed strictly according to the manufacturer's instructions. After incubation at 37°C for 1 hour, the cells were plated onto LB agar plates (containing 5 μg / mL chloramphenicol) and incubated at 37°C for another 12 hours. Approximately 10-20 single colonies were then selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were Pxmj-F / R (primer sequences as above).
[0294] Select a correct single colony and name it Escherichia coli WJ501. After propagation and plasmid extraction, obtain the Escherichia coli WJ501 plasmid.
[0295] Using the *E. coli* WJ301 plasmid (see Example 3) and *E. coli* WJ501 plasmid constructed above, 2.0 μl of each plasmid was simultaneously electroporated into competent cells of the engineered strain Cg-ΔpcaHG. The preparation and electroporation of competent cells were the same as in Example 1. The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol, and incubated at 30°C for 24–36 h.
[0296] Single colonies grown on the plates were selected for verification of the kana and cm genes. Only colonies that could grow on both kana and chloramphenicol-resistant plates and amplify the kana and cm genes were identified as the target strain and named Corynebacterium glutamicum “Cg-ΔpcaHG-double02”. The verification primers were kana-F / R and Cm-F / R (primer sequences as above).
[0297] The genetically engineered strain of Corynebacterium glutamicum, “Cg-ΔpcaHG-double02”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0298] The fermentation of Corynebacterium glutamicum “Cg-ΔpcaHG-double02” consists of three steps:
[0299] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum “Cg-ΔpcaHG-double02” stored at -80℃ and transfer it to a test tube containing 4 mL of LBHIS liquid medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0300] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-free conical flask containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0301] Inoculation with shake-flask fermentation medium: The seed quantity was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The culture was carried out at 30℃ and 200 rpm in a constant temperature shaker for 96 h (0.8 mM IPTG was added for induction after 3 h of culture). Sampling points were taken every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600 Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of protocatechuic acid concentration in fermentation broth: Protocatechuic acid in fermentation broth was detected using an UltiMate 3000 high-performance liquid chromatograph (HPLC, Thermo Fisher Scientific). The mobile phase consisted of phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). A ZORBAX SB-C18 reverse-phase column was used, with a column temperature of 28℃ and a flow rate of 1.0 mL / min. A UV detector was used, with an UV absorption wavelength of 260 nm. Finally, the content of products and other metabolites was calculated based on the peak data of different fermentation samples using a standard curve plotted from standard samples. The results are shown in Table 9 and... Figure 10 .
[0302] Table 9
[0303]
[0304] 4.3 A method for constructing a genetically engineered bacterium that synthesizes protocatechuic acid de novo using glucose as a substrate, comprising the following steps:
[0305] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroB fragment (as shown in SEQ ID NO.1) was amplified using primers aroB-F / R to obtain the Corynebacterium glutamicum-derived aroB fragment with a seamless cloning homologous arm linked to the plasmid vector pXMJ19 and RBS.
[0306] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the aroD fragment (as shown in SEQ ID NO.2) was amplified using primers aroD-F / R to obtain the aroD fragment from Corynebacterium glutamicum with a seamless clonal homologous arm linked to aroB and RBS.
[0307] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the fragment qsuB (as shown in SEQ ID NO.3) was amplified using primers qsuB-F / R to obtain the Corynebacterium glutamicum-derived qsuB fragment with seamless clonal homologous arms and RBS of aroD and the following genes.
[0308] UbiC derived from E. coli K12 synthesized by BGI Genomics and optimized with codons opt Using the gene fragment (as shown in SEQ ID NO. 63) as a template, the ubiC2-F / R primer was used to amplify the ubiC2-F / R gene fragment. opt UbiC derived from E. coli K12 with seamless clonal homologous arms linked to qsuB and RBS. opt Excerpt.
[0309] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the pobA fragment was amplified using primers pobA3-F / R. cg (As shown in SEQ ID NO.71), obtain with ubiC opt Seamless cloning homologous arms linked to plasmid vector pXMJ19 and RBS-derived pobA from Corynebacterium glutamicum cg Excerpt.
[0310] The primer sequences are:
[0311] aroB-F / R, aroD-F / R, qsuB-F / R, and ubiC2-F / R are the same as above.
[0312] pobA3-F: 5'-GGCTTCTCCGCTGTACTAAAAGGAGGATATACATATGAACCACGTACCAGTGGC-3'; SEQ ID NO.72;
[0313] pobA3-R: 5'-TTATACCTCGAAGCGTGGTAGGT-3'; SEQ ID NO. 73.
[0314] The gene amplification system and gene amplification procedure are the same as above.
[0315] After agarose gel electrophoresis and product recovery, the PCR products yielded the corresponding gene products aroB, aroD, qsuB, and ubiC from different sources. opt and pobA cg .
[0316] The amplification system and procedure are the same as those for gene amplification.
[0317] The plasmid vector pXMJ19 was linearized using primers px-F4 and px-R4 to obtain the pxmj vector. The primer sequences are as follows:
[0318] px-F4: 5'-CCACGCTTCGAGGTATAAtctagaggatccccgggt-3'; SEQ ID NO.74;
[0319] px-R4: 5'-tgcaggcatgcaagcttaattaattc-3'; SEQ ID NO. 75.
[0320] Add 1.0 μl of aroB, 1.0 μl of aroD, 2.0 μl of qsuB, and 1.0 μl of ubiC from different sources to the PCR tube. opt 1.0 μl pobA cg 4.0 μl pxmj vector, 10.0 μl Gibson enzyme.
[0321] The connection temperature was 50℃, the connection time was 15 min, and the total volume was 20 μL.
[0322] The total 20 μl Gibson-ligated culture was transformed into commercial E. coli Trans10 competent cells for culture and preservation. Transformation was performed strictly according to the manufacturer's instructions. After incubation at 37°C for 1 hour, the cells were plated onto LB agar plates (containing 5 μg / mL chloramphenicol) and incubated at 37°C for another 12 hours. Approximately 10-20 single colonies were then selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were Pxmj-F / R (primer sequences as above).
[0323] Select a correct single colony and name it Escherichia coli WJ601. After propagation and plasmid extraction, obtain the Escherichia coli WJ601 plasmid.
[0324] Using the *E. coli* WJ301 plasmid (see Example 3) and *E. coli* WJ601 plasmid constructed above, 2.0 μl of each plasmid was simultaneously electroporated into competent cells of the engineered strain Cg-ΔpcaHG. The preparation and electroporation of competent cells were the same as in Example 1. The mixture was then spread onto LBHIS solid medium plates containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol, and incubated at 30°C for 24–36 h.
[0325] Single colonies grown on the plates were selected for verification of the kana and cm genes. Only colonies that could grow on both kana and chloramphenicol-resistant plates and amplify the kana and cm genes were identified as the target strain and named Corynebacterium glutamicum “Cg-ΔpcaHG-double03”. The verification primers were kana-F / R and Cm-F / R (primer sequences as above).
[0326] The genetically engineered strain of Corynebacterium glutamicum, “Cg-ΔpcaHG-double03”, was validated by fermentation in a 50 mL system. The seed culture was carried out using LBG medium, and the fermentation was performed using shake flask fermentation medium.
[0327] The fermentation of Corynebacterium glutamicum “Cg-ΔpcaHG-double03” consists of three steps:
[0328] Transfer to test tubes: Take 100 μL of Corynebacterium glutamicum “Cg-ΔpcaHG-double03” stored at -80℃ and transfer it to a test tube containing 4 mL of LBHIS liquid medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate at 30℃ for 12-14 h.
[0329] Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of bacterial culture from the test tube and transfer it to 20 mL of LBG liquid medium (container is a 100 mL baffle-free conical flask containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and incubate at 30℃ and 200 rpm in a constant temperature shaker for 12-14 hours.
[0330] Inoculation with shake-flask fermentation medium: The seed quantity was 5% of the total fermentation system, inoculated into 50 mL of fermentation broth (container: 250 mL baffled Erlenmeyer flask; shake-flask fermentation medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). The pH of the fermentation broth was adjusted to neutral using concentrated ammonia. The culture was carried out at 30℃ and 200 rpm in a constant temperature shaker for 96 h (0.8 mM IPTG was added for induction after 3 h of culture). Sampling points were taken every 24 h to detect OD. 600 And the concentration of the target product, protocatechuic acid. (1) OD 600Detection: The fermentation broth was poured into a cuvette, diluted 50 times with deionized water, and the absorbance (600 nm) was measured using a UV spectrophotometer. The OD value was then determined. 600 (2) Determination of protocatechuic acid concentration in fermentation broth: Protocatechuic acid in fermentation broth was detected using an UltiMate 3000 high-performance liquid chromatograph (HPLC, Thermo Fisher Scientific). The mobile phase consisted of phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). A ZORBAX SB-C18 reverse-phase column was used, with a column temperature of 28℃ and a flow rate of 1.0 mL / min. A UV detector was used, with an UV absorption wavelength of 260 nm. Finally, the content of products and other metabolites was calculated based on the peak data of different fermentation samples using a standard curve plotted from standard samples. The results are shown in Table 10 and... Figure 11 .
[0331] Table 10
[0332]
[0333] Example 5: The optimal engineered strain Cg-ΔpcaHG-double03 undergoes de novo fermentation using glucose as a substrate to synthesize protocatechuic acid.
[0334] Preparation of seed culture: Select a single colony of engineered Corynebacterium glutamicum Cg-ΔpcaHG-double03 and inoculate it into 5 mL of LBHis liquid medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol. Incubate in a constant temperature shaker at 30℃ and 200 rpm for 14 h. This is the primary activation process of the strain.
[0335] The activated bacterial culture was added to 100 mL of fresh LBG liquid medium containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol at a volume ratio of 1:50, and cultured in a constant temperature shaker at 30 °C and 200 rpm for 12 h. This is the fermentation seed culture process. The fermentation seed culture can be used for subsequent fermentation processes in shake flasks or 5L bioreactors.
[0336] Optimal fermentation conditions in the fermenter: Engineered Corynebacterium glutamicum Cg-ΔpcaHG-double03 is fermented using fermentation medium in the fermenter. The temperature is maintained at 30℃ throughout the fermentation process, and the pH value is controlled within the range of 6.9-7.1. During the fermentation process, 6% sulfuric acid and 25% ammonia are used for automatic pH adjustment. The aeration rate is 0.8 vvm, and the inoculum size is 5-10% to ensure an initial OD of 3.0. Taking a 5L fermenter as an example, the liquid volume is usually 2.5L. During the fermentation process, an antifoaming agent (silicone-based grease) is added appropriately according to the foam situation in the tank to keep the foam height in the tank no higher than 2cm.
[0337] The fermentation process is mainly divided into the growth period, the induction period, and the feeding stage. The growth period of the strain is 0-8 hours, during which the biomass of the strain accumulates rapidly. When the biomass OD600 reaches 20.25 (i.e., 8 hours), IPTG with a final concentration of 0.9 mM is added as an inducer for induction. At the same time, the feeding stage is started. The feeding stage is to add 800 g / L of glucose and add carbon source at a rate that increases over time, maintaining the sugar concentration in the tank at 20-25 g / L until the fermentation process is completed.
[0338] Detection of fermentation products: Samples were taken every 8 hours throughout the fermentation process, and biomass was measured using a spectrophotometer. Sugar and product concentrations were detected using a Thermo Fisher Scientific high-performance liquid chromatograph (HPLC), with the detection methods described above. Determination of protocatechuic acid concentration in the fermentation broth: Protocatechuic acid in the fermentation broth was detected using an UltiMate 3000 HPLC system (Thermo Fisher Scientific). The detection method included a mobile phase consisting of phase A (0.1% formic acid aqueous solution) and phase B (pure methanol). A ZORBAX SB-C18 reverse-phase column was used, with the column temperature set at 28℃ and the mobile phase flow rate set at 1.0 mL / min. Detection was performed using a UV detector with an UV absorption wavelength set to 260 nm. Finally, the content of products and other metabolites was calculated based on the peak data of different fermentation samples using a standard curve plotted from standard samples. Glucose was detected using an Aminex HPX-87H column with a UltiMate 3000 Variable Wavelength Detector. The mobile phase was 5 mM H₂SO₄, the column temperature was 65 °C, and the flow rate was 0.6 mL / min. The results are shown in Table 11. Figure 12 .
[0339] Table 11
[0340]
[0341]
[0342] Table 11 and Figure 12 The results show that, under optimal fermentation conditions, repeated experiments demonstrate that the highest concentration of protocatechuic acid produced by fermentation of the optimal engineered strain Cg-ΔpcaHG-double03 constructed in this invention can reach 85.16 g / L. This is the highest yield of protocatechuic acid produced by de novo biological synthesis in related studies reported to date, which has great potential for industrial application of high-yield protocatechuic acid produced by biological methods.
[0343] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A genetically engineered bacterium for synthesizing protocatechuic acid, characterized in that, the genetically engineered bacterium is a recombinant Corynebacterium glutamicum comprising a shikimic acid pathway and a DAHP pathway, and the recombinant Corynebacterium glutamicum is based on Corynebacterium glutamicum ATCC13032; or the genetically engineered bacterium is a recombinant Corynebacterium glutamicum comprising a shikimic acid pathway or a DAHP pathway, and the recombinant Corynebacterium glutamicum is based on Corynebacterium glutamicum ATCC13032 and is modified by a chassis microorganism; wherein the chassis microorganism is modified by knocking out a pcaHG gene of Corynebacterium glutamicum ATCC13032 as a starting strain; the shikimic acid pathway expresses a 3-dehydroquinate synthase gene, a 3-dehydroquinate dehydratase gene and a 3-dehydroshikimate dehydratase gene; and the DAHP pathway is DAHP pathway 1 or DAHP pathway 2; the DAHP pathway 1 expresses a transketolase gene and a 3-deoxy-D-arabinose-heptulosonate 7-phosphate synthase gene; and the DAHP pathway 2 expresses a transketolase gene, a 3-deoxy-D-arabinose-heptulosonate 7-phosphate synthase gene, a transaldolase gene and a 3-phosphoglyceraldehyde dehydrogenase gene. 2.A genetically engineered bacterium for synthesizing protocatechuic acid, characterized in that, the genetically engineered bacterium is a recombinant Corynebacterium glutamicum comprising a shikimic acid pathway or a DAHP pathway, and the recombinant Corynebacterium glutamicum is based on Corynebacterium glutamicum ATCC13032; or the genetically engineered bacterium is a recombinant Corynebacterium glutamicum comprising a shikimic acid pathway or a DAHP pathway, and the recombinant Corynebacterium glutamicum is based on Corynebacterium glutamicum ATCC13032 and is modified by a chassis microorganism; wherein the chassis microorganism is modified by knocking out a pcaHG gene of Corynebacterium glutamicum ATCC13032 as a starting strain; the shikimic acid pathway expresses a 3-dehydroquinate synthase gene, a 3-dehydroquinate dehydratase gene and a 3-dehydroshikimate dehydratase gene. The transketolase gene is derived from Escherichia coli (E. coli) The exogenous transketolase gene of K12, the nucleotide sequence of which is shown in SEQ ID NO.16; the DAHP pathway is DAHP pathway 1 or DAHP pathway 2; the DAHP pathway 1 expresses a transketolase gene and a 3-deoxy-7-phosphoheptulonate synthase gene; the DAHP pathway 2 expresses a transketolase gene, a 3-deoxy-7-phosphoheptulonate synthase gene, a transaldolase gene and a 3-phosphoglyceraldehyde dehydrogenase gene; the 3-dehydroquinate synthase gene is an endogenous C. glutamicum 3-dehydroquinate synthase gene, and the nucleotide sequence thereof is shown as SEQ ID NO. 1; the 3-dehydroquinate dehydratase gene is an endogenous C. glutamicum 3-dehydroquinate dehydratase gene, and the nucleotide sequence thereof is shown as SEQ ID NO. 2; the 3-dehydroshikimate dehydratase gene is an endogenous C. glutamicum 3-dehydroshikimate dehydratase gene, and the nucleotide sequence thereof is shown as SEQ ID NO. 3; The transketolase gene is an exogenous transketolase gene derived from Escherichia coli (E. coli) K12, and the nucleotide sequence of the transketolase gene is shown as SEQ ID NO.
16. Escherichia coli ) K12, and the nucleotide sequence of the transketolase gene is shown as SEQ ID NO.
16. the 3-deoxy-7-phosphoheptulonate synthase gene is an exogenous 3-deoxy-7-phosphoheptulonate synthase gene derived from E. coli K12, and the nucleotide sequence thereof is shown as SEQ ID NO. 17; the transaldolase gene is an endogenous C. glutamicum transaldolase gene, and the nucleotide sequence thereof is shown as SEQ ID NO. 43; the 3-phosphoglyceraldehyde dehydrogenase gene is an endogenous C. glutamicum 3-phosphoglyceraldehyde dehydrogenase gene, and the nucleotide sequence thereof is shown as SEQ ID NO.
44.
3. The genetically engineered bacterium for synthesizing protocatechuic acid according to claim 1, wherein further comprising a 4-HBA pathway; the 4-HBA pathway expresses a chorismate pyruvate lyase gene and a 4-hydroxybenzoic acid hydroxylase gene; the chorismate pyruvate lyase gene is a gene derived from E. coli K12 or a gene derived from E. coli K12 and codon-optimized; the nucleotide sequence of the chorismate pyruvate lyase gene derived from E. coli K12 is shown as SEQ ID NO. 55; the nucleotide sequence of the chorismate pyruvate lyase gene derived from E. coli K12 and codon-optimized is shown as SEQ ID NO. 63; the 4-hydroxybenzoic acid hydroxylase gene is an endogenous C. glutamicum 4-hydroxybenzoic acid hydroxylase gene or an exogenous 4-hydroxybenzoic acid hydroxylase gene; the nucleotide sequence of the endogenous C. glutamicum 4-hydroxybenzoic acid hydroxylase gene is shown as SEQ ID NO. 71; The exogenous 4-hydroxybenzoic acid hydroxylase gene is a gene derived from Pseudomonas aeruginosa (ATCC 10145) or a gene derived from Pseudomonas aeruginosa and codon-optimized; Pseudomonas aeruginosa the nucleotide sequence of the 4-hydroxybenzoic acid hydroxylase gene derived from P. aeruginosa is shown as SEQ ID NO. 56; the nucleotide sequence of the 4-hydroxybenzoic acid hydroxylase gene derived from P. aeruginosa and codon-optimized is shown as SEQ ID NO.
64.
4. The method for constructing a genetically engineered bacteria for synthesizing proto-catechuic acid according to any one of claims 1 to 3, characterized in that, comprising the following steps: (1) taking C. glutamicum ATCC13032 as a starting strain, knocking out the pcaHG gene to obtain a modified C. glutamicum; (2) expressing the shikimic acid pathway-related genes, DAHP pathway-related genes described in claim 1 or 2; or the shikimic acid pathway-related genes, DAHP pathway-related genes and 4-HBA pathway-related genes described in claim 3 in the original strain or the modified Corynebacterium glutamicum.
5. Use of the genetically engineered bacteria of any one of claims 1-3 or the genetically engineered bacteria constructed by the method of claim 4 in the production of protocatechuic acid.
6. Use of the genetically engineered bacteria of any one of claims 1-3 or the genetically engineered bacteria constructed by the method of claim 4 in the production of protocatechuic acid to increase the yield of protocatechuic acid.
7. A method for producing protocatechuic acid, characterized by, Fermentation using the genetically engineered bacteria of any one of claims 1-3 or the genetically engineered bacteria constructed by the method of claim 4.
Citation Information
Patent Citations
Genetically engineered bacterium for de novo synthesis of cis, cis-muconic acid by taking glucose as substrate and application of genetically engineered bacterium
CN117004547A
Genetically engineered bacterium for synthesizing protocatechuic acid, construction method and application
CN117511832A