Application of ZmGAD gene and InDel molecular marker in regulating GABA content in corn root system

Abstract

The present application relates to molecular markers and their applications, in particular to the application of ZmGAD gene and InDel molecular marker in regulating GABA content of corn root system.The molecular marker ZmGAD-INDEL10842 provided by the present application has the characteristics of stable amplification, high detection efficiency, etc., and provides effective marker resources for molecular marker assisted breeding of GABA content of corn root system, and can promote genetic improvement of stress resistance of corn and help cultivation of new corn varieties with high yield.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of crop selection and breeding, and particularly relates to application of a ZmGAD gene and an InDel molecular marker in regulating GABA content in corn roots. BACKGROUND

[0002] As one of the most important food crops in the world, the yield and quality of corn have always been the focus of agricultural scientists. With the rapid development of bioinformatics technology, genome-wide association study (GWAS) has become a hot topic in genomics research in recent years. By testing the significance of the association between genetic markers and phenotypic variation throughout the genome, genetic loci associated with traits are located, and the genetic basis of traits is analyzed at the population level, which can provide a theoretical basis and reference for crop trait genetic improvement and molecular marker-assisted breeding.

[0003] Roots are not only the main organs for water and nutrient absorption, but also can adapt to changing soil environments by regulating root architecture, synthesizing or secreting hormones, organic acids, and enzymes and other substances. Corn root development quality is an important factor affecting corn stress resistance. Gamma-aminobutyric acid (GABA) is a non-protein amino acid commonly found in plants, which is recognized as an endogenous plant signaling molecule and is involved in various physiological and biochemical reactions, as well as signal transduction, nitrogen metabolism, osmotic regulation, and antioxidant stress protection. GABA can directly or indirectly improve the stress resistance of plants and alleviate the damage of abiotic stress to plants. At present, there are few reports on sites and genes related to GABA content in corn roots, and there is no related report on target sites. Therefore, it is of great significance to mine stable major loci of GABA content in corn roots, develop functional markers, and use them for breeding to accelerate the breeding of new corn varieties with stress resistance. SUMMARY

[0004] To solve the above technical problems, the application provides application of a ZmGAD gene and an InDel molecular marker in regulating GABA content in corn roots, which can be widely used for identifying GABA content in corn roots to be tested and accelerating the breeding process.

[0005] The technical scheme provided by the application is as follows:

[0006] The application provides application of a corn ZmGAD gene in regulating corn root growth, wherein the nucleotide sequence of the corn ZmGAD gene is shown in SEQ ID NO. 1; or a nucleotide sequence generated by adding, substituting or deleting one or more bases to the nucleotide sequence shown in SEQ ID NO. 1, and encoding a corn ZmGAD protein.

[0007] Further, the corn ZmGAD gene is as follows (a) or (b):

[0008] (a) a protein consisting of the amino acid sequence shown in SEQ ID No. 2;

[0009] (b) a protein derived from SEQ ID No. 2 by substitution and / or addition and / or deletion of one or several amino acid residues of the sequence shown in SEQ ID No. 2.

[0010] Further, the regulation of the corn root growth comprises regulation of the corn root length, L-glutamic acid content and GABA content of the root.

[0011] The application also provides a method for promoting corn root growth, wherein the CDS sequence of the corn ZmGAD gene is constructed into a plant expression vector, transformed into a target plant, and a positive overexpression transgenic corn is obtained; the transgenic corn has higher yield compared with the target plant, and the nucleotide sequence of the corn ZmGAD gene is shown in SEQ ID No. 1.

[0012] Further, the promotion of the corn root growth comprises increasing the corn root length and GABA content, and reducing the L-glutamic acid content of the root.

[0013] The application also provides a molecular marker related to the GABA content of the corn root. The sequence of the molecular marker is shown in SEQ ID No. 1, and the polymorphism at the 628th position of SEQ ID No. 1 is deletion or CT, and the insertion / deletion is located in the 4th exon region of the ZmGAD gene.

[0014] Further, in the Indel site of the molecular marker, the corn root GABA content of the base deletion type is higher than that of the insertion type base.

[0015] The application also provides the above-mentioned molecular marker primer related to the GABA content of the corn root, and the sequence of the primer is as follows:

[0016] ZmGAD-INDEL10842-Fg: 5'-GAAGGTGACCAAGTTCATGCTTCGCGGCCATCCTCG-3';

[0017] ZmGAD-INDEL10842-Ft: 5'-GAAGGTCGGAGTCAACGGATTTGTGGCGGCCATCCTCT-3';

[0018] ZmGAD-INDEL10842-R: 5'-TCCTCGAACTCGCCGTTC-3.

[0019] The application also provides application of the above-mentioned molecular marker related to GABA content of corn root system or the above-mentioned primer in identification of GABA content of corn root system and breeding of corn varieties with developed root system.

[0020] The application also provides a method for breeding corn varieties with developed root system, comprising the following steps: performing PCR amplification on DNA of a corn variety to be tested to obtain a PCR product, using the above-mentioned primer as an amplification primer, reading a fluorescence signal after the amplification is completed, and obtaining a genotype result; and breeding corn plants of a gene deletion type.

[0021] A molecular marker related to GABA content of corn root system is named ZmGAD-INDEL10842, which is an ARMS marker. The marker is obtained by amplification of two forward primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 and one reverse primer shown in SEQ ID NO: 3. The forward primers of SEQ ID NO: 1 and SEQ ID NO: 2 are combined with FAM and HEX fluorescence groups at the 5' end, respectively. In fluorescence detection, if the detected fluorescence signal is blue, it indicates that the base deletion (--) type of the Indel site; if the fluorescence signal is green, it indicates that the base of the Indel site is insertion (CT) type.

[0022] According to the variation site, the test population is divided into two types, and the two types are significantly different in L-glutamic acid content, ZmGAD gene expression amount and root system traits. Among them, the base deletion (--) of the Indel site is identified as an excellent type of the corn ZmGAD gene.

[0023] Beneficial effects

[0024] Based on whole genome association analysis, the application finds a new significant association site of GABA content of corn root system and develops a molecular marker ZmGAD-INDEL10842 for regulating GABA content of corn root system, which can be widely used for identification of GABA content of corn root system to be tested and can accelerate the breeding process.

[0025] The molecular marker ZmGAD-INDEL10842 provided by the application has the characteristics of stable amplification and high detection efficiency, provides effective marker resources for molecular marker assisted breeding of GABA content of corn root system, and can promote genetic improvement of the stress resistance of corn and help breeding of new corn varieties with high yield.

[0026] By applying the molecular marker ZmGAD-INDEL10842 related to the GABA content of corn provided by the present application, it can be determined whether the synergistic variation of the GABA site of the corn variety (line) to be tested exists, greatly improving the selection efficiency and quality of the corn variety (line), minimizing costs, and directly realizing the identification of the target trait site in corn germplasm resources and breeding offspring, thereby providing a reliable molecular marker for corn molecular marker-assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 Figure 1 is a diagram showing the mQTL mapping of GABA and L-glutamic acid content on chromosome 1 of corn, the distribution of ZmGAD genes, the relationship between gene expression and metabolite abundance, and the comparison of phenotypes and root characteristics of different genotypes and materials (including wild type, knockout and overexpression materials). (A) mQTL mapping diagram of γ-aminobutyric acid (GABA) content in the root system on chromosome 1 of corn; (B) mQTL mapping diagram of L-glutamic acid content in the root system on chromosome 1 of corn; (C) distribution and location of ZmGAD genes on chromosome 1 of corn; (D) relationship between gene expression level and GABA abundance; (E) relationship between gene expression level and L-glutamic acid abundance; (F) changes in various indicators between two genotypes (CC and TT); (G) difference in GABA abundance between ZmGAD wild type and knockout material sample groups; (H) difference in GABA abundance between ZmGAD wild type and overexpression material sample groups; (I) difference in root L-glutamic acid content between different sample groups; (J) comparison photos of ZmGAD wild type and knockout mutant materials; (K) difference in root length between ZmGAD wild type and knockout mutant; (L) comparison photos of ZmGAD wild type and overexpression materials; (M) difference in root length between ZmGAD wild type and overexpression materials.

[0028] Figure 2 Figure 2 is a diagram showing the association of ZmGAD gene variation with GABA and L-glutamic acid, haplotype difference analysis caused by InDel10842, and structural changes caused by the variation of ZmGAD. (A) Regional Manhattan plot showing the association of genetic variation of ZmGAD with GABA, L-glutamic acid and ZmGAD expression in corn inbred lines. The ZmGAD gene structure diagram is shown. The gray dashed line indicates the significance p value threshold (p = 2.278 x 10^-5). Significant variations associated with GABA, L-glutamic acid and ZmGAD expression are highlighted in red, blue and green, respectively. InDel10842 is marked with a red dashed line. (B) Structural variation diagram showing the changes caused by 2 base insertions. The structure is predicted by the NCBI conserved domain search service, showing the ZmGAD - -contains a glutamate decarboxylase (GAD) domain. The red line indicates the position of InDel 10842. This insertion results in a premature stop of translation and disrupts the glutamate decarboxylase domain. (C) Haplotypes of ZmGAD in the natural variation population are shown according to InDel 10842. Box plots show GABA content, L-glutamate content, ZmGAD expression, and total root length (TRL) for each haplotype. n indicates the number of maize inbreds in each haplotype. Comparisons were made using two-sided Student's t tests, and p values are indicated.

[0029] Figure 3 Typing map for ZmGAD-INDEL 10842 site-specific primer linkage to FAM fluorescent group. DETAILED DESCRIPTION

[0030] Example 1

[0031] Validation of candidate genes

[0032] Root samples of 273 maize inbred lines were subjected to non-targeted metabolome determination, and a total of 406 metabolites were identified. Using 300,877 high-quality SNPs obtained from transcriptome data, genome-wide association analysis was performed on 406 root metabolites. Through GWAS, mQTLs associated with root metabolites (GABA and L-glutamate) were determined, and combined with transcriptome data, eQTLs of ZmGAD were identified. The correlation between the abundance of GABA, L-glutamate and the expression of ZmGAD was evaluated using ANOVA. A hot spot of mQTLs with linkage variation was found on chromosome 1, which was associated with GABA and L-glutamate. There were 3 overlapping mQTLs between L-glutamate and GABA, and based on information such as gene sequence variation, gene expression and functional annotation, the candidate gene was determined to be ZmGAD, which encodes glutamate decarboxylase, a key enzyme for catalyzing the conversion of L-glutamate to GABA. The eGWAS results of ZmGAD showed that the eQTLs of ZmGAD coding region (including S1_269571758, S1_269571776 and S1_269571900) overlapped with the mQTLs associated with L-glutamate and GABA. The expression level of ZmGAD was significantly correlated with the abundance of GABA and L-glutamate. The peak SNP (S1_269571758) was located in the 7th exon of ZmGAD, and according to the variation site, the test population was divided into two types, and there were significant differences in GABA content, L-glutamate content, ZmGAD gene expression and root traits between the two types of samples. Among them, cytosine (C) and thymine (T) were associated with high and low abundance of GABA, respectively. Inbred lines with C alleles had lower L-glutamate abundance than inbred lines with T alleles. The expression level of ZmGAD in inbred lines carrying C alleles was significantly higher than that in inbred lines carrying T alleles (P = 1.163 × 10-41). In addition, we observed that the TRL in inbred lines with C alleles was significantly longer than that in inbred lines with T alleles. The SNP site of ZmGAD gene showed significant correlation between GABA and L-glutamate, indicating that the gene plays an important role in the metabolic regulation of maize roots. The identified C allele is associated with better root traits and metabolite abundance, providing a genetic basis for the improvement of maize. Therefore, further study of the performance of ZmGAD under different environmental conditions and its application in maize variety improvement has important value.

[0033] Example 2

[0034] Functional analysis

[0035] We verified the function of ZmGAD using mutants generated by CRISPR / Cas9, which have three independent lines with specific genetic modifications, including deletion, 5bp deletion and insertion. We also generated 4 transgenic plants overexpressing ZmGAD driven by the maize ubiquitin promoter. For the overexpression construct, the ZmGAD coding sequence from B73 was cloned into the pBCXUN vector and driven by the maize Ubiquitin 1 promoter. These fusion vectors were transformed into immature embryos of maize inbred line ND101 by Agrobacterium-mediated transformation. Subsequently, RT-qPCR was performed to determine the expression levels of the ZmGAD overexpression lines. The nucleotide sequences of all primers used to isolate the overexpression ZmGAD overexpression lines are as follows:

[0036] ZmGAD-CRISPR-F: AGCACGCAAAGCCAGCAA (SEQ ID NO. 3);

[0037] ZmGAD-CRISPR-R: AAGGACGCCAGGTTCAGC (SEQ ID NO. 4);

[0038] Actin-F: GTGTCCTGTCCACCCACTCTCT (SEQ ID NO. 5);

[0039] Actin-R: GGAACTCGTTCACATCAACGTTC (SEQ ID NO. 6);

[0040] ZmGAD-OE-F: GCTACTACGTCATGGACCCG (SEQ ID NO. 7);

[0041] ZmGAD-OE-R: GAAGTCCCACTCCAGTTCCG (SEQ ID NO. 8);

[0042] Quantitative RT-PCR (reverse transcription polymerase chain reaction) analysis showed that the expression level of ZmGAD in the overexpression line was 2-5 times higher than that in the wild type. Compared with the wild type, the GABA content in the roots of the ZmGAD knockout line decreased by about 75.51%; while the GABA content in the ZmGAD overexpression line increased significantly, about 36 times of the wild type, the L-glutamic acid content decreased by 50.36%, and the root length increased by 17.31%. These results showed that ZmGAD played a key role in regulating the levels of GABA and L-glutamic acid and root growth. Loss of function led to inhibition of GABA synthesis, resulting in accumulation of L-glutamic acid as a precursor in vivo. While overexpression of ZmGAD increased the efficiency of GABA synthesis and reduced the content of L-glutamic acid. In addition, the importance of ZmGAD to root development was also demonstrated, the root length of the ZmGAD knockout line was shorter than that of the wild type, while the root length of the ZmGAD overexpression line was longer. These results confirmed that ZmGAD is a positive regulator of GABA accumulation and affects the development of corn roots.

[0043] Example 3

[0044] Application of molecular markers

[0045] 1. Development of KASP molecular markers for SNP1 site of ZmGAD

[0046] For the SNP1 site of the corn root GABA content gene ZmGAD, three primers were designed to develop ARMS (Allele-Specific PCR, AS-PCR) molecular markers. The three primers include two specific upstream primers and one specific downstream primer, the two upstream primers are respectively ZmGAD-INDEL10842-Fg and ZmGAD-INDEL10842-Ft, and the downstream primer is ZmGAD-INDEL10842-R. The developed ARMS molecular marker is ZmGAD-INDEL10842. The nucleotide sequences of the three primers are as follows:

[0047] ZmGAD-INDEL10842-Fg:

[0048] 5'-GAAGGTGACCAAGTTCATGCTTCGCGGCCATCCTCG-3' (SEQ ID NO. 9);

[0049] ZmGAD-INDEL10842-Ft:

[0050] 5'-GAAGGTCGGAGTCAACGGATTTGTGGCGGCCATCCTCT-3' (SEQ ID NO. 10);

[0051] ZmGAD-INDEL10842-R:

[0052] 5'-TCCTCGAACTCGCCGTTC-3(SEQ ID NO. 11).

[0053] In order to detect the PCR amplification product by fluorescence reader, the FAM fluorescent group is combined at the 5' end of the upstream primer ZmGAD-INDEL10842-T, and the HEX fluorescent group is combined at the 5' end of the upstream primer ZmGAD-INDEL10842-C.

[0054] 2. Identification of SNP1 site genotype

[0055] The SNP site (ZmGAD-INDEL10842) of 273 natural population materials is genotyped by using molecular markers. Specifically, the following steps are included:

[0056] (1) PCR amplification

[0057] (i) PCR amplification of the DNA of the corn variety to be tested to obtain PCR products, and the PCR amplification system is as follows: 1 μL of DNA template, 0.15 μL of allele-specific primer 1, 0.15 μL of allele-specific primer 2, 0.4 μL of label-specific primer, 5 μL of 2x PARMS premix reagent, 3.3. μL of ddH2O; ordinary amplification program is used for amplification, and the specific conditions are as follows:

[0058] (ii) The PCR amplification reaction conditions are as follows: denaturation at 94°C for 20 min; 10 cycles of denaturation at 94°C for 20 s, annealing at 65°C for 1 min; 32 cycles of denaturation at 94°C for 20 s, annealing at 57°C for 1 min; and end amplification.

[0059] (2) Genotyping

[0060] After PCR is completed, the fluorescence signal is read by using a TECAN infinite M1000 enzyme marker, and then the fluorescence signal is analyzed and converted by using an online software snpdecoder to obtain a clear and intuitive typing chart, and the genotype result is output according to the color difference.

[0061] The results show that the ZmGAD-INDEL10842 site specific primer is connected with the FAM fluorescent group. On the typing chart, if the detected fluorescence signal is blue, it indicates that the base deletion (--) type of the Indel site; if the fluorescence signal is green, it indicates that the base of the Indel site is inserted (CT); and the display of red indicates the heterozygous type (CT). Figure 3

[0062] (3) Typing results ​

[0063] GABA content, L-glutamate abundance, ZmGAD relative expression level, root length were determined in roots of different ZmGAD gene types of maize plants and data visualization was performed by Prism software. GABA content of Indel site base insertion type decreased by about 45.00% compared with Indel site base deletion type, while the relative expression level of ZmGAD significantly decreased by about 82.45%. This indicates that the base insertion in Indel site base insertion type may cause the expression of ZmGAD gene to decrease significantly, thereby reducing the synthesis of GABA. Nevertheless, the L-glutamate abundance of Indel site base insertion type increased by about 24.19%, which means that although GABA synthesis is limited, the accumulation of L-glutamate as a precursor is increasing, suggesting that Indel site base insertion type may be less efficient in converting L-glutamate to GABA. In addition, the root length of Indel site base insertion type decreased by about 12.16%, further indicating the importance of ZmGAD in root growth. Therefore, Indel site base deletion type significantly improves GABA content and promotes root growth by high expression of ZmGAD, while low expression of Indel site base insertion type weakens this function, revealing the key role of ZmGAD in maize roots in response to abiotic stress. Indel site base insertion type Indel site base deletion type.

[0064] The above results show that Indel site base deletion type is an excellent genotype of GABA content related gene ZmGAD in maize roots, and molecular marker ZmGAD-INDEL10842 is of great significance in accelerating the breeding of new maize varieties with stress resistance. Indel molecular markers play an important role in genetic research, breeding improvement, and resistance analysis of crops such as maize. Through the detection of insertion or deletion variations, Indel markers can effectively evaluate genetic diversity, help identify differences between different genotypes, and reveal the process of crop evolution and domestication. At the same time, Indel markers are widely used in gene mapping and marker-assisted selection (MAS), accelerating the screening and breeding process of disease resistance and stress tolerance traits. In addition, the application of Indel markers in population structure analysis and variety identification makes the management and protection of germplasm resources more precise, ensuring the maintenance of genetic diversity. In functional gene research, Indel variations help reveal the relationship between genes and phenotypes, especially in the regulation of key traits such as GABA metabolism. The application of Indel markers in genome editing technology provides new possibilities for precise directional improvement of crops. Therefore, as a key molecular tool, Indel markers have promoted the improvement of maize breeding efficiency and the development of resistance improvement, laying a solid foundation for the sustainable development of modern agriculture.

[0065] SEQ ID NO. 1: (wherein the 1st exon region is 1~86, the 2nd exon region is 87~291, the 3rd exon region is 292~492, the 4th exon region is 493~707, the 5th exon region is 708~961, the 6th exon region is 962~1014, and the 7th exon region is 1015~1482)

[0066]

[0067] SEQ ID NO. 2:

[0068] MVLSHGVGGSDESVHSTFASRYVRTSLPRYRMPEQSIPKEAAYQIINDELMLDGNPRLNLASFVTTWMEPECDKLIQASVNKNYVDMDEYPVTTELQNRCVNMIAHLFNAPLGDAETAVGVGTVGSSEAIMLAGLAFKRRWQNKMKAAGKPCDKPNIVTGANVQVCWEKFARYFEVELKEVKLSDGYYVMDPQKAVDMVDENTICVAAILGSTLNGEFEDVKLLNDLLTKKNAETGWDTPIHVDAASGGFIAPFLYPELEWDFRLPLVKSINVSGHKYGLVYAGIGWCIWRTKVDLPEELIFHINYLGADQPTFTLNFSKGSSQVIAQYYQLIRLGFEGYKNIMENCQENATVLKQGLEKTGKFNIVSKDNGVPLVAFSLKDSSRHSEFEISDFLRRFGWIVPAYTMPPDAQHVTVLRVVIREDFSRTLAERLVLDIEKVLHELDALPARVPSGDLAALAAAESSEREMEKQRQVISLWKRAVLAKKKTNGVC*.

Claims

1. Overexpression of maize ZmGAD The application of genes in regulating maize root growth is characterized by, The corn ZmGAD The nucleotide sequence of the gene is shown in SEQ ID NO.1; the regulation of maize root growth is to increase the root length of maize and increase the GABA content in maize roots, and decrease the L-glutamic acid content in maize roots.

Images