Application of F-box gene OsFBX49 in rice resistance to brown planthopper

By overexpressing the F-box gene OsFBX49 in rice, the problem of insufficient resistance of rice to brown planthoppers was solved, and the efficient resistance of transgenic rice to brown planthoppers was enhanced, reducing the loss of rice to insect pests.

CN119082139BActive Publication Date: 2025-10-10WUHAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411532244.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-30
Publication Date
2025-10-10
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve rice's resistance to brown planthoppers, resulting in large-scale wilting of rice fields and serious yield reductions.

Method used

By increasing the expression of the F-box gene OsFBX49 in rice varieties, especially by constructing an overexpression vector and introducing it into plant cells, the activity and expression level of OsFBX49 are enhanced, and genetic transformation is carried out using Agrobacterium-mediated method to obtain transgenic rice with brown planthopper resistance.

Benefits of technology

Significantly enhance rice's resistance to brown planthoppers, as evidenced by increased survival rate of transgenic plants after feeding by brown planthoppers, reduced insect weight, and reduced honeydew secretion, thus preventing large-scale wilting and yield reduction in rice fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119082139B_ABST
    Figure CN119082139B_ABST
Patent Text Reader

Abstract

The application discloses application of F-box gene OsFBX49 in rice resistance to brown planthopper and belongs to the technical field of plant genetic engineering. The amino acid sequence of the protein coded by the gene OsFBX49 is shown as SEQ ID NO. 1. In the application, the OsFBX49 gene is transferred into rice susceptible to planthopper through agrobacterium-mediated genetic transformation, and the result shows that the plant overexpressing the OsFBX49 gene has enhanced resistance to brown planthopper. After the brown planthopper feeds on the transgenic plant, the survival rate of the brown planthopper is obviously reduced, the weight gain of the brown planthopper is obviously reduced, and the amount of honeydew secreted by the brown planthopper is obviously reduced. The gene in the application provides a basis for researching the gene interaction between rice and brown planthopper and has a reference significance for researching the molecular function of genes and breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to application of an F-box gene OsFBX49 in rice resistance to brown planthoppers. Background Art

[0002] Rice is one of the most important food crops, serving as the staple food for over half of the world's population. Furthermore, rice production is directly linked to my country's food security, farmers' income growth, and rural stability. The brown planthopper (Nilophaga lugens) is the most common and widespread pest in rice production. Adults and nymphs of the Nilophaga lugens gather at the base of rice clumps, sucking sap from the phloem and depleting the rice plants' nutrients. When a major Nilophaga outbreak occurs, the lower part of the rice plants turns black, paralyzed and collapses, withering large areas of rice fields, resulting in reduced or even complete crop failure. Statistics show that between 2006 and 2015, Nilophaga lugens affected 3.87 mu (approximately 1.5 acres) of rice in my country each year, resulting in 120 tons of rice losses. This represents 29.5% of the total losses from various rice pests and diseases, making it the leading pest in my country's rice production (Liu Wancai et al., 2016). Nilophaga lugens is also the leading pest in rice production in Asia, often causing significant losses to rice crops worldwide. Especially since the beginning of the 21st century, the frequency and scale of brown planthopper outbreaks have been increasing across rice-producing regions throughout Asia. It has become the greatest threat to rice production and is considered the leading pest of rice (Heong & Hardy, 2009; IRRI, Annual Report 2011). Therefore, curbing the development and damage of brown planthoppers is a critical requirement for ensuring the safety of rice production.

[0003] F-box proteins, originally discovered in the cell cycle protein CyclinF, are key components of the SCF complex (Glickman MH et al., 2002; Jain M., 2007). They are named F-box because of the approximately 40-50 amino acid F-box motif at their N-termini. These positions are occupied by a highly conserved Leu-Pro dipeptide and a combination of other hydrophobic or branched (Val and Ile) amino acids. F-box proteins interact with S-phase kinase-associated protein 1 (SKP1), the core subunit of the SCF ubiquitin E3 ligase, to form the SCF complex. These proteins participate in various processes, including plant growth and development, photomorphogenesis, plant hormone signaling, and resistance to biotic stresses. F-box proteins are crucial for plant growth and development and adaptation to stress, but their role in insect resistance is poorly understood. Summary of the Invention

[0004] In view of the above deficiencies in the prior art, the present invention provides an application of a rice F-box domain protein gene OsFBX49 in improving the resistance of rice to brown planthoppers.

[0005] To achieve the above purpose, the specific technical solutions of the present invention are as follows:

[0006] In a first aspect, the present invention provides a use of the F-box gene OsFBX49 in improving resistance of rice to brown planthoppers, wherein the nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0007] (i) The nucleotide sequence shown in SEQ ID NO. 1, whose ORF is 1176 bp in length and encodes 391 amino acids;

[0008] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted, and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO. 1.

[0009] Those skilled in the art will understand that, based on the nucleotide sequence set forth in SEQ ID NO. 1, substitution, deletion, and / or addition of one or more nucleotides can be used to obtain a nucleotide sequence with the same function. For example, in sequences grown in different rice backgrounds, substitution or deletion of one or more nucleotides will result in an amino acid sequence encoding no frameshift mutation, but only partial amino acid deletions or point mutations. Therefore, the nucleotide sequence of the gene OsFBX49 described in the present invention also includes a nucleotide sequence that expresses the same protein as the nucleotide sequence set forth in SEQ ID NO. 1, with substitution, deletion, and / or addition of one or more nucleotides.

[0010] Furthermore, the gene OsFBX49 encodes the following protein (a) or (b):

[0011] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO. 2;

[0012] (b) A protein derived from (a) in which the amino acid sequence shown in SEQ ID NO. 2 is substituted, deleted and / or added with one or more amino acids and has the same function as the protein consisting of the amino acid sequence shown in SEQ ID NO. 2.

[0013] It should be understood by those skilled in the art that, without affecting the activity of the protein encoded by the gene OsFBX49 (i.e., not in the active center of the protein), those skilled in the art can make various substitutions, additions and / or deletions of one or more amino acids to the amino acid sequence shown in SEQ ID NO. 2 to obtain an amino acid sequence with equivalent function.

[0014] The present invention provides an application of the F-box gene OsFBX49 in improving rice resistance to brown planthoppers. When the activity and / or expression level of the gene OsFBX49 is increased, the resistance of rice to brown planthoppers is enhanced. The enhanced resistance of rice to brown planthoppers is mainly manifested in that after brown planthoppers feed on rice leaf sheaths, control rice plants die, while plants with overexpression of the gene OsFBX49 grow normally. At the same time, after brown planthoppers feed on the leaf sheaths of the overexpressing plants, the survival rate of the brown planthoppers is reduced, their weight gain is reduced, and the amount of honeydew secreted is reduced.

[0015] In a second aspect, the present invention provides a biomaterial, characterized in that the biomaterial contains the gene OsFBX49, and the biomaterial is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, or an engineered bacterium; the nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0016] (i) the nucleotide sequence shown in SEQ ID NO. 1;

[0017] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted, and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO. 1.

[0018] In a third aspect, a gene OsFBX49 or the biomaterial according to claim 3 is used in breeding rice varieties with brown planthopper resistance, wherein the nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0019] (i) the nucleotide sequence shown in SEQ ID NO. 1;

[0020] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted, and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO. 1.

[0021] In a fourth aspect, the present invention provides a method for enhancing resistance of rice to brown planthoppers, comprising: increasing the activity and / or expression level of the OsFBX49 gene by genetic engineering means.

[0022] Furthermore, the genetic engineering includes: constructing an overexpression vector of the OsFBX49 gene, and transforming rice with the vector.

[0023] Furthermore, the overexpression vector is introduced into plant cells using conventional biotechnology methods, including but not limited to the use of Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation.

[0024] Furthermore, the overexpression vector is introduced into plant cells using Agrobacterium-mediated method and is used to transform rice.

[0025] In a fifth aspect, the present invention provides the use of transgenic rice obtained by the method in rice breeding.

[0026] Furthermore, the breeding methods include: transgenic, hybridization, backcrossing, self-pollination or asexual reproduction.

[0027] Discovery and functional verification of the OsFBX49 gene described in the present invention:

[0028] (1) Discovery process: Through transcriptome analysis of rice resistant and susceptible to brown planthoppers, we discovered a gene, OsFBX49, that was upregulated in brown planthopper-resistant rice when fed by brown planthoppers.

[0029] (2) Genetic transformation verification function: An OsFBX49 gene overexpression vector was constructed. The vector backbone was a pCXUN vector containing the Ubiquinti promoter. The overexpression vector was introduced into susceptible rice plants using the Agrobacterium EHA105-mediated genetic transformation method. Transgenic plants were screened and finally, positive transgenic rice plants with overexpression of the OsFBX49 gene were obtained. Quantitative PCR analysis was performed on the T2 generation plants, and two representative lines with relatively high expression levels (OsFBX49-1 and OsFBX49-6) were selected for functional verification. The insect resistance of the T2 generation transgenic plants was identified, including the seedling group method, survival rate, insect weight gain and honeydew amount. It was found that the two lines had significantly enhanced resistance to brown planthoppers.

[0030] Compared with the prior art, the present invention is beneficial in that:

[0031] By increasing the expression of the OsFBX49 gene in insect-susceptible rice varieties, the present invention discovered that the overexpressed transgenic rice plants had enhanced insect resistance. This invention reveals for the first time that the OsFBX49 gene enhances rice resistance to brown planthoppers and can be used to study plant resistance to insects. There are many OsFBX49 gene members in plant cells, which participate in multiple biological functions. Therefore, the present invention's research on the OsFBX49 gene has great reference value for subsequent research on other F-box domain-containing protein members. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The results of quantitative PCR detection of transgenic plants; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001;

[0033] Figure 2 The insect-resistant phenotype of transgenic rice lines FBX49-1 and FBX49-6; Figure 2 A is a physical picture of rice after brown planthoppers have fed on it; Figure 2 B represents the level of rice resistance to brown planthoppers; smaller values ​​indicate stronger resistance; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001.

[0034] Figure 3 The changes in survival rate, insect weight gain and honeydew production after brown planthoppers fed on different transgenic strains; Figure 3 A shows the changes in the survival rate of brown planthoppers after feeding on different transgenic strains; Figure 3 B shows the changes in brown planthopper weight gain after feeding on different transgenic strains; Figure 3 C shows the changes in honeydew production after brown planthoppers fed on different transgenic strains; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001. DETAILED DESCRIPTION

[0035] The technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments obtained by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0036] The present invention provides an application of the F-box gene OsFBX49 in improving the resistance of rice to brown planthoppers. The nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0037] (i) The nucleotide sequence shown in SEQ ID NO. 1, whose ORF is 1176 bp in length and encodes 391 amino acids;

[0038] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted, and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO. 1.

[0039] Through transcriptome analysis of resistant and susceptible rice varieties before and after feeding by brown planthoppers, the present invention discovered that the OsFBX49 gene was significantly upregulated in resistant rice varieties after feeding by brown planthoppers, while no significant changes were observed in susceptible rice varieties. This suggests that OsFBX49 may play a role in rice's insect resistance mechanism. To investigate the specific role of this gene in rice resistance to brown planthoppers, the present invention used Agrobacterium-mediated genetic transformation to overexpress the gene into the susceptible rice variety Nipponbare. The results showed that the overexpressing transgenic plants exhibited stronger resistance to brown planthoppers than the control Nipponbare plants. This was primarily demonstrated by the fact that after feeding by brown planthoppers, the control Nipponbare plants withered and died, while the transgenic plants survived remarkably well. Furthermore, the survival rate, weight gain, and honeydew secretion of the transgenic plants after feeding by brown planthoppers were significantly reduced. This invention provides valuable insights into gene function and breeding.

[0040] In the following specific embodiments, unless otherwise specified, all reactions were performed according to conventional experimental methods and described recombination techniques (e.g., Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001, etc.), or according to the conditions recommended in the manufacturer's instructions.

[0041] Example 1

[0042] 1. Obtaining the Rice OsFBX49 Gene

[0043] Using the transcriptome sequencing ID, we located the full-length sequence of the OsFBX49 gene in the Nipponbare database. Primers were designed based on the ORF, and PCR amplification was performed using Nipponbare rice cDNA as a template using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme) in a 50 µL reaction. PCR conditions were: pre-denaturation at 95°C for 3 min, followed by denaturation at 95°C for 15 s, and annealing and extension at 58°C for 30 s / kb, for 30 cycles. The PCR system was as follows:

[0044]

[0045] The PCR product was recovered and ligated into the pMD18-T vector, and positive clones were screened and sequenced. The sequencing results showed that the sequence of the PCR product was shown in SEQ ID NO. 1.

[0046] 2. Construction of OsFBX49 gene overexpression vector and Agrobacterium-mediated genetic transformation

[0047] 1. Construction of OsFBX49 overexpression vector

[0048] The inventors designed primers by cutting a section from each end of the ORF, and the sequences are as follows:

[0049] F: cccggggggatccccaatactatggaagacatggttacgg (5'-3'), as shown in SEQ ID NO. 3;

[0050] R: aacccgctgttatccccaatactataagtgatccgaacgagac (5'-3'), as shown in SEQ ID NO. 4;

[0051] The vector used was pCXUN (kindly provided by Professor Wang Guoliang of Ohio State University, USA; GenBank ID: FJ905215.1, from a 2009 paper published in Plant Pathlology by Songbiao Chen, Pattavipha Songkumarn, Jianli Liu, and Guo-Liang Wang titled "A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics"). The pCXUN vector was digested with XcmI, and the exogenous fragment was directly ligated after A addition. After sequencing verification, the resulting vector, the Os02g27400 gene overexpression vector, was electroporated into Agrobacterium tumefaciens EHA105. A single colony was selected for expansion and confirmed by PCR. An equal volume of 50% glycerol was added and mixed, and stored at -80°C until further use.

[0052] 2. Genetic transformation

[0053] The OsFBX49 gene overexpression vector was introduced into the japonica rice variety Nipponbare using Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) to obtain transgenic plants. Positive plants were detected using the universal primers Hyg-L and Hyg-R for hygromycin.

[0054] The T2 positive plants were harvested from the flag leaves to extract RNA, which was converted into cDNA and the expression level was detected by quantitative PCR. Figure 1 The results showed that the overexpression effects of the two different transgenic lines (FBX49-1-7 and FBX49-6-9) were significant.

[0055] 3. Phenotypic analysis of OsFBX49 overexpressing plants

[0056] 1. Seedling Group Method

[0057] Overexpressing transgenic plants FBX49-1 and FBX49-6 and control plants Nipponbare (transgenic background plants, showing insect resistance) were sown in milk tea cups, with 15 seeds per cup, and replicated three times per group. When the rice reached the three-leaf stage, insects were released to ensure that each rice seedling contained eight 2- to 3-year-old brown planthopper nymphs. When the mortality rate of the susceptible control group exceeded 90%, photos were taken and the resistance level of each rice plant in each cup was read. The average value was the insect resistance level of the transgenic line. The test results are shown in [1]. Figure 2 ,in, Figure 2 A is a physical picture of rice after brown planthoppers have fed on it; Figure 2 B is the rice's resistance to brown planthoppers, with smaller values ​​indicating stronger resistance. Figure 2 A: It can be seen that when brown planthoppers feed on Nipponbare and cause it to wither and die, the transgenic plants FBX49-1-7 and FBX49-6-9 still survive.

[0058] 2. Determination of survival rate, insect weight gain and honeydew amount

[0059] Similarly, transgenic plants FBX49-1 and FBX49-6, as well as the control plant Nipponbare, were sown in milk tea cups. Each group had 10 cups, with one plant per cup. When the plants reached the five-leaf stage, 20 2-3 instar brown planthopper nymphs were inoculated into each cup. The number of brown planthoppers surviving on different plants was recorded daily, and their survival rates were calculated. The results are as follows: Figure 3 As shown in A. The results showed that the survival rate of brown planthoppers decreased significantly after feeding on overexpressed transgenic plants.

[0060] Transgenic plants FBX49-1, FBX49-6 and the control plant Nipponbare were sown in milk tea cups. There were 3 cups per group and 6 seeds per cup. When the rice reached the five-leaf stage, folded wax bags were tied to the rice stems, two wax bags per plant, and a brown planthopper was placed in each wax bag. After feeding for 48 hours, the wax bags were removed and the brown planthopper and the wax bags were weighed. The difference in weight of the brown planthopper before and after feeding was calculated as the insect weight gain of the brown planthopper, and the difference in the wax bags before and after feeding was calculated as the amount of honeydew secreted by the brown planthopper. The results are as follows: Figure 3The results showed that after feeding on the transgenic plants with overexpression of the gene, the weight gain and honeydew secretion of brown planthoppers were significantly reduced.

[0061] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

Claims

1. F-box genes OsFBX49 The application of the invention in improving the resistance of rice to brown planthopper is characterized in that: The gene OsFBX49 The nucleotide sequence is: the nucleotide sequence shown in SEQ ID NO.

1.

2. A gene OsFBX49 The application of the invention in breeding rice varieties with brown planthopper resistance is characterized in that: The gene OsFBX49 The nucleotide sequence is: the nucleotide sequence shown in SEQ ID NO.

1.

3. A method for enhancing rice resistance to brown planthoppers, characterized in that: include: Using genetic engineering, OsFBX49 The expression level of the gene increases; the gene OsFBX49 The nucleotide sequence is: the nucleotide sequence shown in SEQ ID NO.

1.

4. The method for enhancing rice resistance to brown planthopper according to claim 3, characterized in that: The genetic engineering includes: constructing OsFBX49 The invention relates to a gene overexpression vector, which is used to transform rice.

5. Use of the transgenic rice obtained by the method according to claim 3 or 4 in rice breeding.

6. The use according to claim 5, characterized in that The breeding methods include hybridization, backcrossing, self-pollination or asexual reproduction.