MiR5513 for regulating plant seed grain shape and sheath blight resistance and application thereof

Abstract

The application discloses miR5513 for regulating plant seed grain shape and sheath blight resistance and application thereof, and relates to the technical field of botany and gene engineering. The application provides miR5513 and / or a precursor thereof capable of regulating the seed grain shape and sheath blight resistance of a plant in the family Poaceae, and by regulating (for example, down-regulating / knocking out) the expression of the miRNA or the precursor thereof, the seed grain length and width can be increased, and the seed yield of the plant in the family Poaceae is improved; the sheath blight resistance of the plant in the family Poaceae is also improved; and the application has a very wide application prospect in the cultivation of the transgenic plant in the family Poaceae.

Description

Technical Field

[0001] This invention relates to the fields of botany and genetic engineering, and in particular to miRNAs that regulate seed shape and resistance to sheath blight in plants and their applications. Background Technology

[0002] Among grasses, rice, wheat, corn, and sorghum are the most common and important food and economic crops for humans. Rice is a major food crop in my country and the world. Rice yield is closely related to grain shape; changes in grain shape affect rice yield. Therefore, research on rice grain shape and yield are often inseparable.

[0003] Sheath blight is a global disease caused by Rhizoctonia solani Kühn. This pathogen has a wide host range and high pathogenicity, severely impacting high and stable rice yields. Therefore, discovering sheath blight-resistant genes and breeding and cultivating resistant varieties are the most economical, safe, and effective control strategies for rice sheath blight, and are also an urgent need for resource-saving and environmentally friendly agricultural production.

[0004] MicroRNAs (miRNAs) are a class of small, non-coding RNAs, approximately 20-24 nucleotides in size, widely found in plants. They can bind to the complementary sequence of target gene mRNAs, regulating the expression level of target gene mRNAs by cleaving and degrading them or inhibiting their translation. This, in turn, allows them to regulate various biological functions of plants, such as growth and development, and resistance to pests and diseases.

[0005] Target mimicry technology utilizes the Arabidopsis gene IPS1 and modifies its miRNA-binding region sequence, replacing the segment complementary to miR399 with a segment complementary to the target gene to construct a mimic mutant, thereby silencing the corresponding miRNA. CRISPR / Cas9 technology is based on a modified bacterial acquired immune system. Its working principle is that crRNA (CRISPR-derived RNA) binds to tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA / crRNA complex. This complex guides the Cas9 protein to cleave double-stranded DNA at the target site paired with crRNA. Therefore, researchers artificially design crRNA and tracrRNA to create single guide RNA (sgRNA) to guide Cas9 to precisely cleave DNA, achieving gene knockout.

[0006] While there are many transgenic plant breeding technologies for grasses, no research has yet been found on transgenic technologies that target seed shape and sheath blight resistance in grasses. Summary of the Invention

[0007] This invention provides a miR5513 for regulating seed shape and sheath blight resistance in plants, and its application. The inventors discovered that by regulating the expression of miR5513 or its precursors in plants, it is possible to regulate plant traits (such as seed length, seed width, yield, and sheath blight resistance). This is specifically achieved through the following techniques.

[0008] In a first aspect, the present invention provides a nucleic acid molecule for regulating plant traits, selected from the nucleotide sequence of miR5513 or its precursor nucleotide sequence; the nucleotide sequence of miR5513 is shown in SEQ ID NO.1, and the sequence of the precursor of miR5513 is shown in SEQ ID NO.2;

[0009] The plant traits are: seed length; and / or seed width; and / or plant yield; and / or plant resistance to sheath blight.

[0010] A second aspect of the present invention provides the application of a method for regulating the expression of miR5513 or its precursor in regulating plant traits, thereby promoting an increase in seed length by downregulating / knocking out the expression of miR5513 or its precursor; and / or promoting an increase in seed width; and / or increasing plant yield; and / or increasing plant resistance to sheath blight.

[0011] The miR5513 sequence is shown in SEQ ID NO.1, and the sequence of the precursor of miR5513 is shown in SEQ ID NO.2.

[0012] A third aspect of the present invention provides an application of a method for regulating the expression of miR5513 or its precursor in the selection of transgenic plants with altered traits. By downregulating / knocking out the expression of miR5513, or by downregulating / knocking out the expression of the precursor of miR5513, transgenic plants that meet the criteria of increased seed length, and / or increased seed width, and / or increased plant yield, and / or enhanced resistance to sheath blight are selected.

[0013] The miR5513 sequence is shown in SEQ ID NO.1, and the sequence of the precursor of miR5513 is shown in SEQ ID NO.2.

[0014] In a fourth aspect, the present invention provides a method for regulating plant traits, which promotes seed length increase, and / or promotes seed width increase, and / or increases seed yield, and / or increases plant resistance to sheath blight by downregulating or knocking out the expression of miR5513 or its precursor in plants.

[0015] The miR5513 sequence is shown in SEQ ID NO.1, and the miR5513 precursor sequence is shown in SEQ ID NO.2.

[0016] Furthermore, methods for downregulating the expression of miR5513 or its precursor in plants include: constructing and utilizing miR5513 silencers to downregulate the expression of miR5513 or its precursor.

[0017] Furthermore, methods for downregulating the expression of miR5513 or its precursor in plants include: placing the mimicry miR5513 sequence into the IPS1 gene to obtain the ips-MIM5513 fragment sequence; and transferring the ips-MIM5513 fragment sequence into plants to obtain transgenic plants.

[0018] Furthermore, methods for knocking out miR5513 or its precursor sequence in plants include: constructing sgRNA expression cassettes of the sense and antisense strands of miR5513 based on CRISPR / Cas9 technology, and knocking out miR5513 or its precursor sequence.

[0019] In a fifth aspect, the present invention provides an application of miR5513 or its precursor as a molecular marker for identifying plant seed shape and resistance to sheath blight; seed shape includes seed length and / or seed width; the sequence of miR5513 is shown in SEQ ID NO.1, and the sequence of the precursor of miR5513 is shown in SEQ ID NO.2.

[0020] In a sixth aspect, the present invention provides the application of a downregulator of miR5513 or its precursor for improving plant traits, the improved plant traits including: promoting an increase in seed length, and / or promoting an increase in seed width, and / or increasing seed yield of the plant, and / or increasing resistance of the plant to sheath blight.

[0021] The sequence of miR5513 is shown in SEQ ID NO.1, and the sequence of the precursor of miR5513 is shown in SEQ ID NO.2; the downregulator is an interfering molecule that specifically downregulates the expression of miR5513 or its precursor, or a miR5513 silencing agent based on targetmimicry technology.

[0022] In a seventh aspect, the present invention provides a biomaterial containing a sequence fragment of ips-MIM5513, the nucleotide sequence of which is shown in SEQ ID NO.9; the biomaterial is used to transfer into plants to regulate plant traits, the plant traits being: seed length; and / or seed width; and / or plant yield; and / or plant resistance to sheath blight.

[0023] Furthermore, the biological material is an expression cassette, a vector, or a host cell.

[0024] The eighth aspect of the present invention provides the application of miR5513 or its precursor in the improvement of germplasm resources with altered plant traits, characterized in that the sequence of miR5513 is as shown in SEQ ID NO.1, and the sequence of the precursor of miR5513 is as shown in SEQ ID NO.2; the altered plant traits are: increased seed length, and / or increased seed width, and / or increased plant yield, and / or transgenic plants with enhanced resistance to sheath blight.

[0025] The inventors of this invention have discovered that by regulating the expression of miR5513 or its precursor, the seed shape and sheath blight resistance of gramineous plants can be correspondingly regulated and altered. Specifically, by downregulating / knocking out the expression of miR5513 or its precursor, seed length and width can be increased, thereby increasing seed yield in gramineous plants; it can also enhance the sheath blight resistance of gramineous plants. Currently, no one has discovered a correlation between the expression of miR5513 or its precursor and the seed shape and sheath blight resistance of gramineous plants.

[0026] To downregulate / knock out the expression of miR5513 or its precursor, this invention employs two techniques: target mimicry and CRISPR / Cas9. Target mimicry involves constructing corresponding mimic mutant materials to silence miR5513. CRISPR / Cas9 technology utilizes the sequence target site where the Cas9 protein pairs with crRNA to achieve miR5513 cleavage knockout.

[0027] As will be readily apparent to those skilled in the art, techniques for downregulating / knocking out the expression of miR5513 or its precursors include, but are not limited to, the aforementioned target mimicry techniques and CRISPR / Cas9 techniques. In addition, the same objective can be achieved through other gene editing methods commonly used in the field of genetic engineering.

[0028] Based on the same technical approach, those skilled in the art will readily recognize that the main gene editing steps in cultivating transgenic gramineous plants with improved seed shape or better resistance to sheath blight can also be carried out using the above method.

[0029] Compared with the prior art, the advantages of this invention are as follows: This invention provides a miR5513 or its precursor that can regulate the seed shape and sheath blight resistance of grass plants. By downregulating / knocking out the expression of miR5513 or its precursor, the expression of seed length and seed width can be increased, thereby improving the seed yield of grass plants. It can also improve the sheath blight resistance of grass plants. Based on the above findings, genetic engineering technology can be used to regulate the seed shape and sheath blight resistance of grass plants, which has a very broad application prospect in the scientific research and cultivation of grass plants. Attached Figure Description

[0030] Figure 1 The spectrum of the pBSK (pBluescript II SK(+)) vector.

[0031] Figure 2 A schematic diagram of the construction of the MIM5513 plasmid.

[0032] Figure 3 This is a map of the pCXUN vector.

[0033] Figure 4 A map of the CRISPR / Cas9 binary vector.

[0034] Figure 5 This is a map of the CRISPR / sgRNA vector. Among them, Figure 5 A represents the overall structure of the eight basic sgRNA intermediate vectors; Figure 5 B represents the Bsa I restriction site sequence in the 12 sgRNA vectors; Figure 5 C represents representative regular and irregular target sites, their target linkers to the OsU6a promoter, and the 5' sequence after transcription.

[0035] Figure 6 The miR5513 locus and expression level were identified in the mimicry transgenic plant (MIM5513) and the knockout plant (KO5513). Figure 6 A is a schematic diagram of the silent body of MIM5513; Figure 6 B represents the miR5513 knockout site (marked in red) in the miR5513 knockout plant (KO5513). Figure 6 C represents the miR5513 expression level in mimicry transgenic plants and knockout plants.

[0036] Figure 7 The seed shape and yield phenotypes of MIM5513 and KO5513 plants were analyzed. Figure 7 Both MIM5513 and KO5513 plants of type A showed increased grain width; Figure 7 Both MIM5513 and KO5513 plants of type B showed increased grain length; Figure 7 C is a statistical graph of grain width in MIM5513 and KO5513 plants; Figure 7 D is a statistical graph of grain length in MIM5513 and KO5513 plants; Figure 7 E is a statistical graph of the thousand-grain weight of MIM5513 and KO5513 plants; Figure 7 F is a statistical graph showing the yield per plant of MIM5513 and KO5513.

[0037] Figure 8 The resistance phenotypes of MIM5513 and KO5513 plants to sheath blight are shown. Figure 8 Both MIM5513 and KO5513 plants in group A showed resistance to sheath blight in their leaf sheaths. Figure 8 B is a statistical graph of the length of lesions in MIM5513 and KO5513 plants; Figure 8 Both MIM5513 and KO5513 plants in C showed resistance to sheath blight in their leaves. Figure 8 D is a statistical chart of the lesion area of ​​MIM5513 and KO5513 plants. Detailed Implementation

[0038] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0039] After extensive experimental research, including the following specific embodiments, this invention has found that miR5513 is closely related to seed traits, yield, and resistance to sheath blight in plants. Downregulating (silencing) or knocking out miR5513 can increase seed length and width, thereby improving plant yield; it can also enhance plant resistance to sheath blight. Therefore, miR5513 or its precursors, or substances and physicochemical methods that can downregulate or inhibit the expression of miR5513 or its precursors, can be considered for application in plant variety improvement based on gene editing / genetic engineering technology.

[0040] As will be readily apparent to those skilled in the art, the term "plant" as used in this invention refers to a plant capable of expressing miR5513 or its precursor.

[0041] Those skilled in the art will also readily recognize that, as described in the background section of this invention, "plant" includes, but is not limited to, grasses.

[0042] Furthermore, grasses include, but are not limited to: plants of the genus *Oryza*, such as rice; plants of the genus *Triticum*, such as wheat; and plants of the genus *Zea*, such as corn.

[0043] Specifically, "plants" include, but are not limited to, rice, barley, wheat, oats, rye, corn, sorghum, etc.

[0044] In the specific implementation examples provided by this invention, regulation of miR5513 or its precursor expression in any of the above-mentioned plants can cause significant changes in plant traits (seed length; and / or, seed width; and / or, plant yield; and / or, plant resistance to sheath blight), all of which fall within the protection scope of this invention.

[0045] Specifically, downregulating / knocking out the expression of miR5513 or its precursor can promote increased seed length; and / or, increase seed width; and / or, improve plant yield; and / or, enhance plant resistance to sheath blight.

[0046] As will be readily apparent to those skilled in the art, the “grass” as defined in the present invention above includes, but is not limited to, rice sheath blight.

[0047] As will be readily apparent to those skilled in the art, "miR5513" in the following specific embodiments refers to miR5513 of the genus *Oryza*. It is easily understood and conceivable to those skilled in the art that, given the high sequence similarity between miRNAs (or their precursors), downregulating subsequently discovered miR5513-like sequences can regulate seed traits and disease resistance in gramineous plants, achieving the same technical effect as the downregulation of miR5513 verified in the embodiments of this invention.

[0048] The miR5513 provided in the following specific embodiments can be applied to the study of resistance to sheath blight and yield of gramineous plants, such as rice, and has very important application value in both theoretical research and practical plant improvement.

[0049] Based on the above findings of this invention, the method for regulating seed shape and sheath blight resistance in gramineous plants provided by this invention can employ related genetic engineering techniques to silence, knock out, or mutate the miR5513 gene or its precursor expression gene in gramineous plants, thereby downregulating / knocking out the expression of miR5513 or its precursor, and thus promoting changes in seed shape, such as increasing seed length and width, increasing the length-to-width ratio of the seed, and ultimately increasing plant yield; as well as enhancing resistance to sheath blight.

[0050] Based on the above findings of this invention, it is readily understood and known by those skilled in the art that any specific genetic engineering techniques that can achieve silencing, knocking out, or mutating the miR5513 gene or its precursor expression genes, or downregulating / inhibiting the expression of miR5513 or its precursor substances, i.e., interfering with / inhibiting the expression of miR5513 or its precursors, are within the scope of protection of this invention.

[0051] Those skilled in the art will readily recognize that substances used to downregulate or knock out miR5513 or its precursors include, but are not limited to, nucleic acid inhibitors, antagonists, downregulators, blockers, and inhibitors. Any substance capable of downregulating or knocking out the expression level of miR5513 or its precursor falls within the scope of this invention. The aforementioned substances belonging to biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level.

[0052] Furthermore, the substance used to downregulate or knock out miR5513 or its precursor can be any substance that can prevent miR5513 (especially its binding key site) or its precursor from binding to its target sequence, or reduce the activity of miR5513 or its precursor, or reduce the stability of miR5513 or its precursor, or downregulate or knock out the expression of miR5513 or its precursor, or reduce the effective duration of miR5513 or its precursor. These substances are all within the scope of protection of this invention. For example, these substances include, but are not limited to: nucleic acid inhibitors, protein inhibitors, antibodies, ligands, nucleases, nucleic acid binding molecules, etc.

[0053] As one preferred embodiment of the present invention, the aforementioned claimed "substance" may be an interfering molecule that can specifically downregulate miR5513 or its precursor, or a miRNA5513 silencing agent based on miRNA target mimicry technology.

[0054] More preferably, the mimicry miR5513 sequence is placed in the IPS1 gene sequence to obtain the ips-MIM5513 sequence fragment.

[0055] The ips-MIM5513 sequence fragment is placed in a suitable vector and transformed into plants to obtain transgenic plants with improved traits.

[0056] Alternatively, the aforementioned "substance" could be an sgRNA expression cassette of miR5513 based on CRISPR / Cas9 technology.

[0057] This invention, based on the role of miR5513 in seed shape and resistance to sheath blight in grasses, provides specific genetic engineering techniques for silencing, knocking out, or mutating the miR5513 gene or its precursor gene, or methods for downregulating or inhibiting the expression of miR5513 or its precursor substances. Options include miR5513 silencing agents and corresponding methods based on target mimicry technology, and miR5513 sgRNA expression cassettes and corresponding methods based on CRISPR / Cas9 technology.

[0058] In some embodiments of the present invention, the method for reducing miR5513 expression in gramineous plants based on miRNA target mimicry technology includes the following steps:

[0059] (1) Construct the miRNA5513 silencer (i.e., the ips-MIM5513 sequence), which includes the mimicry miR5513 sequence in the IPS1 gene sequence and the mimicry miR5513 sequence located between CCTTAGAAA and AGCCTTCGGTT in the sequence.

[0060] (2) Then the miRNA5513 silencing agent is transferred into the cells, tissues and organs (including but not limited to fruits and seeds) of grass plants to obtain cells, tissues and organs of grass plants that can downregulate miRNA5513, and these cells, tissues and organs are cultivated to obtain transgenic grass plants through tissue culture technology.

[0061] Those skilled in the art should know that, based on the above steps, the method may also include screening plant cells, tissues or organs that have been successfully transfected with miRNA5513 silencing agents.

[0062] In other embodiments of the present invention, the method based on CRISPR / Cas9 technology is as follows: designing a miR5513 sgRNA expression cassette, placing the fragment (sgRNA expression cassette) in a suitable vector, and transforming it into grass plants to obtain transgenic grass plant varieties with improved traits (i.e., seed shape and resistance to sheath blight).

[0063] The present invention also provides an expression vector containing the ips-MIM5513 sequence, or an expression vector containing an sgRNA expression cassette containing miR5513.

[0064] The preferred expression vector is a plant expression vector.

[0065] More preferably, the expression vectors mentioned above can be selected from those suitable for subsequent transgenic operations (such as transgenic operations using Agrobacterium).

[0066] Methods well known to those skilled in the art can be used to construct expression vectors containing the promoter and / or target gene sequence described in this invention. These methods include in vivo / in vitro DNA recombination techniques, DNA synthesis techniques, etc. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0067] The present invention also provides genetically engineered host cells containing the ips-MIM5513 sequence, or an sgRNA expression cassette containing miR5513, or a vector containing the ips-MIM5513 sequence or an sgRNA expression cassette.

[0068] The host cell is usually a plant cell.

[0069] Those skilled in the art should know that methods for transforming plants can include human-based Agrobacterium-mediated transformation or gene gun transformation, such as leaf disc transformation and rice embryo transformation.

[0070] Preferably, the Agrobacterium method is used. Transformed plant cells, tissues, or organs can be regenerated into plants using conventional methods, thereby obtaining grasses with altered traits compared to the wild type.

[0071] In a specific embodiment of the present invention, "miR5513" refers to RNA having the nucleotide sequence shown in SEQ ID NO.1. "miR5513 precursor" (i.e., pre-miR5513) refers to the nucleotide sequence shown in SEQ ID NO.2.

[0072] In a specific embodiment of the present invention, the rice miR5513 gene was cloned, and a transgenic plant with competitive downregulation of miR5513 (named “MIM5513”) was constructed by: (1) target mimicry technology; (2) a transgenic plant with miR5513 knocked out (named “KO5513”) was constructed by CRISPR / Cas9 technology.

[0073] Analysis showed that the seeds of MIM5513 and KO5513 plants had significantly increased length and width, as well as significantly increased thousand-grain weight and yield per plant. Identification confirmed that MIM5513 and KO5513 plants exhibited significant resistance to rice sheath blight. MIM5513 and KO5513 plants have high application value in improving rice yield and enhancing resistance to rice sheath blight.

[0074] Those skilled in the art should understand that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally operated under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* (3rd edition, Science Press, 2002), edited by J. Sambrook et al., or according to the conditions provided and recommended by the manufacturer.

[0075] Example 1: Construction of MIM5513 transgenic plant.

[0076] 1. The expression of the IPS1 gene in Arabidopsis thaliana is induced by phosphorus deficiency stress.

[0077] In this embodiment, Arabidopsis thaliana was cultured under phosphorus-deficient conditions, its total RNA was extracted, and then reversed into cDNA.

[0078] Using the full-length cDNA sequence of the Arabidopsis thaliana IPS1 gene (as shown in SEQ ID NO.4) as a template, amplification primers ipsF and ipsR were designed at both ends of its CDS region for PCR amplification.

[0079] ipsF (BamHI) sequence: 5'-gtggatccAAGAAAAATGGCCATCCCCTAGC-3'; as shown in SEQ ID NO.5.

[0080] ipsR (SacI) sequence: 5'-ctggagctcGAGGAATTCACTATAAAGAGAATCG-3'; as shown in SEQ ID NO.6.

[0081] The amplified products were then digested with restriction endonucleases BamHI and SacI, and the digested fragments were ligated into the original vector pBSK (e.g., Figure 1 The intermediate vector was obtained from the BamHI and SacI sites (as shown).

[0082] 2. The mimicry miR5513 sequence is designed as follows:

[0083] 5'-TAACAAAGGACtagaAACAGACTGA-3'; as shown in SEQ ID NO.3.

[0084] The addition of "taga" in the mimicry miR5513 sequence greatly enhances the ability of MIM5513 to bind to target genes, making normal miR5513 uncompetitive when binding to target genes, thereby achieving the goal of downregulating normal miR5513.

[0085] 3. Based on the mimicry miR5513 sequence and related sequences in the IPS1 gene, the following MIM5513-I and MIM5513-II sequences were designed:

[0086] MIM5513-I sequence:

[0087] 5'-cgaagctTAACAAAGGACtagaAACAGACTGAtttctagagggagataa-3', as shown in SEQ ID NO.7;

[0088] MIM5513-II sequence:

[0089] 5'-cctctagaaaAGTCTGTTTCTAGTCCTTTGTTAagcttcggttcccctcg-3', as shown in SEQ ID NO:8.

[0090] Using the intermediate vector obtained in the previous steps as a template, amplification was performed using ipsF and MIM5513-I as paired primers and ipsR and MIM5513-II as paired primers, respectively, resulting in two fragments.

[0091] 4. Using the two clone fragments amplified in the above steps as templates, and using ipsF and ipsR as primers, perform overlapping PCR (i.e., "overlapping PCR", technical reference from "Higuchi, R., Krummel, B., and Saiki, RK (1988). Nucleic Acids Res 16, 7351-7367").

[0092] This replaces mimicry miR5513 at the incomplete target site of miR399 in the IP1 gene (i.e., cDNA). Figure 2 The bases within the dashed box (the sites between CCTTAGAAA and AGCCTTCGGTT) yield the corresponding ips-MIM5513 fragment.

[0093] 5. Amplify the fragment using ips-MIM5513, perform an A-addition reaction on the final amplified fragment, and ligate it into the pCXUN vector (e.g., Figure 3 As shown in the figure, the recombinant vector was obtained.

[0094] 6. Wild-type rice Nipponbare was transformed using Agrobacterium tumefaciens, and the ips-MIM5513 fragment was overexpressed to construct a miR5513 target mimicry transgenic plant (abbreviated as MIM5513).

[0095] The complete sequence of the ips-MIM5513 fragment (miR5513 silent form) is as follows:

[0096] As shown in SEQ ID NO.9.

[0097] Example 2: Construction of KO5513 transgenic plants

[0098] 1. Based on the miR5513 precursor (pre-miR5513) sequence, knockout site analysis was performed using the online software CRISPR-P (http: / / cbi.hzau.edu.cn / crispr). Ultimately, one target site was selected from both the sense and antisense strands of miR5513.

[0099] The positive chain target sequence of miR5513 is as follows:

[0100] 5'-tatgttataacaaaggacaa-3', as shown in SEQ NO.10.

[0101] The antisense target sequence of miR5513 is:

[0102] 5'-agccggatatgttataacaaag-3', as shown in SEQ NO.11.

[0103] 2. Based on the two target sequences and the vector sequence of the sgRNA expression cassette mentioned above, the positive sense primer 5513-gRT1 and the negative sense primer 5513-gRT2 were designed.

[0104] The sequence of the positive linker primer 5513-gRT1 is as follows:

[0105] 5'-GCCGTATGTTATCACAAAGGACAAgttttagagctagaaat-3', as shown in SEQ NO.12.

[0106] The sequence of the antisense linker primer 5513-gRT2 is as follows:

[0107] 5'-GCCGTACAGATATGTTATCACAAgttttagagctagaaat-3', as shown in SEQ NO.13.

[0108] 3. Using overlapping PCR, sgRNA expression cassettes of miR5513 sense and antisense strands driven by the U6a promoter were constructed, respectively.

[0109] The sgRNA expression cassette sequence of the positive strand of miR5513 is as follows:

[0110] tatgttataacaaaggacaagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt, as shown in SEQ ID NO. 14.

[0111] The sgRNA expression cassette sequence of the miR5513 antisense strand is as follows:

[0112] agccggatatgttataacaaaggttttagagctagaaatagcaagttaaaataaggctagtctccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt, as shown in SEQ ID NO. 15.

[0113] 4. Using plasmid pYLgRNA-OsU6a (e.g.) Figure 5 Using the template shown, primers UF and 5513-U6a1 were used as paired primers, and primers UF and 5513-U6a2 were used as paired primers to amplify the U6a promoter fragment.

[0114] The sequence of primer 5513-U6a1 is as follows:

[0115] 5'-AAACTTGTCCTTTGTGATAACATACggcagccaagccagca-3', as shown in SEQ NO.16.

[0116] The sequence of primer 5513-U6a2 is as follows:

[0117] 5'-AAACTTGTGATAACATATCTGTACggcagccaagccagca-3', as shown in SEQ NO.17.

[0118] The sequence of primer UF is:

[0119] 5'-ctccgttttacctgtggaatcg-3', as shown in SEQ NO.18.

[0120] Using primers gR-R and 5513-gRT1 as paired primers, and primers gR-R and 5513-gRT2 as paired primers, the sgRNA fragment of miR5513 was amplified, and the sgRNA expression cassettes of the sense and antisense strands of miR5513 were obtained, respectively.

[0121] The sequence of primer gR-R is as follows:

[0122] 5'-cggaggaaaattccatccac-3', as shown in SEQ NO.19.

[0123] 5. Using the first-round PCR product (i.e., the U6a promoter fragment and two miR5513 sgRNA expression cassettes) diluted 10-fold as a template, and using universal primers Pps-GGL and Pgs-GG2 as paired primers, and Pps-GG2 and Pgs-GGR as paired primers, perform the second round of overlapping PCR.

[0124] The sequence of the universal primer Pps-GGL is as follows:

[0125] 5'-ttcagaggtctctctcgactagtatggaatcggcagcaaagg-3', as shown in SEQ NO.20.

[0126] The sequence of the universal primer Pgs-GG2 is as follows:

[0127] 5'-agcgtgggtctcgtcagggtccatccactccaagctc-3', as shown in SEQ NO.21.

[0128] The sequence of the universal primer Pps-GG2 is as follows:

[0129] 5'-ttcagaggtctctctgacactggaatcggcagcaaagg-3', as shown in SEQ NO.22.

[0130] The sequence of the universal primer Pgs-GGR is as follows:

[0131] 5'-agcgtgggtctcgaccgacgcgtatccatccactccaagctc-3', as shown in SEQ NO.23.

[0132] 6. Using the product of the second round of overlapping PCR described above, perform enzyme digestion and ligation reactions using variable temperature cycling to assemble the sgRNA expression cassette into the pYLCRISPR / Cas9 vector (the specific reaction system is shown in Table 1 below).

[0133] Table 1. Enzyme digestion-ligation reaction of binary vector and sgRNA expression cassette

[0134]

[0135] 7. The above recombinant expression vector was transformed into wild-type rice Nipponbare using Agrobacterium tumefaciens to construct a CRISPR / Cas9 transgenic plant of miR5513 (abbreviated as KO5513).

[0136] Example 1: Identification of miR5513 expression level and knockout site in transgenic rice plants.

[0137] The expression levels and knockout sites of the T2 generation homozygous transgenic lines (MIM5513, KO5513) obtained in Examples 1 and 2 were identified.

[0138] Primers were designed based on the pre-miR5513 sequence to amplify the miR5513 sequence in the genome of miR5513 knockout plants.

[0139] The primer sequences for quantitative amplification of miR5513 are as follows:

[0140] The quantitative amplification primer qRT5513-F: 5'-tacgtttgttcatttaggatagaca-3', as shown in SEQ NO.24.

[0141] The quantitative amplification primer qRT5513-R: 5'-aacatatccggctaatgtcag-3', as shown in SEQ NO.25.

[0142] The results are as follows Figure 6 As shown. Figure 6 A is a schematic diagram of the structure of the silent MIM5513 (i.e., ips-MIM5513). Figure 6 B shows the miR5513 knockout site (marked in red) in the miR5513 knockout plant (KO5513). Compared with the control, miR5513 has one base insertion in the sense strand and one base deletion in the antisense strand.

[0143] Simultaneously, RNA was extracted from MIM5513 and KO5513, and after reversing the cDNA, quantitative PCR was used to verify the expression level of U6 as a housekeeping gene. The results are as follows: Figure 6 As shown in C, the expression level of miR5513 was downregulated in both the mimicry transgenic plant (MIM5513) and the knockout plant (KO5513).

[0144] Experimental Example 2: MIM5513 and KO5513 plants exhibited phenotypic characteristics of increased grain length, grain width, thousand-grain weight, and yield per plant.

[0145] The agronomic traits of the transgenic plants (MIM5513 and KO5513) obtained in Examples 1 and 2 were observed and compared with those of the wild-type Nipponbare.

[0146] The results are as follows Figure 7 As shown, the seed morphology of both MIM5513 and KO5513 plants underwent significant changes during the reproductive growth stage. Figure 7 As can be seen from AD, the grain length and width of MIM5513 and KO5513 plants are significantly increased. Figure 7 As can be seen from EF, the thousand-grain weight and yield per plant also increased significantly.

[0147] Experimental Example 3: Evaluation of resistance of MIM5513 and KO5513 plants to sheath blight.

[0148] Resistance was assessed by inoculating single live plants of MIM5513 and KO5513 at the heading stage with *Rhizoctonia solani*. The specific method was as follows:

[0149] Cut 1mm thick bark into 1cm long and 2mm wide pieces and place them in a petri dish. Add 6-7mL of PDA culture solution to the sterilized petri dish to submerge the bark pieces. Place one activated *Rhizoctonia solani* AG-1 mycelium block in the center of the dish and incubate at 28℃ in the dark for 3 days until the surface of the bark pieces is covered with mycelium. Using tweezers, embed the bark inoculum into the inner side of the leaf sheath below the second leaf pulvinus of MIM5513 and KO5513 plants at the heading stage. Seven days after inoculation, statistically analyze the length and area of ​​diseased rice materials.

[0150] The results are as follows Figure 8 As shown. From Figure 8 As shown in Figures AB, the infection rate of sheath blight in MIM5513 and KO5513 plants was significantly lower than that in Nipponbare, and the length of lesions on the leaf sheaths of these plants was shorter than that of Nipponbare lesions. As shown in Figures CD, the area of ​​lesions after the leaf sheaths were unfolded was also significantly smaller than that of Nipponbare lesions.

[0151] The above detailed embodiments describe the implementation of the present invention. It should be noted that the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A method of modulating a trait in a plant, comprising, A plant with increased grain length of seeds; and / or, increased grain width of seeds; and / or, increased yield of plants; and / or, increased sheath blight resistance of plants, by down-regulating or knocking out the expression of miR5513 or its precursor in the plant; the plant is rice; The miR5513 sequence is shown as SEQ ID NO. 1, and the miR5513 precursor sequence is shown as SEQ ID NO. 2; The method for down-regulating the expression of miR5513 or its precursor in the plant comprises: down-regulating the expression of miR5513 or its precursor by constructing and utilizing a miR5513 silencer; placing a mimicry miR5513 sequence in an IPS1 gene to obtain an ips-MIM5513 fragment sequence; and transferring the ips-MIM5513 fragment sequence into a plant to obtain a transgenic plant; the nucleotide sequence of the mimicry miR5513 is shown as SEQ ID NO. 3; and the nucleotide sequence of the ips-MIM5513 fragment sequence is shown as SEQ ID NO.

9. The method for knocking out the miR5513 or its precursor sequence in the plant comprises: constructing an sgRNA expression cassette of the sense strand and the antisense strand of miR5513 based on CRISPR / Cas9 technology to knock out the miR5513 or its precursor sequence; the sgRNA expression cassette sequence of the sense strand of miR5513 is shown as SEQ ID NO. 14; and the sgRNA expression cassette sequence of the antisense strand of miR5513 is shown as SEQ ID NO.

15.

2. Use of a down-regulator of miR5513 or a precursor thereof, characterized in that, A plant with increased grain length of seeds; and / or, increased grain width of seeds; and / or, increased yield of plants; and / or, increased sheath blight resistance of plants, for improving plant traits; the plant is rice; The sequence of miR5513 is shown as SEQ ID NO. 1, and the sequence of the precursor of miR5513 is shown as SEQ ID NO. 2; the down-regulator is a miR5513 silencer based on target mimicry technology; and the sequence of the miR5513 silencer is shown as SEQ ID NO.

9.

3. Use of a down-regulator of miR5513 or a precursor thereof in the improvement of germplasm for plant trait alteration, characterized in that, The sequence of miR5513 is shown as SEQ ID NO. 1, and the sequence of the precursor of miR5513 is shown as SEQ ID NO. 2; the plant traits are changed to promote the increase of grain length of seeds; and / or, promote the increase of grain width of seeds; and / or, increase the yield of plants; and / or, increase the sheath blight resistance of plants; the plant is rice; the down-regulator is a miR5513 silencer based on target mimicry technology; and the sequence of the miR5513 silencer is shown as SEQ ID NO. 9.

Images