Polypeptide with xylanase and arabinofuranosidase activity and application thereof

Abstract

The present invention discloses a polypeptide having xylanase and arabinofuranosidase activity, the polypeptide having an amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared thereto, or an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 2, the polypeptide having xylanase activity and arabinofuranosidase activity. The polypeptide can hydrolyze β-1,4-glycosidic bonds and α-L-arabinosidic bonds, has a wide pH tolerance range and good thermal stability, and is suitable for industrial applications in industries such as papermaking, feed, food, and bioenergy manufacturing.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a polypeptide with bifunctional xylanase and arabinofuranosidase activities, and application thereof. Background Art

[0002] Xylan is a structural non-starch polysaccharide in plant cell walls. It consists of a main chain of stable β-D-pyranose xylose residues connected by β-1,4 glycosidic bonds, and is composed of complex side chains such as α-L-arabinose, acetylmannose and 4-O-methyl aD-glucuronic acid. The substituents on the side chains determine that xylan is difficult to degrade and has a high viscosity. In natural plant cell walls, xylan is cross-linked with cellulose, lignin, etc., and they wrap around each other to form a complex spatial structure. Therefore, xylan is difficult to degrade in nature and in the animal digestive tract.

[0003] Xylanase refers to a complex enzyme system that can effectively degrade non-starch polysaccharides or xylan into xylose and oligoxylose. Xylanase is widely used in the papermaking, food, feed and other industries. In the papermaking industry, xylanase can increase the whiteness of paper, enhance the strength of pulp, improve pulping performance, and reduce energy consumption; in the food industry, xylanase can decompose insoluble arabinoxylan, increase the ductility, water retention and elasticity of dough; in the feed industry, xylanase can eliminate the anti-nutritional effects of xylan in feed, reduce intestinal chyme viscosity, destroy plant cell walls, release nutrients wrapped by cell walls, hydrolyze xylan into prebiotic oligoxylose, and improve animal intestinal health.

[0004] Therefore, the development of new xylanases is of great significance to industries such as papermaking, food, and feed. Summary of the invention

[0005] The present invention discloses a bifunctional xylanase and arabinofuranosidase encoding gene and a xylanase / arabinofuranosidase expressed thereby, which is suitable for industrial application in industries such as papermaking, feed, food, and bioenergy manufacturing.

[0006] According to one aspect of the present disclosure, a polypeptide is provided, which has an amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence with one or several amino acids substituted, deleted or added thereto, or an amino acid sequence with at least 95%, at least 98%, at least 99% or at least 100% sequence identity with SEQ ID NO: 2, and the polypeptide has xylanase activity and arabinofuranosidase activity.

[0007] According to another aspect of the present disclosure, an isolated nucleic acid molecule is provided, wherein the nucleic acid molecule encodes the polypeptide described in the present disclosure.

[0008] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 1, or a nucleotide sequence having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 100% sequence identity to SEQ ID NO: 1.

[0009] According to yet another aspect of the present disclosure, an expression vector is provided, wherein the expression vector comprises the isolated nucleic acid molecule described in the present disclosure.

[0010] According to another aspect of the present disclosure, a host cell is provided, wherein the host cell comprises the isolated nucleic acid molecule or the expression vector described in the present disclosure, or expresses the polypeptide described in the present disclosure.

[0011] According to another aspect of the present disclosure, a method for preparing the polypeptide of the present disclosure is provided, the preparation method comprising: culturing the host cell of the present disclosure, and isolating the polypeptide of the present disclosure from the culture of the host cell.

[0012] In some embodiments, the preparation method comprises the following steps:

[0013] (1) cloning the coding sequence of the polypeptide described in the present disclosure (SEQ ID NO: 1) into a plasmid to construct a recombinant plasmid;

[0014] (2) Genetically engineered bacteria are obtained by introducing the recombinant plasmid into host cells;

[0015] (3) Expanding and inducing the expression of the genetically engineered strain containing the recombinant plasmid to produce the polypeptide described in the present disclosure (amino acid sequence as shown in SEQ ID NO: 2), and purifying the protein using a nickel column.

[0016] In some embodiments, the host cell is Escherichia coli. In some embodiments, the competent cells of Escherichia coli are prepared using the calcium chloride method.

[0017] In some embodiments, BL21(DE3) strain is used as a host cell for expressing xylanase, and IPTG is used to induce expression in the BL21(DE3) strain containing the transformant.

[0018] In some embodiments, a TOP10 strain is used for plasmid cloning (e.g., pET28a), and the polypeptide encoding gene is connected to pET28a and then transferred into TOP10 competent cells. Positive transformants are screened using LB screening medium containing kanamycin, and the recombinant plasmid is extracted after identification.

[0019] In some embodiments, a Poly-His tag is selected for protein purification, and six His residues are used as protein tags at the amino acid termini of the polypeptide to facilitate protein purification using a nickel column.

[0020] According to another aspect of the present disclosure, a composition is provided, comprising the polypeptide of the present disclosure or the culture of the host cell, and a vector.

[0021] In some embodiments, the carrier comprises a carrier acceptable for papermaking, medicine, food or feed.

[0022] According to another aspect of the present disclosure, provided is the use of the polypeptide of the present disclosure as xylanase and / or arabinofuranosidase.

[0023] In some embodiments, the polypeptide acts as a xylanase for hydrolyzing xylan.

[0024] In some embodiments, the xylanase activity is 340.10 U / mg at the optimal conditions of pH 6.0 and 55°C.

[0025] In some embodiments, the polypeptide acts as an arabinofuranosidase for hydrolyzing arabinofuranoside.

[0026] In some embodiments, the arabinofuranosidase activity is 637.10 U / mg at the optimal conditions of pH 7.0 and 35°C.

[0027] In some embodiments, the polypeptide has good tolerance as xylanase and / or arabinofuranosidase between pH 4.0-10.0, and the enzyme activity is maintained above 80% after being kept at 50° C. for 60 min, and has good thermal stability.

[0028] According to another aspect of the present disclosure, provided is the use of the polypeptide, the isolated nucleic acid molecule, the expression vector, the host cell or the composition described in the present disclosure in papermaking, medicine, food or feed production.

[0029] In some embodiments, the polypeptide or the composition is used as a feed additive or a food additive.

[0030] According to another aspect of the present disclosure, a method for hydrolyzing xylan is provided, comprising reacting a substrate containing xylan with the polypeptide, the host cell or the composition of the present disclosure.

[0031] In some embodiments, the pH value of the reaction is 4-10, for example, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10 or any value therebetween. In some preferred embodiments, the pH value of the reaction is 5-10.

[0032] In some embodiments, the reaction temperature is 20-80°C, for example, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C or any value therebetween. In some preferred embodiments, the reaction temperature is 40-65°C.

[0033] According to another aspect of the present disclosure, a method for hydrolyzing arabinofuranoside is provided, the method comprising reacting a substrate containing arabinofuranoside with the polypeptide, the host cell or the composition of the present disclosure.

[0034] In some embodiments, the pH value of the reaction is 4-8.5, for example, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 or any value therebetween. In some preferred embodiments, the pH value of the reaction is 5-6.5.

[0035] In some embodiments, the reaction temperature is 20-80°C, for example, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C or any value therebetween. In some preferred embodiments, the reaction temperature is 20-45°C.

[0036] The present invention discloses a bifunctional xylanase / arabinofuranosidase gene obtained based on metagenomic technology, and a bifunctional enzyme capable of hydrolyzing β-1,4-glycosidic bonds and α-L-arabinosidic bonds is obtained through heterologous expression. The bifunctional enzyme has a wide pH tolerance range and good thermal stability, and has broad application prospects in industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the electrophoresis diagram of the recombinant E. coli plasmid gene sequence. Lane M is TakaraDL5000 Marker, and lanes P1 and P2 are two positive clones.

[0038] Figure 2 The figure is the SDS-PAGE electrophoresis of the purified product of xylanase / arabinofuranosidase. Lane M is the electrophoresis result of protein marker, and lanes 1 and 2 are xylanase / arabinofuranosidase and its purified product, respectively.

[0039] Figure 3This is the optimum pH for xylanase / arabinofuranosidase.

[0040] Figure 4 pH stability of xylanase / arabinofuranosidase.

[0041] Figure 5 is the optimum temperature for xylanase / arabinofuranosidase.

[0042] Figure 6 Temperature stability of xylanase / arabinofuranosidase.

[0043] Figure 7 Effect of metal ions on the enzymatic activity of xylanase / arabinofuranosidase. DETAILED DESCRIPTION

[0044] Xylanase refers to a complex enzyme system that can effectively degrade non-starch polysaccharides or xylan into xylose and oligoxylose, mainly including β-1,4-endo-xylanase (EC 3.2.1.8), β-D-xylosidase (EC 3.2.1.37), α-L-arabinosidase (EC 3.2.1.55), α-D-glucuronidase (EC 3.2.1.139), acetyl xylanase (EC3.1.1.72), and phenolic acid esterase (EC 3.1.1-). The degradation of xylan requires the synergistic effect of multiple enzymes. Among them, one of the key enzymes of xylan is β-1,4-endo-xylanase, referred to as xylanase, which produces a variety of xylooligosaccharides, xylobiose, and some small amounts of xylose by randomly cutting the β-1,4-glycosidic bonds in the main chain. β-D-xylosidase mainly decomposes xylooligosaccharides and xylobiose into xylose from the non-reducing end. Xylanases other than the above two enzymes act on different groups on the xylan side chains. α-L-arabinosidase can hydrolyze non-reducing furanose arabinose residues on the xylan side chains. α-D-glucuronidase mainly acts on the α-1,2-glycosidic bond between 4-O-methyl glucuronic acid and xylose. Acetylxylan esterase mainly acts on the acetyl groups of C-2 and C-3 of xylose residues. There are two main types of phenolic acid esterases: ferulic acid esterase and coumaric acid esterase. The first enzyme mainly breaks the ester bond between ferulic acid and arabinose residues, and the other enzyme mainly hydrolyzes the ester bond between coumaric acid and arabinose residues.

[0045] Metagenome, also known as microbial environmental genome or metagenome, has the advantage of avoiding traditional pure culture and obtaining all the genetic information of uncultured microorganisms in the environment, so as to analyze the genetic information of microorganisms and screen their functional genes. Through the analysis of metagenomic data and the screening of metagenomic libraries, a large number of uncultured microorganisms and their functional genes in extreme environments are more easily mined.

[0046] The present disclosure provides a bifunctional xylanase / arabinofuranosidase encoding gene from a metagenomic source and a method for its efficient expression and product separation and purification. The present disclosure cloned a xylanase gene from a hot spring metagenomic library, and the product expressed by the gene in Escherichia coli can hydrolyze xylan and p-nitrophenol acetate. After the expressed crude enzyme was purified, the xylanase activity was 340.10 U / mg at the optimal conditions of pH 6.0 and 55°C, and the arabinofuranosidase activity was 637.10 U / mg at 35°C. Studies on the enzymatic properties found that the enzyme had good tolerance between pH 4.0-10.0, and the enzyme activity remained above 80% after being kept at 50°C for 60 min. The enzyme has a wide pH adaptability range and good thermal stability, which can well meet the needs of industrial production.

[0047] definition

[0048] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0049] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0050] The term "about" as used herein refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0051] The terms "polypeptide", "protein" and "peptide" are intended to mean a polymer of amino acid residues comprising at least nine amino acids joined by peptide bonds. The polymer may be linear, branched or cyclic. The polymer may comprise natural amino acids and / or amino acid analogs, and it may be interrupted by non-amino acid residues.

[0052] The term "nucleic acid molecule" is intended to mean a polymer of deoxyribonucleic acid (DNA) or polydeoxyribonucleotides of any length, particularly including complementary DNA or cDNA, genomic DNA, plasmids, vectors, viral genomes, isolated DNA, probes, primers and any mixture thereof; or a polymer of ribonucleic acid (RNA) or polyribonucleotides of any length, particularly including messenger RNA or mRNA, antisense RNA; or mixed polyribo-polydeoxyribonucleotides. They encompass single-stranded or double-stranded, linear or circular, and natural or synthetic polynucleotides. In addition, polynucleotides may contain non-natural nucleotides and may be interrupted by non-nucleotide components.

[0053] The term "vector" is intended to mean a carrier, preferably a nucleic acid molecule or a viral particle, which comprises the elements necessary to enable one or more nucleic acid molecules to be administered to a host cell or organism, propagated in a host cell or organism, and / or expressed in a host cell or organism. In the context of the present invention, the term "vector" should be understood in a broad sense, including both plasmid vectors (or plasmids) and viral vectors.

[0054] As used herein, "plasmid" means a replicable DNA construct. Typically, a plasmid vector comprises a selective marker gene that allows identification and / or selection of a host cell carrying the plasmid as positive or negative in the presence of a compound corresponding to the selective marker. A variety of positive and negative selective marker genes are known in the art. By way of illustration, an antibiotic resistance gene can be used as a positive selective marker gene to select a host cell in the presence of a corresponding antibiotic.

[0055] The term "host cell" is intended to mean a cell comprising a nucleic acid molecule according to the present invention. Advantageously again, the host cell is capable of expressing a polypeptide having polyketide synthase activity and / or a vector of the present invention. Advantageously, the host cell is capable of synthesizing avermectin B1a. The host cell may be composed of a single type of cell or a group of different types of cells. The host cell may also be a hybrid cell, that is, a cell produced by the fusion of at least two different types of cells. The host cell may belong to a cultured cell line, a primary cell, a stem cell or a proliferating cell. The "host cell" according to the present invention is a recombinant host cell, that is, a cell that accommodates exogenous genetic material. Therefore, the host cell is not a naturally occurring wild-type cell, but a molecular biology tool obtained by genetic manipulation techniques.

[0056] "Percent (%) sequence identity" relative to a reference amino acid sequence refers to the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in the reference amino acid sequence, after aligning the sequences and introducing gaps (if necessary) to obtain maximum percent sequence identity, but without considering any conservative substitutions as part of the sequence identity. To determine the percent amino acid sequence identity, alignments can be performed in various ways within the scope of the art, such as using BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm required to achieve maximum alignment over the full length of the compared sequences.

[0057] The present disclosure also relates to amino acid sequence variants, which can be prepared by introducing appropriate modifications into the nucleotide sequence encoding the molecule or by peptide synthesis. Such modifications include, for example, deletions, insertions and / or substitutions of residues in the antibody amino acid sequence. Any combination of deletions, insertions and substitutions can be performed to obtain a final construct having the desired properties, such as antigen binding activity. Sites for substitution generally include HVR and framework (FR). Possible substitutions of amino acids include, but are not limited to: conservative substitutions of Ala (A) include Val, Leu, Ile, preferably conservative substitutions to Val; conservative substitutions of Arg (R) include Lys, Gln, Asn, preferably conservative substitutions to Lys; conservative substitutions of Asn (N) include Gln, His, Asp, Lys, Arg, preferably conservative substitutions to Gln; conservative substitutions of Asp (D) include Glu, Asn, preferably conservative substitutions to Glu; conservative substitutions of Cys (C) include S The conservative substitutions of Gln (Q) include Asn and Glu, and the conservative substitutions of Gln (E) include Asp and Gln, and the conservative substitutions of Gly (G) include Ala; the conservative substitutions of His (H) include Asn, Gln, Lys, Arg, and the conservative substitutions of Ile (I) include Leu, Val, Met, Ala, Phe, Nle, and the conservative substitutions of Ile (I) include Leu, Val, Met, Ala, Phe, Nle, and the conservative substitutions of Ile (I) include Leu, Val, Met, Ala, Phe, Nle, and the conservative substitutions of Ile (I) include Leu, Val, Met, Ala, Phe, Nle, and the conservative substitutions of Ile (I) include Leu, Val, Met, Ala, Phe, Nle, and the conservative substitutions of Ile (I) include Asp and Gln, and the conservative substitutions of Gly (G) include Ala; the conservative substitutions of His (H) include Asn, Gln, Lys, Arg ... Asp and Gln, and the conservative substitutions of Gly (G) include Conservative substitutions are Leu; conservative substitutions of Leu (L) include Nle, Ile, Val, Met, Ala, Phe, preferably conservative substitutions are Ile; conservative substitutions of Lys (K) include Arg, Gln, Asn, preferably conservative substitutions are Arg; conservative substitutions of Met (M) include Leu, Phe, Ile, preferably conservative substitutions are Leu; conservative substitutions of Phe (F) include Trp, Leu, Val, Ile, Ala, Tyr; Tyr; conservative substitutions of Pro (P ... Pro (P) include Arg, Gln, Asn, preferably conservative substitutions are Arg; conservative substitutions of Met (M) include Leu, Phe, Ile, preferably conservative substitutions are Leu; conservative substitutions of Pro (P) include Arg, Gln, Asn, preferably Arg; conservative substitutions of Met (M) include Leu, Phe, Ile, preferably Leu; conservative substitutions of Pro (P) include Arg, Gln, Asn, preferably Arg; conservative substitutions of Met (M) include Leu, Phe, Ile, preferably Leu; conservative substitutions of Pro (P) include Arg Conservative substitutions include Ala; conservative substitutions of Ser (S) include Thr; conservative substitutions of Thr (T) include Val and Ser, and preferably conservative substitutions are Ser; conservative substitutions of Trp (W) include Tyr and Phe, and preferably conservative substitutions are Tyr; conservative substitutions of Tyr (Y) include Trp, Phe, Thr, Ser, and preferably conservative substitutions are Phe; conservative substitutions of Val (V) include Ile, Leu, Met, Phe, Ala, Nle, and preferably conservative substitutions are Leu.

[0058] The term "enzyme activity" or "catalytic activity" or "activity" is intended to indicate the efficiency of an enzyme in converting a substrate into a product in a given environment. The efficiency of an enzyme herein takes into account both the rate at which the enzyme converts a substrate into a product and the extent to which the enzyme converts a substrate into a product. The expression "the extent to which an enzyme converts a substrate into a product" is intended herein to indicate the ratio between the amount of final product obtained relative to the initial amount of substrate for a defined amount of enzyme.

[0059] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0060] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0061] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0062] Example 1: Bioinformatics analysis of xylanase genes

[0063] By analyzing the metagenome of hot spring microorganisms originating from 42-90℃ (from the JGI-IMG Microbial Functional Genomics Database), a 2031 bp sequence containing the gene xyl61 encoding the complete GH62 (arabinofuranosidase) and GH10 (xylanase) was screened out and handed over to Shanghai Sangon Biotechnology Co., Ltd. to synthesize the gene sequence.

[0064] Example 2: Expression of bifunctional xylanase / arabinofuranosidase gene in Escherichia coli xyl61

[0065] 1. Construction of recombinant expression vector in host Escherichia coli

[0066] The xyl61 gene (SEQ ID NO: 1, the corresponding amino acid sequence is shown in SEQ ID NO: 2) and the pET28a vector were connected by homologous recombination. The forward primer used was CAGCAAATGGGTCGCGGATCCAAAGCGCCGTTTGAAACCC (SEQ ID NO: 3), and the reverse primer was GTGGTGGTGGTGGTGCTCGAGTTTCTGTTCGCGAACCACG (SEQ ID NO: 4). The pET28a vector was linearized with the restriction endonuclease BamH1. xyl61The PCR product and linearized vector were recombined with the ClonExpress Ultra OneStep Cloning Kit V2 to obtain the expression vector pET28a- xyl61 The amino acid terminus of the expression product carries a His tag (6×His-Tag) provided by the expression vector to facilitate subsequent purification.

[0067] 2. Transformation and expression verification of xyl61 gene in Escherichia coli

[0068] The recombinant plasmid pET28a- xyl61 Convert into E. coli TOP10 competent cells. Plasmids were extracted from colonies grown on LB plates containing kanamycin, and PCR amplification of the template was performed using primers SEQ ID NO: 3 / SEQ ID NO: 4 to identify positive clones. The results are shown in Figure 1 As shown, the target fragments were amplified in strains P1 and P2, proving that they were positive clones.

[0069] 3. Expression of xyl61 gene in E. coli and purification of expression product

[0070] The positive clone Escherichia coli P1 was inoculated into LB medium containing kanamycin, and the plasmid was extracted after overnight culture. The recombinant plasmid was transferred into E. coli In BL21(DE3) competent cells, pick a single colony of the recombinant on the kanamycin-resistant plate and transfer it to 5 mL of LB liquid medium containing kanamycin, and culture it at 37°C, 200 rpm overnight. Take 1 mL of the culture medium and transfer it to 100 mL of LB culture medium containing kanamycin, and culture it at 37°C, 200 rpm until the OD 600 When the pH was 0.6-0.8, IPTG was added to a final concentration of 500 μM, and the culture was continued at 28°C and 150 rpm for 12 h. The cells were then collected by centrifugation at 4°C (8000 rpm, 10 min).

[0071] The collected bacteria were washed three times with pre-cooled PBS, and then an appropriate amount of binding buffer (binding buffer: 20mmol / LPB, 500mmol / L NaCl, 5mmol / L imidazole pH7.4) was added, and phenylmethylsulfonyl fluoride (PMSF) was added to a final concentration of 1mM. The cells were disrupted with an ultrasonic disruptor in ice water, and the lysate was centrifuged at 4°C (12000×g, 20 min) to obtain the supernatant, which was the crude xylanase solution.

[0072] The crude enzyme solution was purified using the Shanghai Biotech Ni-IDA 6FFHis tag protein purification kit and washed with imidazole elution solution. The elution solution formula is as follows: 20 mmol / L PB, 500 mmol / L NaCl, 150 mmol / L imidazole, pH 7.4.

[0073] The results of SDS-PAGE electrophoresis of crude enzyme solution and purified enzyme are shown in Figure 2 As shown. Figure 2 It can be seen that the electrophoresis result is a single band when eluted with 150 mM imidazole eluent, indicating that high-purity Xyl61 target protein can be obtained under this condition. All eluates containing the target protein were combined, concentrated and dialyzed with a 10 kDa ultrafiltration tube (Merck, Millipore, USA), and the buffer was replaced with 20 mM NaH2PO4 with a pH of 7.4 to remove the imidazole in the enzyme solution and obtain the purified recombinant enzyme.

[0074] Example 3: Analysis of the zymological properties of recombinant Xyl61 protein

[0075] 1. Determination of xylanase activity

[0076] The dinitrosalicylic acid method (DNS method) was used to determine the enzymatic activity of xylanase.

[0077] Standard enzyme activity determination method: In a 100 μL reaction system, containing 1% beechwood xylan and 100 mM citric acid-sodium hydrogen phosphate buffer, add an appropriate amount of enzyme solution diluted with the buffer (the final concentration of the enzyme is 0.01 mg / mL) and react at 55°C for 30 min. Then add 200 μL DNS reagent (purchased from Solarbio) to terminate the reaction. After reacting in a 95°C water bath for 5 min, add 700 μL distilled water, and draw 200 μL to add to the ELISA plate to measure the absorbance at 540 nm (use the inactivated enzyme solution as a blank control). After subtracting the control from the sample measurement value, the enzyme activity unit (U) is calculated using the standard curve.

[0078] Definition of enzyme activity unit (U): 1 U is the amount of enzyme required to catalyze the hydrolysis of xylan to produce 1 μmol of reducing sugar per minute.

[0079] Definition of specific activity unit: enzyme activity per milligram of protein (U / mg).

[0080] The results showed that the specific activity of the recombinant enzyme was 340.10 U / mg at the optimal conditions of pH 6.0 and 55℃.

[0081] 2. Arabinofuranosidase activity assay

[0082] 25 μL of 5 mmol / L p-nitrophenyl-α-l-arabinofuranoside (pNPA) was mixed with 50 μL of pH 7.0 citric acid-sodium hydrogen phosphate buffer, preheated at 37°C for 5 min, and 25 μL of the recombinant enzyme prepared in Example 2 diluted appropriately (the final concentration of the enzyme was 0.01 mg / mL) was added. After reacting at 35°C for 15 min, 100 μL of 1 mol / L Na2CO3 was used to terminate the reaction and develop color. After standing for 10 min, the absorbance of the reaction product p-nitrophenol (pNP) at 405 nm was measured.

[0083] Definition of enzyme activity unit (U): 1 U is the amount of enzyme required to hydrolyze 1 umol of pNP per minute.

[0084] Definition of specific activity unit: enzyme activity per milligram of protein (U / mg).

[0085] The results showed that the specific activity of the recombinant enzyme was 637.10 U / mg at the optimal conditions of pH 6.0 and 35℃.

[0086] 3. Determination of optimum pH and pH stability

[0087] (1) Determination of optimal pH

[0088] The recombinant enzyme prepared in Example 2 was used to treat xylan and p-nitrophenol acetate under different pH conditions. The pH corresponding to the highest enzyme activity was the optimal pH of the enzyme.

[0089] The optimum pH of the recombinant enzyme was determined in the range of 2-10, with a gradient of 0.5. The buffer pairs used were as follows: glycine-hydrochloric acid buffer (pH 2.0-3.5), citric acid-disodium hydrogen phosphate buffer (pH 4.0-8.0), and glycine-sodium hydroxide buffer (pH 8.5-10.0). The reaction was carried out and the enzymatic activities of xylanase and arabinofuranosidase were determined in the same manner as in 1 and 2 above, except that only the pH of the reaction was changed. The highest enzyme activity was defined as 100%, and the relative activities under other conditions were calculated (repeated three times).

[0090] Figure 3 The results showed that the optimal pH of the recombinant enzyme was 6.

[0091] (2) pH stability analysis

[0092] The recombinant enzyme prepared in Example 2 was allowed to stand at 4°C for 1 h at different pH values, and then the substrate was added for reaction. The enzymatic activities of xylanase and arabinofuranosidase were measured at the optimal pH value.

[0093] pH stability determination: The enzyme solution was allowed to stand at 4°C for 1 h at the corresponding pH, and then the enzyme solution was added to the substrate for reaction at the optimal pH. The other reaction conditions were the same as those in 1 and 2 above. The reaction was terminated and the enzyme activities of xylanase and arabinofuranosidase were determined in the same manner as in 1 and 2 above. The highest enzyme activity was defined as 100%, and the relative activities under other conditions were calculated (repeated three times).

[0094] Figure 4 The results showed that the recombinant enzyme had a wide pH tolerance range.

[0095] 4. Determination of optimum temperature and thermal stability

[0096] (1) Determination of optimum temperature

[0097] The recombinant enzyme prepared in Example 2 was used to treat xylan and p-nitrophenol acetate under different temperature conditions. The temperature corresponding to the highest enzyme activity was the optimal temperature of the enzyme.

[0098] The optimum temperature range of the recombinant enzyme is set at 20-80°C, with a temperature gradient of 5°C. The optimum temperature determination method is: first keep the enzyme solution at different temperatures for 5 minutes, then add the reaction substrate and mix quickly, and then react at the corresponding temperature. The other reaction conditions are the same as those in 1 and 2 above. Then, terminate the reaction and determine the mass of the product in the same way as in 1 and 2 above, and calculate the enzyme activity.

[0099] Figure 5 The results showed that the optimum temperature for xylanase was 55°C and that for arabinofuranosidase was 35°C.

[0100] (2) Temperature stability analysis

[0101] The recombinant enzyme prepared in Example 2 was incubated at different temperatures for 1 h, and then the reaction substrate was added, and the enzyme activity was measured at the optimal temperature.

[0102] The temperature stability test was carried out at 40-80°C. The enzyme solution was kept at different temperatures for 1 h, and then the enzyme solution was added to the reaction substrate to react at the optimal temperature. The other reaction conditions were the same as those in 1 and 2 above. Then the reaction was terminated in the same way as in 1 and 2 above, and the enzyme activities of xylanase and arabinofuranosidase were determined. The highest enzyme activity was defined as 100%, and the relative activity under other conditions was calculated (repeated three times).

[0103] Figure 6 The results showed that the recombinant enzyme had good thermal stability.

[0104] 5. Effect of metal ions on enzyme activity

[0105] The enzyme solution and different concentrations of metal ions were placed at 4°C for 30 min, and then reacted at the optimal temperature and optimal pH. After the reaction was terminated, the enzyme activity was measured and the highest enzyme activity was defined as 100%, and the relative activity under other conditions was calculated.

[0106] Prepare 10 mM different metal ion solutions with pH 6.0 phosphate buffer, mix the enzyme solution and the metal ion solution in equal proportions, react under the optimal conditions (following the same method as 1 and 2 above), and use the enzyme solution diluted with PBS as a blank control to determine the enzyme activity. The highest enzyme activity is defined as 100%, and the relative activity under other conditions is calculated (repeated three times).

[0107] Figure 7 The results showed that the recombinant enzyme had strong tolerance to different metal ions.

[0108] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Use of a polypeptide having an amino acid sequence as shown in SEQ ID NO: 2 as a xylanase and / or an arabinofuranosidase.

2. The use according to claim 1, characterized in that: The polypeptide is used for hydrolyzing xylan and / or arabinofuranoside.

3. Use of the polypeptide having an amino acid sequence as shown in SEQ ID NO: 2 or a host cell expressing the polypeptide having an amino acid sequence as shown in SEQ ID NO: 2 as xylanase and / or arabinofuranosidase in papermaking, medicine, food and feed production.

4. A method for hydrolyzing xylan, the method comprising reacting a substrate containing xylan with a polypeptide having an amino acid sequence as shown in SEQ ID NO: 2, or a host cell expressing the polypeptide having an amino acid sequence as shown in SEQ ID NO: 2; The pH value of the reaction is 4-10; the temperature of the reaction is 20-55°C.

5. The method according to claim 4, characterized in that The pH value of the reaction is 5-10; the temperature of the reaction is 40-55°C.

6. The method according to claim 4, characterized in that The pH value of the reaction was 6.0; the temperature of the reaction was 55°C.

7. A method for hydrolyzing arabinofuranoside, the method comprising reacting a substrate containing arabinofuranoside with a polypeptide having an amino acid sequence as shown in SEQ ID NO: 2, or a host cell expressing the polypeptide having an amino acid sequence as shown in SEQ ID NO: 2; The pH value of the reaction is 4-8.5; the temperature of the reaction is 20-80°C.

8. The method according to claim 7, characterized in that The pH value of the reaction is 5-6.5; the temperature of the reaction is 20-45°C.

9. The method according to claim 7, characterized in that: The pH value of the reaction was 6.0; the temperature of the reaction was 35°C.

Images