Application of osacr8 gene in breeding rice varieties with improved drought resistance
By using gene editing technology to change the function of the OsACR8 gene and constructing the mutant rice osacr8, the problem of poor growth of rice under drought conditions was solved, the drought resistance and survival rate of rice were improved, water loss and oxide accumulation were reduced, and drought resistance was enhanced.
Patent Information
- Application Number
- CN202411156765.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-22
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-08-22
AI Technical Summary
In the prior art, the role of the OsACR gene in rice's response to abiotic stress is unclear, resulting in poor growth and development of rice under drought conditions, affecting yield and drought resistance.
By knocking out or mutating the OsACR8 gene through gene editing technology, the mutant rice osacr8 was constructed to improve the drought resistance of rice. The specific method includes constructing an OsACR8 overexpression vector and using CRISPR/Cas9 technology to produce deoxynucleotide mutations, thereby changing the function of the OsACR8 gene.
The OsACR8 mutant rice significantly improved survival rate, reduced water loss, decreased hydrogen peroxide and superoxide anion accumulation, increased proline and soluble sugar content, and enhanced drought resistance under drought stress.
Smart Images

Figure CN119082170B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological genes and drought resistance of rice, and particularly relates to application of an OsACR8 gene in breeding of rice varieties with improved drought resistance. BACKGROUND
[0002] Rice is an important food crop, consumed as a staple food by more than half of the world's population. Rapidly changing climate patterns have affected normal agricultural productivity, threatening global food security. It is estimated that about one-third of the world's arable land is under drought stress, and rice under drought stress shows poor growth and development due to insufficient morphophysiological, biochemical and molecular responses. Therefore, it is of great significance to explore genes related to drought response in rice and elucidate their regulatory mechanisms for breeding drought-resistant rice with efficient use of water resources.
[0003] Rice yield is greatly threatened under drought conditions. Drought damages the morphophysiology of rice plants, inhibiting the growth and development of plants. It has been reported that drought stress has an impact on rice yield as high as 90%, depending on the intensity, duration and growth stage of the crop. Crop plants tend to avoid, escape, tolerate and recover from the effects induced by drought, which are collectively referred to as drought resistance. Some studies have divided plant responses to drought into drought avoidance, drought tolerance and drought recovery. Drought avoidance refers to the fact that the entire growth and development process of a plant does not encounter drought stress, and the plant escapes the harm of drought. Drought tolerance refers to the innate ability of a plant to sustain physiological and biochemical activities under water-deficient conditions, causing minimal damage to the plant. Drought recovery refers to the ability of a plant to recover metabolic activities and vigor after exposure to extremely high levels of drought stress and dehydration.
[0004] ACR proteins are highly conserved in plants, however, their functions are largely unknown. Based on previous studies, we found that ACR family plays an important role in plant abiotic stress. In Arabidopsis, plant hormones and abiotic stresses differentially regulate the expression of ACR1 to ACR8, in which the steady-state level of ACR8 mRNA is significantly increased under abscisic acid and salt treatment. ACR9 is involved in the regulation of early seedling growth and anthocyanin biosynthesis under high glucose (Glc) concentration. acr9 mutant is hypersensitive to ABA, and ACR9 may act upstream of the HXK1-SnRK1 signaling module to regulate early seedling development under high Glc concentration. ACR9 may also act as an inhibitor of Glc signaling to inhibit early seedling development independently of the HXK1-SnRK1 pathway. ACR11 interacts with Fd-dependent glutamate oxoglutarate aminotransferase (Fd-GOGAT1) and forms a protein complex. In acr11 mutant, Fd-GOGAT enzyme activity is significantly reduced. ACR11 also interacts with and activates chloroplast glutamine synthetase 2 (GS2). In addition, ACR11 is also involved in regulating the production of reactive oxygen species and salicylic acid-related immune response.
[0005] In general, although some reports show that ACR family is related to plant stress response, the role of OsACR gene in the response of rice to abiotic stress is unclear. SUMMARY
[0006] To overcome the problems in the related art, the purpose of the present application is to provide application of OsACR8 gene in breeding rice varieties with improved drought resistance. OsACR8 is of great significance to improve the drought resistance of rice and can be used as a new target for improving the drought resistance of rice.
[0007] The application of OsACR8 gene in improving the drought resistance of rice, the nucleotide sequence of the OsACR8 gene is shown as SEQ ID NO: 1, and the amino acid sequence of the encoded protein of the OsACR8 gene is shown as SEQ ID NO: 2.
[0008] In one embodiment, the drought resistance of mutant rice osacr8 obtained by mutation of the OsACR8 gene is enhanced. The improvement of the drought resistance of the mutant rice osacr8 improves the plant survival rate when responding to drought stress caused by nutrient soil dehydration, soil dehydration and PEG.
[0009] In the application, the drought resistance of the mutant rice osacr8 is improved, and when the rice PEG causes drought stress, the OsACR8 gene mutant rice plant osacr8 leaf closes more stomata, reduces water loss, reduces the accumulation of hydrogen peroxide and superoxide anion, and increases the proline content, soluble sugar content and reduces the malondialdehyde content.
[0010] In the preferred technical solution of the application, the mutant rice osacr8 is obtained by knocking out the OsACR8 gene of the rice through gene editing technology, or one or more deoxynucleotide mutations are generated at the coding region of the OsACR8 gene using gene editing technology.
[0011] In the preferred technical solution of the application, the rice is japonica rice.
[0012] In the preferred technical solution of the application, the japonica rice is Zhonghua 11.
[0013] The application has the following beneficial effects:
[0014] (1) The OsACR8 gene (the corresponding gene locus number corresponds to LOC_Os08g42100 published by Rice Genome Annotation Project) is cloned from the rice by the method of PCR. The OsACR8 gene is of great significance to improve the drought resistance of rice and can be used as a new target for improving the drought resistance of rice.
[0015] (2) Compared with the wild type, the survival rate of the OsACR8 gene mutant rice osacr8 after soil drought stress, soil drought stress and PEG simulated drought stress is significantly higher than that of the wild type plant, and the survival rate of the OsACR8 gene overexpression plant OE-OsACR8 is significantly lower than that of the wild type plant. It is inferred that OsACR8 negatively regulates the drought resistance of rice.
[0016] (3) The OsACR8 gene mutant rice osacr8 can improve the drought resistance of rice to PEG caused drought stress, and the leaf closes more stomata and reduces water loss.
[0017] (4) The OsACR8 gene mutant rice osacr8 can reduce the accumulation of hydrogen peroxide and superoxide anion when PEG causes drought stress.
[0018] (5) The OsACR8 gene mutant rice osacr8 can improve the drought resistance of the plant to PEG caused drought stress, increase the proline content, soluble sugar content and reduce the malondialdehyde content.
[0019] OsACR8 gene is a potential new target for the study of rice drought resistance mechanism. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 Figure 4 is the performance of OsACR8 mutant strain and overexpression strain under PEG simulated drought treatment. Wherein, Fig. a is the drought treatment phenotype diagram of wild type plant, overexpression strain OE-OsACR8 and mutant strain osacr8; Fig. b is the survival rate statistical result diagram of wild type plant, overexpression strain OE-OsACR8 and mutant strain osacr8 after drought treatment.
[0021] Figure 2 Figure 5 is the performance of OsACR8 mutant strain and overexpression strain under soil drought treatment. Wherein, Fig. a is the drought treatment phenotype diagram of wild type plant, overexpression strain OE-OsACR8; Fig. b is the drought treatment phenotype diagram of wild type plant, mutant strain osacr8; Fig. c is the survival rate statistical result diagram of wild type plant, overexpression strain OE-OsACR8 after drought treatment; Fig. d is the survival rate statistical result diagram of wild type plant, mutant strain osacr8 after drought treatment.
[0022] Figure 3 Figure 6 is the performance of OsACR8 mutant strain and overexpression strain under clay drought treatment. Wherein, Fig. a is the drought treatment phenotype diagram of wild type plant, overexpression strain OE-OsACR8; Fig. b is the drought treatment phenotype diagram of wild type plant, mutant strain osacr8; Fig. c is the survival rate statistical result diagram of wild type plant, overexpression strain OE-OsACR8 after drought treatment; Fig. d is the survival rate statistical result diagram of wild type plant, mutant strain osacr8 after drought treatment.
[0023] Figure 4 Figure 7 is the stomatal conductance analysis of wild type plant, overexpression strain OE-OsACR8 and mutant strain osacr8 after PEG simulated drought treatment. Wherein, Fig. a is a representative photo of completely closed, partially open and completely open stomata of rice leaves. Fig. b is the proportion of different stomata types. The data in the figure is the mean value ± standard deviation. *p<0.05, **p<0.01, ***p<0.001 indicates significant difference compared with WT, n=3.
[0024] Figure 5The wild type plant, overexpression line OE-OsACR8 and mutant line osacr8 were subjected to PEG simulated drought treatment for antioxidant activity detection. Fig. a is DAB staining, DAB staining is also called diaminobenzidine method, which is used to detect the active site of peroxidase in cells. Fig. b is NBT staining, NBT staining is also called nitro blue tetrazolium staining method, which is used to detect the active site of peroxidase and superoxide anion in cells.
[0025] Figure 6 The wild type plant, overexpression line OE-OsACR8 and mutant line osacr8 were subjected to simulated drought treatment for physiological index detection. Fig. a is proline content, Fig. b is soluble sugar content, and Fig. c is malondialdehyde content. DETAILED DESCRIPTION
[0026] Preferred embodiments of the present application will be described in more detail with reference to the drawings. Although preferred embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and to fully convey the scope of the present application to those skilled in the art.
[0027] Plant material: The test material of this study is japonica rice (Oryza sativa L.). The wild type (WT) is Zhonghua 11 (ZH11) (publicly available rice variety, commercially available). The plant overexpression vector pRHV was provided by the Wang Guoliang group of the Chinese Academy of Agricultural Sciences (the plant overexpression vector pRHVcGFP has been disclosed in the supplementary data of He F, Zhang F, Sun W, et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes [J]. Rice, 2018, 11(1): 27.); the genetic transformation of the above genetic material was constructed by Baige Gene Technology (Jiangsu) Co., Ltd.
[0028] Chemical reagents: PEG6000 was purchased from Shengong Bioengineering (Shanghai) Co., Ltd., NBT and DAB staining solution were purchased from Regen Biochemical Co., Ltd.; restriction endonuclease was purchased from New England Biolabs Co.; high-fidelity enzyme KOD FX was purchased from TOYOBO Co.; abm reverse transcription kit was purchased from abm Biotechnology Co., Ltd.; gel recovery kit and plasmid extraction kit were purchased from Jifan Biotechnology (Beijing) Co., Ltd.; 2x Taq PCR StarMix was purchased from Beijing Kangrunchengye Biological Technology Co., Ltd.
[0029] Nucleotide sequence of rice OsACR8:
[0030]
[0031] Amino acid sequence of the protein encoded by the rice OsACR8 gene:
[0032] MARSGGELVVVEEDDEYAKLVRRMNPPSVVIDNDSCDSATVIRVDRVKKHGILLEAVQVLVDLNLVITKAYISSDGNWFMDVFNVTDQDGNKVQNKEVTDCIKKCLESEDYLVLPASSPAGGAAPSEETTCIELTGTDRPGLLSEVCAVLASLRCNIVNAEVWTHDRRAAAVIQITDEATGLPVRDGGRLSQLQELLGNVMQGDGDGGGDSRKGSTAVSLGAANAERRLHRLMLDDGDAGRCGEERGGVAAAKAKAKVVVMDCTERRYTVVILRCRDRPRLLFDTLCALTDLHYVVFHGTVDAEGGSAKEAYQEYYVRHVDGHPVRCDAERLRLVRCLEAAVERRASDGLELEVKTEDRAGLLSEITRVFRENSLSIIRAVITTKDGEADDTFYVSDAYGNPVDGKAMEALGEQLGHAVLRVKSNGRAAINRAEDSGGGGAAAIIGNLLKGSFQGFRLIRSYS*.
[0033] Example 1: Construction of OsACR8 overexpression lines
[0034] The plant overexpression vector pRHVcGFP was provided by the Wang Guoliang group of the Chinese Academy of Agricultural Sciences (the plant overexpression vector pRHVcGFP has been disclosed in the supplementary data of He F, Zhang F, Sun W, et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes [J]. Rice, 2018, 11(1): 27.).
[0035] 1. Construction of pRHVcGFP-OsACR8 overexpression vector
[0036] (1) Amplification of target gene
[0037] The cDNA of WT leaf was taken as the template (operation according to the abm reverse transcription kit instruction), and the primers were designed according to the target gene (Table 1). The target gene was obtained by PCR amplification, and the amplification PCR system is shown in Table 2:
[0038] Table 1: Primers for PCR amplified target fragments
[0039]
[0040] Table 2: PCR reaction system for target gene
[0041] Reaction solution Volume (μL) template 2μL 2× KOD FX buffer 25 μL Primer OsCYP71K4-OE-F / R (10 μM) 1.5 μL 2mM dNTPs 10 μL High-fidelity enzyme KOD FX 1 μL ddH2O 9μL Total volume 50μL
[0042] The amplification procedure was as follows: pre-denaturation at 94°C for 5 min, denaturation at 98°C for 10 s, annealing at 55°C for 30 s, elongation at 68°C for 60 s, 32 cycles, total elongation at 68°C for 5 min, and keeping at 16°C for 1 min. After the reaction, 50 μL of the amplified product was added to 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel was imaged under a UV imaging instrument to detect whether the target band was amplified. If the target band was amplified, it indicated that the amplified fragment might contain the target gene. The target band was cut off for further gel recovery and purification of the product (operation according to the instructions of the gel recovery kit) and concentration determination.
[0043] (2) Preparation of linearized vector
[0044] Each 3 μg of the overexpression vector pRHVcGFP and the target gene was taken (operation according to the instructions of the plasmid extraction kit), and 37°C double enzyme digestion was performed for 20 min. The reaction systems of the overexpression vector pRHVcGFP and the target gene were shown in Table 3:
[0045] Table 3: Enzyme digestion reaction system
[0046] Reaction solution Dosage 10× CutSmart Buffer 5μL SacI endonuclease 1 μL kpnI endonuclease 1 μL Overexpression vector pRHVcGFP / target gene 3 μg Total volume make up with dd H2O to 50 μL
[0047] 50 μL of the reaction product was added to 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel was imaged under a UV imaging instrument. After the target band was separated, it was cut off for further gel recovery and purification of the product and concentration determination.
[0048] (3) Recombination reaction
[0049] 2×Hieff MultiS Enzyme Premix (derived from multi-fragment one-step rapid cloning kit, purchased from Shanghai Yisen Biotechnology Co., Ltd.) homologous recombinase will recombine the insert and the vector in proportion to obtain pRHVcGFP-OsACR8 overexpression vector. The optimal vector and insert molar ratio is 1: (2-3). These molar numbers correspond to the DNA mass that can be roughly calculated by the following formula: optimal vector usage X = [0.02 x vector base pair number] ng (0.03 pmol). Optimal insert usage Y = [0.04 x insert base pair number] ng (0.06 pmol) or = [0.06 x insert base pair number] ng (0.09 pmol). The recombination reaction system is as shown in Table 4:
[0050]
[0051] Table 4: Recombination reaction system
[0052] After the system is prepared, use a pipette to gently suck and beat each component to mix, centrifuge briefly to collect the reaction solution to the bottom of the tube. Place in a 50℃ reaction for 20 min. The reaction product can be directly transformed, or can be stored at -20℃, and thawed for transformation when needed.
[0053] (4) Recombination product transformation and plating
[0054] Thaw the clonal competent cells DH5α on ice. Take 10 μL of the cooled recombination product (containing pRHVcGFP-OsACR8 overexpression vector), add to 100 μL of competent cells, gently shake the tube wall several times to mix, and place on ice for 30 min; 42℃ heat shock for 60 s, ice bath incubation for 2 min, add 900 μL of LB medium, 37℃, 200 rpm, shake for 30 min, 5000 rpm centrifuge for 3 min, discard the supernatant. Resuspend the bacterial cells with the remaining medium, and gently spread them on a plate containing kan resistance with a sterile spreader. After the bacterial solution is absorbed, invert the plate and incubate at 37℃ overnight.
[0055] (5) Cloning identification
[0056] The most convenient and fastest method is colony PCR. Use a sterile gun or toothpick to pick a single colony into 500 μL of LB medium and mix well, directly take 1 μL as the PCR template, and the remaining bacterial solution is used for subsequent sequencing identification. The PCR reaction system is shown in Table 5.
[0057] Table 5: Colony PCR reaction system
[0058]
[0059]
[0060] The amplification procedure is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 25 cycles; 72℃ total extension for 5 min, 16℃ for 1 min. After the reaction, 20 μL of the amplification product is added to 1% agarose gel containing nucleic acid dye for electrophoresis; after electrophoresis, the gel is imaged under a UV imaging instrument to detect whether a band is amplified. If a band is amplified, the clone is sent to a sequencing company for sequencing (sequencing is completed by Guangzhou Qikexi Biotechnology Co., Ltd.), and the sequencing primer is:
[0061] UbiP-seq: TTTTAGCCCTGCCTTCATACGC;
[0062] GFP-seqR: AACTTGTGGCCGTTTACGTCG.
[0063] 2. Genetic transformation and identification of transgenic plants
[0064] The constructed pRHVcGFP-OsACR8 overexpression vector is sent to Baige Gene Technology Co., Ltd. for genetic transformation to obtain T0 generation plants. The obtained transgenic plants are identified, and since the pRHVcGFP-OsACR8 overexpression vector carries a HYG hygromycin marker, it is only necessary to determine whether it is a transgenic plant by identifying whether there is a hygromycin marker. The total genomic DNA of the plant to be tested is extracted, and primer HYG (Table 6) is used for PCR amplification. The size of the PCR product is determined by running agarose gel electrophoresis, and if it is consistent, it is a transgenic plant containing the target gene (i.e., an OsACR8 gene overexpression plant). The PCR amplification method refers to the steps (1) of the PCR reaction system and the PCR amplification procedure in the plant pRHVcGFP-OsACR8 overexpression vector construction method. After the reaction, 5 μL of the amplification product is added to 1% agarose gel containing nucleic acid dye for electrophoresis, and after electrophoresis, the gel is imaged under a UV imaging instrument to observe whether there is a target band. The T0 generation plants are selfed to obtain T1 generation plants, and the T1 generation plants are selfed to obtain T2 generation homozygous OsACR8 gene overexpression plants (OE-OsACR8).
[0065] Table 6: HYG identification primer
[0066]
[0067] In this embodiment, the OsACR8 gene is cloned from rice by PCR method, and the OsACR8 gene is of great significance for regulating rice grain development and can be used as a new target for improving rice grain traits. The OsACR8 gene is transformed into rice by genetic transformation, and a series of overexpression lines are screened. The phenotype of the overexpression lines is analyzed in detail.
[0068] Example 2: Construction of mutant lines
[0069] The osacr8 mutant was constructed according to the CRISPR / Cas9 technology described in Zeng D, Ma X, Xie X, et al. A protocol for CRISPR / Cas9-based multi-gene editing and sequence decoding of mutant sites in plants [J]. Scientia Sinica Vitae, 2018, 48(7): 783-794.
[0070] 1. Target sequence selection and primer design
[0071] The wild-type plant OsACR8 gene was used as the target site, with a 20-bp GTGAAGACGGAGGACAGGGC sequence. Primers were designed according to the target site. gRT2: TGAAGACGGAGGACAGGGCGTTTTAGAGCTAGAAAT; OsU3T2: TGAAGACGGAGGACAGGGCGTTTTAGAGCTAGAAAT; gRT1: GTGAAGACGGAGGACAGGGC; OsU6aT1: TGCATGACGTTGCCGAGGAGCggcagccaagccagca.
[0072] 2. Overlapping PCR
[0073] (1) First round of PCR. The purpose of this step is to introduce the target sequence downstream of the U3 / U6 promoter and upstream of the sgRNA sequence, respectively.
[0074] 2x Phanta Max Buffer 7.5 μl; 10 mM dNTPs Mix 0.25 μl; Phanta Max Polymerase 0.2 μl; YLgRNA-U6 / U3 2-5 ng; 10 μM U-F and U-T each 0.3 μl (reaction 1); 10 μM gR-T and gR-R each 0.3 μl (reaction 2); ddH2O to 15 μl; 25-26 PCR cycles: 95°C for 10 s, 58°C for 15 s, 72°C for 15 s. Take 3-5 μl of PCR product and check with 1.5% agarose gel electrophoresis (reaction 2 product length is about 140 bp). If the amplification product is weak, the second round of PCR can also be continued.
[0075] (2) The second round of PCR. The purpose of this step is to construct the complete expression cassette of the promoter, target and sgRNA. According to the two targets, the two pairs of primers Pps-R / Pgs-2, Pps-2 / Pgs-L are synthesized, and the universal primer pair is mixed into a working solution (10 μM each) in advance. In the second round of PCR, 30 μl of each expression cassette is selected, 1 μl of the products of reactions 1 and 2 in the first round of PCR is added to 8 μl of ddH2O to mix and dilute 10 times, and 1 μl is taken as the template for the second round of PCR. 3 μl of the PCR product is electrophoresed for examination, and the approximate concentration of the sample is estimated. According to the concentration of the second round of PCR fragments of each expression cassette, all the expression cassette fragments are mixed in approximately equal amounts, and purified with a PCR product purification kit. Pps-R: TTCAGAggtctcTaccgACTAGTCACGCGTATGGAATCGGC AGCAAA; Pgs-2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC; Pps-2: TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG; Pgs-L: AGCGTGggtctcGctcgACGCGTATCCATCCACTCCAAGC.
[0076] 3. Cloning of sgRNA expression cassette into pYLCRISPR / Cas9 vector
[0077] This step uses the "Golden Gate" cloning method based on BsaI digestion and ligation to assemble the sgRNA expression cassette into the pYLCRISPR / Cas9 vector in a "cut and connect" manner. Prepare a 15 μl reaction system: 10x CutSmart Buffer 1.5 μl; 10 mM ATP 1.5 μl (1.5 μl of 10x T4 DNA ligase buffer can also be added instead of ATP); pYLCRISPR / Cas9 plasmid 60-80 ng; purified mixed sgRNA expression cassette 10-15 ng per expression cassette, a total of 20-30 ng for 2 targets; BsaI-HF 10 U; T4 DNA ligase 35 U; ddH2O to 15 μl. Perform the cut and connect reaction using variable temperature cycling (PCR instrument can be used) for 10-15 cycles (37°C for 5 min, 10°C for 5 min, 20°C for 5 min); finally 37°C for 5 min.
[0078] 4. Recombination reaction and transformation
[0079] The method is the same as that for constructing the overexpression vector.
[0080] 5. Genetic transformation and identification of transgenic plants
[0081] The constructed CRISPR / Cas9-OsACR8 vector is sent to the Biogiga Gene Technology Co., Ltd. for genetic transformation to obtain T0 generation plants. The obtained transgenic plants are identified. Since the CRISPR / Cas9-OsACR8 vector carries a HYG hygromycin tag, it is only necessary to determine whether it is a transgenic plant by identifying whether there is a hygromycin marker. The detection method is the same as that of the overexpression material identification in the above. After the PCR amplification program is completed, 5 μL of the amplification product is added to a 1% agarose gel containing a nucleic acid dye for electrophoresis. After electrophoresis, the gel is imaged on an ultraviolet imager to observe whether there is a target band. The remaining PCR stock solution is sent to a sequencing company for sequencing and compared with the wild type nucleotide sequence to determine the mutation type of the mutant. The T0 generation plants are selfed to obtain T1 generation plants. At this time, it is necessary to detect whether the plants carry the CRISPR / Cas9 vector. The T1 generation seeds are harvested from the plant lines selected without the vector. The T1 generation plants are selfed to obtain T2 generation homozygous mutant plants osacr8.
[0082] Example 3: PEG drought stress phenotype analysis
[0083] The wild type (WT), OsACR8 mutant strain (osacr8), and OsACR8 overexpression strain (OE-OsACR8) of Oryza sativa japonica are sowed in the farm of South China Agricultural University in Guangzhou, Guangdong Province. After the seeds are harvested, the plants are subjected to polyethylene glycol 6000 (PEG6000) simulated drought stress.
[0084] The mutant rice osacr8 is obtained by knocking out the OsACR8 gene of Oryza sativa using gene editing technology or by generating one or more deoxynucleotide mutations in the coding region of the OsACR8 gene using gene editing technology.
[0085] Tested rice: wild type, osacr8, and OE-OsACR8
[0086] The specific steps are as follows: freshly germinated wild type, osacr8, and OE-OsACR8 seeds are placed in a 96-well plate with holes at the bottom, one seed per well, and three lines for each strain. Then, the seeds are cultured in a culture box containing rice nutrient solution at 28°C under light (16 hours of light / 8 hours of darkness). After the rice seedlings grow to 2 weeks old, they are treated with 20% polyethylene glycol 6000 (PEG6000) for 5 days to simulate drought, and then rice nutrient solution is added for 7 days of recovery. The survival and death of seedlings of each strain are counted, and the survival rate is calculated. Each rice variety is repeated three times.
[0087] The results are shown in Table 1. Figure 1 Figure 1 Scale bar, 5 cm. Each rice variety was repeated three times, and different letters represent p < 0.05, n = 3. Phenotype analysis found that the growth state of wild type, osacr8, OE-OsACR8 before treatment was consistent, and wild type, osacr8, OE-OsACR8 all appeared different degrees of damage after rehydration after drought treatment. Compared with WT, but the damage degree of osacr8 plant was lighter, and the damage degree of OE-OsACR8 plant was heavier Figure 1 a) The survival rate of wild type was 35%-45%, the survival rate of osacr8 mutant plant was 80%-90%, which was significantly higher than that of wild type, and the survival rate of OE-OsACR8 overexpression plant was about 20%, which was significantly lower than that of wild type Figure 1 b) It is shown that the mutation of osacr8 improves the drought tolerance of rice under drought stress, and OE-OsACR8 overexpression reduces the drought tolerance of rice under drought stress. It is inferred that OsACR8 negatively regulates the drought resistance of rice.
[0088] Example 4: Nutrient soil drought stress phenotype analysis.
[0089] The present application sowed japonica rice varieties wild type (WT), OsACR8 mutant plant (osacr8), and OsACR8 overexpression plant (OE-OsACR8) in Guangzhou, Guangdong Province, and planted them in pots after harvesting to perform nutrient soil drought stress.
[0090] Tested rice: wild type, osacr8, OE-OsACR8
[0091] The specific steps are as follows: just emerged wild type, osacr8, and OE-OsACR8 seeds are planted in moist nutrient soil, 15 seedlings of each variety are planted, and 28°C light culture (16 hours light / 8 hours dark) is performed. When the rice seedlings grow to 4 weeks old, stop watering, drought treatment for 7 days, and then add rice nutrient solution for 7 days. Count the survival and death of seedlings of each variety, and calculate the survival rate. Each rice variety is repeated three times.
[0092] The results are shown in Figure 2 Figure 2 Scale bar, 5 cm. Each rice variety was repeated three times, and different letters represent p < 0.05, n = 3. Phenotype analysis found that the growth state of wild type, osacr8, OE-OsACR8 before treatment was consistent, and wild type, osacr8, OE-OsACR8 all appeared different degrees of damage after rehydration after drought treatment. Compared with WT, but the damage degree of osacr8 plant was lighter, and the damage degree of OE-OsACR8 plant was heavier Figure 2 a) The survival rate of wild type was about 60%, the survival rate of osacr8 mutant plants was about 90%, which was significantly higher than that of wild type, and the survival rate of OE-OsACR8 overexpression plants was about 20% (b), which was significantly lower than that of wild type. It shows that the mutation of osacr8 improves the tolerance of rice under drought stress, and OE-OsACR8 overexpression reduces the tolerance of rice under drought stress. It is inferred that OsACR8 negatively regulates drought resistance of rice. Figure 2 b), which was significantly lower than that of wild type. It shows that the mutation of osacr8 improves the tolerance of rice under drought stress, and OE-OsACR8 overexpression reduces the tolerance of rice under drought stress. It is inferred that OsACR8 negatively regulates drought resistance of rice.
[0093] Example 5: Phenotype analysis of soil drought stress.
[0094] The present application sowed japonica rice varieties wild type (WT), OsACR8 mutant plants (osacr8), OsACR8 overexpression plants (OE-OsACR8) in Guangzhou, Guangdong Province, and then planted in pots for soil drought stress.
[0095] Tested rice: wild type, osacr8, OE-OsACR8
[0096] The specific steps are as follows: just after germination, wild type, osacr8, and OE-OsACR8 seeds are sowed in the field, and the soil just covers the germinated seeds. A plastic film is covered to keep warm and humidify. The seedlings are cultivated for about 15 days. When the seedlings grow to about 10 cm, they are transplanted. Each variety has 15 seedlings. Natural light and temperature are used for cultivation. When the rice seedlings grow to the tillering and jointing transition period, stop watering. After 15 days of drought treatment, add tap water to restore for 7 days. The survival and death of seedlings of each variety are counted, and the survival rate is calculated. Each rice variety is repeated three times.
[0097] The results are shown in Figure 3 , the scale is 5 cm. Each rice variety is repeated three times, different letters represent p<0.05, n=3. Phenotype analysis shows that wild type, osacr8, and OE-OsACR8 all appear different degrees of damage after drought treatment and rehydration. Compared with WT, but the damage degree of OE-OsACR8 plants is heavier, and the damage degree of osacr8 plants is lighter Figure 3 a) The survival rate of wild type was about 60%, the survival rate of osacr8 mutant plants was about 90%, which was significantly higher than that of wild type, and the survival rate of OE-OsACR8 overexpression plants was about 20% (b), which was significantly lower than that of wild type. It shows that the mutation of osacr8 improves the tolerance of rice under drought stress, and OE-OsACR8 overexpression reduces the tolerance of rice under drought stress. It is inferred that OsACR8 negatively regulates drought resistance of rice. Figure 3 Figure 3
[0098] Example 6: Physiological index determination after PEG treatment
[0099] The present application sowed japonica rice varieties wild type (WT), OsACR8 mutant strain (osacr8), OsACR8 overexpression strain (OE-OsACR8) in Guangdong Province Guangzhou South China Agricultural University farm, and then performed phenotype under PEG6000 (PEG6000) simulated drought stress after sowing.
[0100] Rice to be tested: wild type, osacr8, OE-OsACR8.
[0101] The specific steps are as follows: just after germination, wild type, osacr8, and OE-OsACR8 seeds are placed in a 96-well plate with holes at the bottom, one seed is placed in each well, and three strains are placed in three columns, then placed in a culture box containing rice nutrient solution, cultured at 28°C with light (16 hours light / 8 hours dark), and sampled after 6 hours of simulated drought treatment with 20% PEG6000 (PEG6000) when the rice seedlings grow to 2 weeks old. Detection is performed using proline (PRO) test kit, plant malondialdehyde (MDA) test kit, and plant soluble sugar kit (proline (PRO) test kit (item number A107-1-1), plant malondialdehyde (MDA) test kit (item number A003-3-1), plant soluble sugar kit (item number A145-1-1) are all purchased from Nanjing Jiancheng Biological Engineering Institute). Each rice variety is repeated three times.
[0102] Proline (Pro) is one of the components of plant proteins and widely exists in the plant body in a free state. Under drought, salinity and other stress conditions, a large amount of proline accumulates in many plant bodies. In addition to being an osmotic regulator in plant cytoplasm, accumulated proline also plays an important role in stabilizing the structure of biological macromolecules, reducing cell acidity, relieving ammonia toxicity, and regulating cell oxidation and reduction potential as an energy reservoir. Under adverse conditions such as drought, salinity, heat, cold, and freezing, the content of proline in the plant body increases significantly. The content of proline in the plant body reflects the plant's resistance to adversity to some extent, and varieties with strong drought resistance tend to accumulate more proline. Therefore, determining the content of proline can be used as a physiological index for drought-resistant breeding. Similarly, the same is true for soluble sugar content. Malondialdehyde (MDA) can be used to measure the extent of damage to plant cell membranes under abiotic stress. This index is related to membrane damage, and the greater the value of malondialdehyde (MDA), the greater the damage to the cell membrane.
[0103] Results are as follows Figure 4Each rice variety was repeated three times. Different letters indicate p < 0.05, n = 3. In OE-OsACR8 overexpression plants after drought treatment, proline and soluble sugar contents were significantly down-regulated; while in mutant osacr8, proline and soluble sugar contents were significantly up-regulated. At the same time, compared with wild type (WT), the content of MDA accumulation in mutant osacr8 was significantly reduced, indicating that the damage was lower than that of WT.
[0104] The above results show that the higher proline content and soluble sugar content and lower MDA accumulation in mutant osacr8 confirm that OsACR8 negatively regulates drought resistance in rice at the physiological level. The results of this example verify that osacr8 can improve the resistance of plants, especially rice, to drought stress caused by PEG, increase proline content, soluble sugar content, and reduce malondialdehyde content accumulation.
[0105] Example 7: Analysis of stomatal conductance of plant leaves after PEG treatment
[0106] Rice to be tested: wild type, osacr8, OE-OsACR8.
[0107] The specific steps are as follows: after wild type, osacr8, and OE-OsACR8 rice seedlings are cultured for 5 weeks, the rice is treated with PEG to simulate drought for 3 days, and the same part of the flag leaf of the rice is cut and stored in glutaraldehyde. The specific method is referred to the sample processing method of the scanning electron microscope. Then the sample is prepared by alcohol fractionation dehydration, gold spraying, and mounting on the stage, and the opening and closing of the stomata of the rice leaves are observed by scanning electron microscope, photographed, and counted.
[0108] As shown in Figure 5 , the proportion of completely open stomata, the proportion of partially open stomata, and the proportion of completely closed stomata of OE-OsACR8 leaves under normal conditions were not different from those of wild type leaves. Compared with normal culture conditions, the proportion of completely open stomata of wild type rice leaf stomata decreased after PEG treatment, and the number of completely closed stomata increased. The number of completely closed stomata of OE-OsACR8 leaves was less after PEG treatment, and the proportion of partially open stomata was significantly higher than that of wild type. The proportion of completely open stomata of osacr8 leaves under normal conditions was significantly lower than that of wild type, and the proportion of completely open and partially open stomata of osacr8 leaves after PEG treatment was significantly lower than that of wild type, and the number of completely closed stomata was higher than that of wild type Figure 5 b). The results show that osacr8 mutant leaves can close more stomata after PEG stress treatment, and the number of completely open and partially open stomata is less. The osacr8 mutant enhances drought resistance by controlling stomatal conductance to reduce water consumption.
[0109] Example 8: DAB and NBT staining analysis of rice leaves after PEG treatment
[0110] Rice to be tested: wild type, osacr8, OE-OsACR8.
[0111] The specific steps are as follows: just after germination, wild type, osacr8, OE-OsACR8 seeds are placed in a 96-well plate with holes at the bottom, one seed in each well, and five columns for each of the two strains, and then placed in a culture box containing rice nutrient solution and cultured at 28°C with light (16 hours of light / 8 hours of darkness). When the rice seedlings grow to 2 weeks old, they are treated with 20% polyethylene glycol 6000 (PEG6000) for 24 hours to simulate drought. The samples are dyed according to the operation instructions of the NBT dyeing solution test box (item number DP0035) and the DAB dyeing solution test box (item number DP0041). Each rice variety is repeated three times.
[0112] (1) As shown in Table 1, under normal culture conditions, the leaves of wild type, osacr8, and OE-OsACR8 plants showed no obvious difference after DAB staining, and all appeared white after decolorization. After PEG simulation of drought treatment, compared with WT, OE-OsACR8 plant leaves accumulated more dark brown spots, and osacr8 plant leaves had significantly fewer dark brown spots than WT. The results showed that osacr8 plant leaves accumulated significantly less catalase than wild type after PEG treatment, and the leaves produced less reactive oxygen species; OE-OsACR8 plant leaves accumulated significantly more catalase than wild type after PEG treatment, and the leaves produced more reactive oxygen species. Figure 6 (2) After NBT staining under normal culture conditions, the leaves of wild type, osacr8, and OE-OsACR8 plants showed no obvious difference, and all appeared white after decolorization. After PEG simulation of drought treatment, compared with WT, OE-OsACR8 plant leaves accumulated more blue spots, and osacr8 plant leaves had significantly fewer blue spots than WT. The results showed that osacr8 plant leaves accumulated significantly less superoxide anion than wild type after PEG treatment, and the leaves produced less reactive oxygen species; OE-OsACR8 plant leaves accumulated significantly more superoxide anion than wild type after PEG treatment, and the leaves produced more reactive oxygen species.
[0113] In the above two staining experiments, the fewer the staining spots, the stronger the plant's ability to scavenge reactive oxygen species and the lower the damage the plant suffers. It can be seen that osacr8 mutant plants suffer less damage than WT under drought conditions, and OE-OsACR8 plant leaves suffer more damage than WT. This indicates that osacr8 mutant plants improve rice drought tolerance by improving antioxidant capacity.
[0114]
[0115] The foregoing merely illustrates the principles of the application and applies only to the particular cases described and illustrated herein. Those skilled in the art will readily devise many other ways of implementing the application without departing from the scope of the application. All statements herein reciting principles, aspects, and embodiments of the application, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents as well as equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present application should not be limited by the embodiments set forth in the examples, but should be given the broadest possible interpretation accessible under the statutes.
[0116] The application may, of course, be carried out in other ways than those specifically set forth herein without departing from essential characteristics of the application. The present embodiments are to be considered in all respects as illustrative and not restrictive, and all changes coming within the meaning and equivalency range of the appended claims are intended to be embraced therein.
Claims
1. Application of knockout of OsACR8 gene in breeding rice varieties with improved drought resistance, characterized by: The nucleotide sequence of the OsACR8 gene is shown in SEQ ID NO:
1.
2. The use of the knockout OsACR8 gene according to claim 1 in breeding rice varieties with improved drought resistance, characterized in that: The amino acid sequence of the protein encoded by the OsACR8 gene is shown in SEQ ID NO:
2.
3. The use of the knockout OsACR8 gene according to claim 1 in breeding rice varieties with improved drought resistance, characterized in that: By knocking out the OsACR8 gene, a rice mutant osacr8 was obtained.
4. The use of the knockout OsACR8 gene in breeding rice varieties with improved drought resistance according to claim 3, characterized in that: The mutant rice osacr8 is obtained by knocking out the OsACR8 gene of rice through gene editing technology, or by generating more than one deoxynucleotide mutation in the coding region of the OsACR8 gene of rice using gene editing technology.
5. Use of the knockout OsACR8 gene according to any one of claims 1 to 4 in breeding rice varieties with improved drought resistance, characterized in that: The rice is japonica rice.
6. The use of the knockout OsACR8 gene in breeding rice varieties with improved drought resistance according to claim 5, characterized in that: The japonica rice is Zhonghua No. 11.
Citation Information
Patent Citations
Application of OsDRS1 gene in improvement of drought resistance of rice
CN118389570A
Drought tolerant plants
US20150156978A1