A molecular marker related to tail fat traits of sheep and application thereof in sheep breeding

Abstract

The application provides application of a molecular marker related to a tail fat deposition trait of sheep in breeding. The application finds that there is an A / T polymorphic site at the 614th position of an amplified fragment by performing PCR amplification and sequence analysis on a GDF10 gene of sheep, further detects the polymorphic site of 795 Hu sheep by using an AQP primer pair, establishes a least square model, and performs correlation analysis on the genotype and the tail fat deposition trait, and finally determines that the amplified GDF10 gene fragment can be used as the molecular marker related to the tail fat deposition trait of sheep. The application can be used for breeding low tail fat type sheep by detecting the molecular marker, and can be used for reducing tail fat deposition of sheep, and is helpful to increase economic benefits.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to a GDF10 gene fragment as a molecular marker affecting tail fat deposition traits of sheep and application of the molecular marker in sheep breeding. BACKGROUND

[0002] Lake sheep is a kind of sheep, as a short and fat tail breed originally from China, it is widely welcomed by breeders due to its high reproductive performance, fast growth, strong adaptability, early sexual maturity, year-round estrus, large lambing number, strong lactation capacity and other characteristics. With the development of indoor sheep production system and the change of people's consumption concept, excessive deposition of tail fat limits the commercial value of lamb, and fat tail has become an undesirable and unnecessary feature. The proportion of tail fat in carcass weight is an important indicator affecting carcass quality, and excessive tail fat deposition will reduce feed conversion rate, increase feeding cost, affect livestock meat quality, animal mating and normal movement. Therefore, it is imperative to reduce the deposition of tail fat in Lake sheep.

[0003] GDF10 (growth differentiation factor 10) is also known as bone morphogenetic protein 3b (BMP-3b), which is a member of the BMP family and an important growth factor protein. GDF10 gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily, binds to various TGF-beta receptors, and causes the recruitment and activation of SMAD family transcription factors that regulate gene expression. The proprotein encoded by this gene is processed by proteolysis to produce a homodimeric subunit linked by a disulfide bond, which promotes nerve repair after stroke. This protein may also act as a tumor suppressor, and reduced expression of this gene is associated with oral cancer. In addition, the gene is involved in osteogenesis and adipogenesis, plays an inhibitory role in osteoblast differentiation through the SMAD2 / 3 pathway, and plays an inhibitory role in the adipogenesis process. The research of Akiyoshi Uezumi et al. shows that BMP3b is specifically expressed in mesenchymal progenitor cells, and its expression level is significantly reduced during aging or adipogenic differentiation. The research of Tamana R Yousof et al. shows that the plasma GDF10 level of children with increased BMI is significantly reduced (P<0.05), which indicates that the plasma GDF10 level of obese children is lower, revealing the potential mechanism leading to childhood obesity. At present, the mechanism of GDF10 gene in sheep tail fat deposition has not been reported, and the function of GDF10 gene is also unknown, and whether GDF10 gene is related to sheep tail fat deposition is also unknown. The present application sequences and analyzes the GDF10 gene, explores the correlation between different genotypes of the GDF10 gene and tail fat deposition traits of sheep, and aims to provide genetic materials for genetic improvement of reducing tail fat deposition of sheep, and accelerate the breeding process of new sheep varieties with low tail fat and high quality meat. SUMMARY

[0004] To solve the above technical problems, the present application provides a molecular marker related to tail fat deposition traits of sheep and its application.

[0005] The molecular marker of the present application is amplified from the sheep GDF10 gene, and the specific nucleotide sequence is shown in SEQ ID NO. 1. By amplifying the DNA sequence of the sheep GDF10 gene and sequencing, the polymorphic site of the GDF10 gene is found, the correlation of different genotypes with the tail fat deposition traits of sheep is analyzed, the detection method of the molecular marker containing the polymorphic site is established, and the molecular marker can be applied to the breeding of new varieties of sheep with reduced tail fat deposition.

[0006] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0007] The application of a molecular marker related to tail fat deposition traits of sheep in breeding, the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein W at position 614bp represents A or T. Due to the A / T mutation at position 614 of the above sequence, the A / T polymorphism of the sheep GDF10 gene at this site is caused.

[0008] The application of a primer pair for detecting the above-mentioned molecular marker related to tail fat deposition traits of sheep in sheep breeding, the primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3.

[0009] The application of an AQP SNP primer pair for detecting the above-mentioned molecular marker related to tail fat deposition traits of sheep in sheep breeding, the AQP SNP primer pair includes a forward primer for detecting Allele A, a forward primer for detecting Allele T, and a universal reverse primer, wherein the nucleotide sequence of the forward primer for detecting Allele A is shown in SEQ ID NO. 4, the nucleotide sequence of the forward primer for detecting Allele T is shown in SEQ ID NO. 5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO. 6.

[0010] The application of a kit for detecting the above-mentioned molecular marker related to tail fat deposition traits of sheep in sheep breeding, the kit contains a PCR primer pair or an AQP SNP primer pair for detecting the above-mentioned molecular marker.

[0011] The method for detecting the molecular marker related to tail fat deposition traits of sheep, the specific detection method includes the following steps:

[0012] S1, amplifying the sheep genomic DNA using the above-mentioned PCR primer pair, AQP SNP primer pair or the kit comprising the above-mentioned primer pair;

[0013] S2, identifying the polymorphic site of the amplification product obtained in step S1.

[0014] In step S2, the method for typing identification includes but is not limited to direct sequencing method, fluorescent probe method, gene chip method and high-resolution melting curve method.

[0015] The method for detecting the molecular marker related to the tail fat deposition trait of sheep using the above-mentioned primer pair comprises the following steps:

[0016] a) extracting the genomic DNA from the blood of sheep, and using the primer pair shown in the nucleotide sequence such as SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6 to perform AQP typing;

[0017] b) after the amplification, detecting the fluorescence signal using C1000 Touch Thermal Cycler instrument and checking the typing result.

[0018] The application of the detection method as described above in the detection of the tail fat deposition trait of sheep can determine the high and low of the tail fat of sheep by detecting the molecular marker of the application in the genomic DNA of the sheep to be detected and analyzing the type of the polymorphic site, so as to screen out the sheep breed with less tail fat deposition, and the tail fat of the sheep carrying the AT genotype is significantly lower than that of the sheep carrying the AA genotype, and the tail fat deposition of the sheep carrying the AT genotype is lower than that of the sheep carrying the AA and TT genotypes.

[0019] The application of the detection method as described above in the breeding of sheep is to breed the sheep breed with low tail fat, and if the genotype of the sample to be detected is AT, the sheep with the genotype is the low tail fat type, and the tail fat deposition of the sheep carrying the AT genotype is lower than that of the sheep carrying the AA and TT genotypes, and the genotype AT is selected for breeding.

[0020] The application finds that there is an A / T polymorphic site at the 614th position of the amplified fragment by performing PCR amplification and sequencing on the GDF10 gene of the representative sheep breed, i.e., the Hu sheep, and determines a molecular marker related to the tail fat deposition trait of sheep by detecting the polymorphism of 795 Hu sheep and establishing a least square model, which can be used for the breeding of the sheep with low tail fat deposition trait, provides an effective genetic engineering means for the genetic improvement of the tail fat deposition trait of sheep, and has great practical application value.

[0021] The application has the following beneficial effects:

[0022] The application provides application of a molecular marker related to a tail fat deposition trait of sheep in sheep breeding, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein W at the 614th position represents A or T, and tail fat of sheep carrying an AT genotype is significantly lower than that of sheep carrying an AA genotype; the sheep carrying the AT genotype is of a low tail fat type, and the AT genotype can be selected and reserved in breeding. The genotype of the sheep to be detected is determined by detecting the polymorphic site, and an effective detection method is provided for selection and breeding of sheep of a low tail fat type.

[0023] The application also establishes a detection method of a molecular marker polymorphic site related to a tail fat deposition trait of sheep, so that the genotype of the polymorphic site of the sheep to be detected can be determined, and the sheep with an AA homozygous genotype can be selected and reserved as breeding sheep for breeding, so as to reduce tail fat deposition and improve the quality of sheep, and help to improve the economic benefits of the breeding industry. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is an agarose gel electrophoresis map of a sheep GDF10 gene fragment used as a molecular marker in the application.

[0025] Figure 2 It is a sequencing result of a sheep GDF10 gene g.41276013A>T mutation site in the application.

[0026] Figure 3 It is an AQP typing result of a GDF10 gene amplification fragment of sheep in the application. DETAILED DESCRIPTION

[0027] The application analyzes the relationship between single nucleotide polymorphism of a GDF10 gene of a Hu sheep and a tail fat deposition trait. In addition, expression levels of the GDF10 gene in sheep of different genotypes are also studied. The application provides a valuable molecular marker for sheep breeding.

[0028] The following examples are used to further illustrate the application, but should not be understood as limiting the application. Modifications or replacements made to the application without departing from the spirit and essence of the application shall all fall within the scope of the application.

[0029] Unless otherwise specified, the technical means used in the examples is a routine means well known to those skilled in the art, and unless otherwise specified, the reagents used in the application are of analytical purity or above.

[0030] Example 1 Amplification of a GDF10 gene

[0031] The sheep GDF10 gene DNA (GenBank accession number: NC_056078.1) was used as a template, and a pair of primers was designed using Oligo7.0 software: the upstream primer as shown in SEQ ID NO. 2 and the downstream primer R-R as shown in SEQ ID NO. 3. The primer sequences are as follows:

[0032] SEQ ID NO. 2: 5'-GCACTACCACAAGCACGAG-3'

[0033] SEQ ID NO. 3: 5'-GAGTTACACTGCGAAGTCACC-3'

[0034] Amplification and sequencing of GDF10 gene

[0035] Genomic DNA was extracted from the blood of sheep using a DNA extraction kit and used as a DNA template for PCR amplification. The total volume of the PCR amplification reaction was 35 μL, including 2x PCR Master Mix 17.5 μL, 10 μmol / L of the upstream primer (SEQ ID NO. 2) 1 μL, the downstream primer (SEQ ID NO. 3) 1 μL, the DNA template 1.4 μL, and ddH2O 14.1 μL. The DNA template was the DNA of 9 different sheep plus one mixed sample, a total of 10 samples, and the mixed sample was a mixture of the DNA of 9 sheep.

[0036] PCR amplification program: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 56.3°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, and finally 72°C extension for 10 min.

[0037] The PCR amplification reaction product was detected by 1% agarose gel electrophoresis, and the results are shown in Figure 1 , wherein lane M: 1500 Marker, lanes 1-10: 1-9 are the GDF10 gene amplification results of the blood samples of 9 sheep, and the last lane is the GDF10 gene amplification result of the mixed DNA sample of 9 sheep. The amplified PCR fragments were sequenced, and the sequencing results showed that a 789 bp amplification fragment was obtained, and the nucleotide sequence is shown in SEQ ID NO. 1. There is a polymorphic site in this fragment, specifically at the 614bp site, W is A or T, i.e. there is A / T polymorphism at the 614bp site of the amplified GDF10 gene fragment (SEQ ID NO. 1) (see Figure 2 ).

[0038] SEQ ID NO. 1: GCACTACCACAAGCACGAGCTGTGGCCCAG CCCCTTCCGTGCACTGAAGCCTCGGCCAGGCCGCAAGGACCGCAGGAAGAAGGGCCAGGATGTGTTCATGGCCTCCTCACAGGTGCTGGACTTCGATGAGAAGACGATGCAGAAAGCCCGGAAGAAGCAATGGGATGAGCCA CGGGTCTGCTCCCGGAGGTATCTGAAGGTGGACTTCGCGGACATAGGGTGGAATGAGTGGGTCATCTCACCCAAGTCCTTCGACGCCTACTACTGCTCGGGGGCCTGCGAGTTCCCGATGCCCAAGGTAGGGTCGCCCTGCTGTGCTCCGCTCGCTGTCATCTCAGCTCTGCCCTCGTAGGCGAGTCCTTCTGCCTCCTCACTCTGTTCCCTGTCTGTAAGCAGGGATAATAACACCTCCCATCCATCTGAGCCAGAGAATAGCTAGACAGGCATACCCAAATGGCAGCCTGTTGGGTGGATACAACCCACAGATGGATGCTGTCTGGCTGTCCTTTTGAAAGTGTTGCCTTCATAGCACTGGAATTTTAAATCAGAACCTGTCTTCTTTTGCAGAGCAGGAGATCCTTCCTTTCAGGTGTGTGTTTCCACACAGCAAATCWCAGAGGTTGCGTGGACGCTGGCCGTTCCCCATTCCTCCCCCCGCCCCACCCCGCACACAGGTCCAGTCTCTTAAACACCTTCATTGCCAAGGCTCTTCTGGAAATCTGGCTTGGATTTCAGGGCATGGTGTCTGTAACCAGCAGAGCTGGCCTCGGTGACTTCGCAGTGTAACTC.

[0039] DNA sequence homology search identified:

[0040] The DNA sequence obtained after sequencing was compared with the known physiological function genes published in GenBank database by BLAST (Basic Local Alignment Search Tool) software of the website of National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) for sequence homology comparison to identify and obtain the functional information of the DNA sequence. The search result showed that the sequence had 99% sequence homology with part of the sequence of sheep GDF10 gene DNA (GenBank accession number: NC_056078.1).

[0041] Establishment of genotyping detection method in Example 2

[0042] 1. First, primer sequence design

[0043] The AQP primer pair was designed from right to left for the A / T polymorphism site of the amplified fragment sequence in Example 1, so as to be used for specific detection of the polymorphism site. The nucleotide sequence of the optimized AQP primer pair was as follows:

[0044] Forward primer A1 (SEQ ID NO. 4) for detecting Allele A: GAAGGTCGGAGTCAACGGATTAGCGTCCACGCAACCTCTGT;

[0045] Forward primer A2 (SEQ ID NO. 5) for detecting Allele T: GAAGGTGACCAAGTTCATGCTAGCGTCCACGCAACCTCTGA;

[0046] Universal reverse primer C (SEQ ID NO. 6): GAGATCCTTCCTTTCAGGTGTGTGTT.

[0047] The above primers were entrusted to Beijing Shengong Bioengineering Co., Ltd. for synthesis.

[0048] 2. Second, quality control of extracted genomic DNA

[0049] Genomic DNA extraction from sheep blood can be performed using a DNA extraction kit. Quality testing of the extracted genomic DNA is performed using 1% agarose electrophoresis and Nanodrop 2100, respectively. The requirements for qualified DNA are: (1) Agarose electrophoresis shows a single DNA band without obvious dispersion. (2) Nanodrop 2100 detection A260 / 280 is between 1.8-2.0; A260 / 230 is between 1.8-2.0; 270nm has no obvious light absorption. Unqualified samples need to be re-extracted and tested. According to the AQP TM Detection Technology and Genomic Size Conversion, the DNA dosage is 2-50 ng per sample. The extracted genomic DNA is diluted to a concentration of 2-50 ng / μL as a DNA template for standby.

[0050] 3. Genotyping

[0051] First, the forward primer A1 for detecting Allele A, the forward primer A2 for detecting Allele T, and the universal reverse primer C in the AQP primer pair are each prepared into a 100 μmol / L solution. These primers are mixed with sterile water in a volume ratio of 12:12:30:46 (forward primer A1: forward primer A2: reverse primer C: sterile water) to prepare a primer mixture for standby.

[0052] Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of diluted DNA template (2-50 ng / μL) to each well of a 384-well plate. After adding, seal the film, shake and centrifuge, and place it in a C1000 Touch TM Thermal Cycler instrument for PCR amplification.

[0053] The specific program is as follows:

[0054] 95℃ pre-denaturation, 10 minutes;

[0055] 95℃, 20 seconds (denaturation) - 61℃-55℃, 40 seconds (annealing & extension), 10 cycles of amplification, each cycle decreasing by 0.6℃;

[0056] 95℃, 20 seconds (denaturation) - 55℃, 40 seconds for 34 cycles of amplification.

[0057] After amplification, use the C1000 Touch TM Thermal Cycler instrument to detect fluorescence signals at 37℃ and view the typing results. Some sample results are shown in Figure 3The FAM is taken as the horizontal coordinate and the HEX is taken as the vertical coordinate, wherein each graph in the figure represents one material to be tested, wherein the blue square near the left side represents that the locus is a homozygous genotype "AA"; the green triangle near the middle represents that the locus is a heterozygous genotype "AT"; and the orange small dot near the right side represents that the locus is a homozygous genotype "TT".

[0058] 4. Application of the molecular marker in association analysis of fat deposition traits of sheep

[0059] The polymorphism of 795 Hu sheep is detected, the genotypes are determined, and the least square model described below is established to perform association analysis of the genotypes and fat deposition traits.

[0060] Y ijkl = μ + G i + P j + S k + F l + ε ijkl

[0061] Wherein, Yijk is the observation value of tail fat deposition, μ is the overall mean, Gi is the genotype effect, Pj is the batch effect, Sk is the season effect, Fl is the field effect, and εijkl is the random error, which is assumed to be mutually independent and subject to N(0, σ2) distribution.

[0062] The genotype detection result shows that there are 384 AA genotypes, 345 AT genotypes and 66 TT genotypes in the 795 individuals. The association analysis result of the genotypes and traits is shown in Table 1. Among them, the 180-day-old body weight is the pre-slaughter weight, the tail fat relative body weight represents the ratio of tail fat weight to 180-day-old body weight, and the tail fat relative carcass weight represents the ratio of tail fat weight to carcass weight.

[0063] Table 1 Association analysis of GDF10 gene polymorphism and tail fat deposition traits of sheep

[0064]

[0065] Note: All data in the table are mean ± standard error. Different letters in the same column indicate significant difference (P<0.05), and the same letter indicates no significant difference (P>0.05).

[0066] The results showed that the sequence of GDF10 gene as SEQ ID NO. 1, the A > T mutation site at 614bp was significantly associated with tail fat deposition traits of sheep. Tail fat deposition requires higher energy cost and feed cost, the relative tail fat and relative carcass weight of sheep carrying AT genotype were significantly lower than that of sheep carrying AA genotype. And the tail fat deposition of sheep carrying AT genotype was better than that of sheep carrying AA and TT genotype. It was indicated that the mutation site of GDF10 gene as SEQ ID NO. 1 at 614bp could be used as a potential molecular marker affecting tail fat deposition traits of Hu sheep. In breeding, AT genotype sheep could be reserved, which could reduce the deposition of tail fat during the growth of sheep, and get the superior sheep group with less tail fat deposition. In breeding, AT genotype could be selected for breeding, which could reduce the deposition of tail fat during the growth of sheep, and get the superior sheep group with less tail fat deposition.

Claims

1. The application of primers for detecting molecular markers related to fat deposition traits in the tail of Hu sheep in the breeding of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein W at 614bp represents A or T, the tail fat relative body weight and tail fat relative carcass weight of sheep carrying AT genotype are significantly lower than those of sheep carrying AA genotype.

2. Use according to claim 1, characterized in that, The primer pair comprises primer R-F and primer R-R, the nucleotide sequence of primer R-F is shown as SEQ ID NO. 2, and the nucleotide sequence of primer R-R is shown as SEQ ID NO.

3.

3. The use according to claim 1, said primers comprising a forward primer for detecting Allele A, a forward primer for detecting Allele T and a common reverse primer, wherein, The nucleotide sequence of the forward primer for detecting Allele A is shown as SEQ ID NO. 4, the nucleotide sequence of the forward primer for detecting Allele T is shown as SEQ ID NO. 5, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.

6.

4. The use of a kit for detecting a molecular marker related to the fat deposition trait of the tail of Hu sheep in the breeding of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein W at 614bp represents A or T, the tail fat relative body weight and tail fat relative carcass weight of sheep carrying AT genotype are significantly lower than those of sheep carrying AA genotype; the kit comprises a primer pair, wherein the primer pair comprises primer R-F and primer R-R, the nucleotide sequence of primer R-F is shown as SEQ ID NO. 2, and the nucleotide sequence of primer R-R is shown as SEQ ID NO. 3; Or the kit comprises an AQP SNP primer pair, the AQP SNP primer pair comprises a forward primer for detecting Allele A, a forward primer for detecting Allele T and a universal reverse primer, wherein the nucleotide sequence of the forward primer for detecting Allele A is shown as SEQ ID NO. 4, the nucleotide sequence of the forward primer for detecting Allele T is shown as SEQ ID NO. 5, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.

6.

5. The application of the method for detecting molecular markers related to fat deposition traits in the tail of Hu sheep in the breeding of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein W at 614bp represents A or T, and the detection method comprises the following steps: S1, using the primer pair shown as SEQ ID NO. 2 and SEQ ID NO. 3 or the AQP SNP primer pair shown as SEQ ID NO. 4-6 to amplify the genomic DNA of the Hu sheep; S2, typing and identifying the polymorphic site at 614bp of the molecular marker of the amplification product obtained in step S1, the tail fat relative body weight and tail fat relative carcass weight of sheep carrying AT genotype are significantly lower than those of sheep carrying AA genotype.

Images