KASP primer set for detecting peanut web blotch resistance molecular marker and application thereof

Abstract

The application discloses peanut resistance to net blotch KASP molecular marker primer group and application, the molecular marker is located at the SNP site of peanut 16th chromosome 12966357 and 13th chromosome 51828217, KASP primer group is designed according to the sequence of 100bp before and after the two molecular marker sites, KASP molecular marker of the site is developed based on wild type and mutant sequence of candidate gene, and the base polymorphism of the two sites is G / C.The KASP molecular marker can be used for genotype detection of peanut materials, judges whether the material has net blotch resistance, saves manpower and material resources through high-throughput genotyping detection, is not affected by environmental factors, the result is accurate and reliable, can be used for early screening of peanut net blotch resistance varieties, can shorten the breeding period, and improve breeding efficiency.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a KASP primer set for detecting a peanut web blotch resistance molecular marker and application thereof. BACKGROUND

[0002] Peanut (Arachis hypogaea L.) is an important oil crop and is widely planted in the world. It plays an important role in agricultural production in China. Peanut web blotch is an important peanut disease. In production, peanut web blotch often occurs together with brown spot and black spot. The disease usually begins to occur during the flowering period, and the peak period is during the podding period to the maturation period. The disease spot initially appears on the leaves at the bottom of the plant, and early shows gray-brown pinhead dots. Then it expands outward in a radial pattern, and the color gradually transitions from gray-brown to black-brown. When the disease is serious, it will cause a large number of leaf drop, and also harm the petiole and stem, which seriously affects the yield and quality of peanuts. According to estimates, the disease can cause a 10% to 20% reduction in peanut yield, and in severe cases, up to 30%, causing huge losses to peanut production.

[0003] Although the traditional chemical control method has a certain effect, it is high in cost and may cause pesticide residues, thereby reducing the quality of peanuts and possibly causing environmental pollution. The most economical and effective control measure at present is to breed resistant peanut varieties. Therefore, developing and screening molecular markers linked to peanut web blotch resistance genes for disease resistance detection in different peanut varieties (lines) can provide important technical support for peanut web blotch resistance identification and disease-resistant variety breeding. SUMMARY

[0004] In view of the problems in the prior art, the present application provides a KASP primer set for detecting a peanut web blotch resistance molecular marker, and also provides a method for detecting peanut web blotch resistance using the KASP primer set, which provides technical support for early identification of web blotch resistance.

[0005] The technical scheme of the present application is as follows:

[0006] 1. A KASP molecular marker primer set for detecting peanut web blotch resistance, comprising: an upstream primer 1, an upstream primer 2 and a downstream primer 3 of molecular marker Chr.16.12966357; an upstream primer 4, an upstream primer 5 and a downstream primer 6 of molecular marker Chr.13.51828217.

[0007] The upstream primer 1 is as follows:

[0008] GAAGGTGACCAAGTTCATGCTTACACACCAGTTCAACACATGCC (SEQ ID NO. 1)

[0009] Upstream primer 2:

[0010] GAAGGTCGGAGTCAACGGATTTACACACCAGTTCAACACATGCG (SEQ ID NO. 2)

[0011] Downstream primer 3: TGTGTTGCGAGCCATTGCAATTGTG (SEQ ID NO. 3)

[0012] Upstream primer 4:

[0013] GAAGGTGACCAAGTTCATGCTTTACCTGGAACATAACGGGTACC (SEQ ID NO. 4)

[0014] Upstream primer 5:

[0015] GAAGGTCGGAGTCAACGGATTTTACCTGGAACATAACGGGTACG (SEQ ID NO. 5)

[0016] Downstream primer 6: CATATGTATATTTTCCGCATAAAATACTTA (SEQ ID NO. 6).

[0017] the KASP molecular marker comprises SNP site Chr. 16.12966357 and SNP site Chr. 13.51828217,

[0018] SNP site Chr. 16.12966357 is located on chromosome 16 of peanut, the mutation site is G / C, and the sequence of 100 bp before and after the mutation site is: TGCATTAAGGGAATATTGTGTGCACTGTGCTTATCTCTTTAA TATTTGATTCAGTGATTTGTGTGTTGCGAGCCATTGCAATTGTGGGGTTGTAATTTAG (SEQ ID NO. 7),

[0019] GCATGTGTTGAACTGGTGTGTACATTAGTTGACCAAGCGGTATTAATGAATTTTGTG GAAGCTACTAAATACTAATGTCTAATGCAACTCATGTGGACAA (SEQ ID NO. 8);

[0020] SNP site Chr. 13.51828217 is located on chromosome 13 of peanut, the mutation site is G / C, and the sequence of 100 bp before and after the mutation site is:

[0021] ACATGAATTCACCAATTAGATAGCGTATCGCATACCAATTCATCTGCATATATACCAGAA CGTCATATGTATATTTTCCGCATAAAATACTTACATATGG (SEQ ID NO. 9);

[0022] GTACCCGTTATGTTCCAGGTAACTGGCTTGGAATGAGGAACAGAACACTAGGTTT GTGTACTCACCGTACTATTTCTTTCTTTAAGTTGATGACTCCCTA (SEQ ID NO. 10).

[0023] 2. The detection reagents or kits for the KASP molecular marker primer set.

[0024] 3. The method for detecting peanut net blotch resistance using the KASP molecular marker primer set described above involves extracting DNA from the peanut material to be identified, performing PCR identification using the KASP molecular marker primer set, and when the genotypes of SNP sites Chr.16.12966357 and Chr.13.51828217 are GG, the peanut material to be identified exhibits disease resistance.

[0025] The PCR reaction program was as follows: pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing / extension at 55-61℃ for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, for 26 cycles.

[0026] 4. Application of the KASP molecular marker primer set in the breeding of peanut varieties resistant to net blotch.

[0027] Beneficial effects of the present invention

[0028] The KASP molecular marker primer set and detection method for peanut net blotch resistance of the present invention are applicable to the detection of most peanut net blotch resistance and are of great significance in peanut breeding practice.

[0029] (1) The molecular markers linked to the peanut resistance to net blotch trait of the present invention are obtained by constructing a genetic segregating population through hybridization of net blotch resistant peanuts and susceptible peanut materials, and stable genetic resistance to net blotch trait is obtained by using the above markers for detection.

[0030] (2) The molecular marker linked to the resistance to net blotch of the present application can be used to detect the genotype of peanuts, and then determine whether the material has resistance to net blotch. Through high-throughput genotyping detection, the manpower and material resources can be greatly saved, the detection is not affected by environmental factors, the result is accurate and reliable, and it can be used for early screening of peanut net blotch resistant varieties, can shorten the breeding period, and improve the breeding efficiency.

[0031] (3) The KASP molecular markers Chr.16.12966357 and Chr.13.51828217 of the present application can be used for breeding of peanut net blotch resistant germplasm, and can accurately genotype peanut net blotch traits, and can be applied to screening of net blotch resistant germplasm, and assist peanut molecular breeding. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 is the chromosome region of 11 recombinant single plants on chromosome 16;

[0033] Figure 2 is the chromosome region of 11 recombinant single plants on chromosome 13;

[0034] Figure 3 is the genotyping of RIL population by markers Chr.16.12966357 and Chr.13.51828217;

[0035] Figure 4 is the box plot of net blotch disease index of 353 natural germplasms corresponding to markers Chr.16.12966357 and Chr.13.51828217, respectively. DETAILED DESCRIPTION

[0036] The present application will be further described in detail below in combination with specific embodiments. Unless otherwise specified, the materials and reagents used in the examples are obtained from commercial channels, and the methods used are conventional methods.

[0037] The YY187 strain is provided by the Plant Protection Institute of Henan Academy of Agricultural Sciences.

[0038] Example 1, Development of KASP molecular markers Chr.16.12966357 and Chr.13.51828217 closely linked to peanut net blotch resistance

[0039] 1, Indoor identification of net blotch resistance of RIL population

[0040] RIL population of 444 families was obtained by crossing JN99 and YH22, and then advancing generations by single-seed descent. On the basis of accurate resistance identification of single plant of RIL population, 30 high-resistant single plants and 30 high-susceptible single plants were selected by bulked segregant analysis (BSA), and genomic DNA of their young leaves was extracted by DNA extraction kit, as follows.

[0041] 2. Extraction of peanut population DNA

[0042] 0.1 g of young peanut leaves was collected, and DNA was extracted by using Tiangen extraction kit (model: DP305), according to the kit operation instruction.

[0043] 3. Identification of net blotch resistance phenotype of peanut population

[0044] ① Activation and culture of inoculum before inoculation: YY187 strain was taken out from -80℃ refrigerator, and was placed on PDA medium for activation and culture at 25℃ for 5-10 days, then the activated mycelium was transferred to OA medium, and was cultured at 25℃ in dark for 10-15 days until conidiospores were produced. The conidiospores were transferred to new OA medium for expansion culture. After a large number of conidiospores were produced, they were filtered by sterile multi-layer gauze, and the concentration of the spore suspension was adjusted to 2×10 6 spores / mL.

[0045] ② Inoculation: when peanut plants grew to 6-8 leaf stage, the top leaves were marked by binding ropes, then 5 mL of conidiospore suspension was inoculated on the surface of each leaf. After inoculation, the plants were covered with plastic film for moisturizing, and were cultured in dark for 48 h, then the film was removed, and the plants were cultured under normal light (16 h light / 8 h dark) at 25℃ and 85% humidity. All inoculation tests were repeated at least 3 times, and 12 plants of each family were inoculated. On the 14th day after inoculation, the third leaves from the bottom of the marked leaves (the third leaves from the bottom of the main stem) were taken, and the symptom grading investigation and disease index statistical analysis were performed.

[0046] ③ Disease grading: the disease was graded according to the lesion area, and the disease grading corresponding to the lesion area was as follows:

[0047] No lesion was recorded as 0 grade; 0%< lesion area≤1% was recorded as 1 grade; 1%< lesion area≤3% was recorded as 2 grade; 3%< lesion area≤5% was recorded as 3 grade; 5%< lesion area≤7% was recorded as 4 grade; 7%< lesion area≤10% was recorded as 5 grade; 10%< lesion area≤15% was recorded as 6 grade; 15%< lesion area≤18% was recorded as 7 grade; 18%< lesion area≤20% was recorded as 8 grade; and lesion area>20% was recorded as 9 grade.

[0048] In order to evaluate the resistance of different varieties, the relative resistance index was used for evaluation.

[0049] The specific criteria are as follows: immunity (I, index 1.0); high resistance (HR, disease index between 0.80-0.99); resistance (R, disease index between 0.60-0.79); moderate resistance (MR, disease index between 0.40-0.59); susceptibility (S, disease index between 0.20-0.39); high susceptibility (HS, disease index less than 0.20).

[0050] The calculation formula of disease index and relative resistance index is as follows:

[0051] Disease index =∑(number of leaves at each disease level × corresponding disease level value) / (total number of leaves surveyed × highest disease level value) × 100

[0052] Relative resistance index = 1 - (disease index of the identified variety / disease index of the most susceptible variety)

[0053] 4. BSA-Seq sequencing analysis

[0054] According to the resistance identification results of the RIL population, 30 high-resistant and 30 high-susceptible single plants of net blotch were selected to construct a resistant pool and a susceptible pool. In order to obtain QTLs closely related to net blotch resistance, BSA-Seq sequencing analysis was further performed on JiNong99, YuHua22, and the resistant pool and the susceptible pool.

[0055] 5. Development of SNP molecular markers closely linked to net blotch resistance

[0056] Based on the BSA-Seq data, whole gene SNP identification, calculation of genotype frequency difference (Δ(SNP-index)) between mixed pools, Euclidean distance, and Fisher's exact test method were used for association analysis, and 16 candidate QTL regions related to net blotch resistance were located on chromosomes 1, 3, 5, 6, 13, 15, and 16.

[0057] Further, a series of SNP sites were screened according to the SNP data in the associated region, and the corresponding KASP markers were developed. The successfully developed KASP markers were used for genotyping of the 444 families of the RIL population, and a genetic linkage map was constructed by QTL IciMapping software. Combined with the phenotype identification results of the RIL population, the net blotch resistance QTLs were located, and finally one QTL was detected on chromosomes 13 and 16, respectively.

[0058] The QTL on chromosome 13 is located between markers Chr.13.50751192 and Chr.13.52100203, with a LOD value of 7.04, which explains 7.48% of the phenotypic variation; a web spot resistance candidate interval is obtained between markers Chr.13.50751192 and Chr.13.52100203, and the size of the interval is 1.35 Mb.

[0059] The QTL on chromosome 16 is located between markers Chr.16.1296635 and Chr.16.13041784, with a LOD value of 13.12, which explains 15.44% of the phenotypic variation.

[0060] All single plants in the RIL population derived from the cross of Jinnong 99 and Yuhua 22 were detected using the flanking markers Chr.16.12447069 and Chr.16.13614536 of the candidate interval on chromosome 16, and 11 recombinant single plants were screened, which were RIL-WG742, RIL-WG743, RIL-WG467, RIL-WG705, RIL-WG389, RIL-WG718, RIL-WG331, RIL-WG504, RIL-WG636, RIL-WG654 and RIL-WG660.

[0061] Further, 8 groups of KASP markers (Table 1) in the interval of Chr.16.12447069 and Chr.16.13614536 were used to genotype the above 11 recombinant single plants, and through linkage analysis, it was found that the recombinant single plants RIL-WG331 and RIL-WG504 exchanged in the chromosomal region between markers Chr.16.12966357 and Chr.16.13041784; RIL-WG705 exchanged in the chromosomal region between Chr.16.12872635 and Chr.16.12966357, and was homozygous in the chromosomal region between Chr.16.12966357 and Chr.16.13041784;

[0062] RIL-WG636 and RIL-WG654 exchanged in the chromosomal region between Chr.16.12872635 and Chr.16.12966357, and were homozygous in the chromosomal region between Chr.16.12966357 and Chr.16.13041784. Figure 1 ) From the above analysis, it can be concluded that marker Chr.16.12966357 is co-segregated with web spot resistance.

[0063] Table 1 8 SNP markers developed near the disease resistance associated interval on chromosome 16

[0064]

[0065] Continued marker encryption in the target interval of chromosome 13, finally developed 2 KASP markers in the candidate interval of chromosome 13: Chr.13.51759417 and Chr.13.51828217.

[0066] Using the flanking markers of the candidate interval of chromosome 13, Chr.13.42196092 and Chr.13.54733271, all single plants in the RIL population derived from the cross of JN99 and YH22 were detected, and 11 recombinant single plants were screened: L-WG358, RIL-WG470, RIL-WG530, RIL-WG441, RIL-WG415, RIL-WG507, RIL-WG517, RIL-WG675, RIL-WG456, RIL-WG583, RIL-WG390.

[0067] Further genotyping of 11 recombinant single plants using 10 groups of KASP markers in the interval of Chr.13.42196092 and Chr.13.54733271 on chromosome 13 (Table 2), through linkage analysis, it was found that the recombinant single plant WG470 consistent with the phenotype of the parent YH22 (sensitive) had a fragment exchange in the chromosomal region between markers Chr.13.5210203 and Chr.13.5268771, and was homozygous in the chromosome between Chr.13.51828217 and Chr.13.52100203; the recombinant single plant WG530 consistent with the phenotype of the parent JN99 (resistant) had a fragment exchange in the chromosomal region between Chr.13.51759417 and Chr.13.51828217, and was homozygous in the chromosome between Chr.13.51828217 and Chr.13.52100203; the recombinant single plant WG456 consistent with the phenotype of the parent YH22 (sensitive) had a fragment exchange in the chromosomal region between markers Chr.13.51759417 and Chr.13.51828217, and was homozygous in the chromosome between Chr.13.51828217 and Chr.13.52100203. Figure 2 Therefore, from the above analysis, it can be concluded that marker Chr.13.51828217 is co-segregated with net blotch resistance.

[0068] Table 2 10 SNP markers developed near the disease resistance associated interval on chromosome 13

[0069]

[0070] SNP locus Chr.16.12966357 on chromosome 16 and SNP locus Chr.13.51828217 on chromosome 13 of peanut.

[0071] The primers of the SNP loci Chr.16.12966357 and Chr.13.51828217 of the molecular marker each include two upstream primers and one downstream primer.

[0072] The primers of the SNP locus Chr.16.12966357 include:

[0073] (1) Sequence of the upstream primer Chr.16.12966357-FAM:

[0074] 5'-gaaggtgaccaagttcatgctTACACACCAGTTCAACACATGCC-3' (SEQ ID NO. 1),

[0075] wherein the lowercase part is a universal tag sequence corresponding to FAM fluorescence;

[0076] (2) Sequence of the upstream primer Chr.16.12966357-HEX:

[0077] 5'-gaaggtcggagtcaacggattTACACACCAGTTCAACACATGCG-3' (SEQ ID NO. 2), wherein the lowercase part is a universal tag sequence corresponding to HEX fluorescence;

[0078] (3) Sequence of the downstream primer Chr.16.12966357-Com:

[0079] 5'-TGTGTTGCGAGCCATTGCAATTGTG-3' (SEQ ID NO. 3).

[0080] The primers of the SNP locus Chr.13.51828217 include:

[0081] (1) Sequence of the upstream primer Chr.13.51828217-FAM:

[0082] 5'-gaaggtgaccaagttcatgctTTACCTGGAACATAACGGGTACC-3' (SEQ ID NO. 4), wherein the lowercase part is a universal tag sequence corresponding to FAM fluorescence;

[0083] (2) Sequence of the upstream primer Chr.13.51828217-HEX:

[0084] 5'-gaaggtcggagtcaacggattTTACCTGGAACATAACGGGTACG-3' (SEQ ID NO. 5), wherein the lower case part is a HEX fluorescence corresponding universal tag sequence;

[0085] (3) The sequence of the downstream primer Chr. 13.51828217-Com:

[0086] 5'-CATATGTATATTTTCCGCATAAAATACTTA-3' (SEQ ID NO. 6).

[0087] The SNP site Chr. 16.12966357 is located on chromosome 16 of peanut, and the mutation site is G / C. The sequence of 100 bp before and after the mutation site is: TGCATTAAGGGAATATTGTGTGCACTGTGCTTATCTCTTTAATATTTGATTCAGTGATTTGTGTGTTGCGAGCCATTGCAATTGTGGGGTTGTAATTTAG (SEQ ID NO. 7),

[0088] GCATGTGTTGAACTGGTGTGTACATTAGTTGACCAAGCGGTATTAATGAATTTTGTGGAAGCTACTAAATACTAATGTCTAATGCAACTCATGTGGACAA (SEQ ID NO. 8);

[0089] The SNP site Chr. 13.51828217 is located on chromosome 13 of peanut, and the mutation site is G / C. The sequence of 100 bp before and after the mutation site is:

[0090] ACATGAATTCACCAATTAGATAGCGTATCGCATACCAATTCATCTGCATATATACCAGAACGTCATATGTATATTTTCCGCATAAAATACTTACATATGG (SEQ ID NO. 9);

[0091] GTACCCGTTATGTTCCAGGTAACTGGCTTGGAATGAGGAACAGAACACTAGGTTTGTGTACTCACCGTACTATTTCTTTCTTTAAGTTGATGACTCCCTA (SEQ ID NO. 10).

[0092] PCR amplification system: 2 μL of DNA at a concentration of 100 ng / μL, 1 μL of 1 × PARMS PCR Mix, and 1 μL of Primer Mix; the Primer Mix comprises an upstream primer and a downstream primer, the concentration of the two upstream primers is 400 nM, and the concentration of the downstream primer is 150 nM.

[0093] The PCR amplification procedure is as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 55-61°C for 60 s, with a decrease of 0.6°C for each cycle, for 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for 26 cycles.

[0094] High-throughput genotyping is performed by using the SNP Line genotyping platform (LGC, UK), and genotyping and data analysis of the PCR products are performed by using the SNP viewer software.

[0095] When detected, if homozygous resistance is blue on the genotyping map, the output result is HEX; if homozygous susceptibility is red on the genotyping map, the output result is FAM; and if heterozygous resistance signal is green on the genotyping map, the output result is FAM HEX.

[0096] Using the obtained primers, the Jinnong 99 and Yuhua 22 and 444 RIL families derived from the hybridization thereof are subjected to genotyping according to the PCR amplification reaction system and amplification procedure as described above, and the genotyping results are as shown in Table 2. Figure 3

[0097] Figure 3 In the figure, A and B are genotyping of the RIL population by using markers Chr. 16.12966357 and Chr. 13.51828217, respectively; the black dot close to the origin represents a blank control without template DNA; the red dot close to the Y axis and the blue dot close to the X axis represent a family carrying a C allelic variation site and a family carrying a G allelic variation site, respectively.

[0098] The abscissa value represents the HEX fluorescence signal value, and the ordinate value represents the FAM fluorescence signal value.

[0099] The genotype of the peanut genome Chr. 16.12966357 and Chr. 13.51828217 site to be tested is determined, i.e., whether the 12966357th base of the 16th chromosome and the 51828217th base of the 13th chromosome of the peanut genome are G or C.

[0100] ​If the fluorescence signal value of the peanut amplification product is close to the horizontal coordinate, the fluorescence reading presents blue (HEX signal), and the genotype of Chr. 16.12966357 and Chr. 13.51828217 loci in the genome of the peanut to be tested is GG homozygous (i.e., the 12966357th base of the 16th chromosome and the 51828217th base of the 13th chromosome of the peanut genome are both GG homozygous) ;

[0101] If the fluorescence signal value of the peanut amplification product is close to the vertical coordinate, the fluorescence reading presents red (FAM signal), and the genotype of Chr. 16.12966357 and Chr. 13.51828217 loci in the genome of the peanut to be tested is CC homozygous (i.e., the 12966357th base of the 16th chromosome and the 51828217th base of the 13th chromosome of the peanut genome are both CC homozygous) ;

[0102] If the fluorescence signal value of the peanut amplification product is close to the middle of the horizontal and vertical coordinates, the fluorescence reading presents green (FAM and HEX signals), and the genotype of Chr. 16.12966357 and Chr. 13.51828217 loci in the genome of the peanut to be tested is GC heterozygous (i.e., the 12966357th base of the 16th chromosome and the 51828217th base of the 13th chromosome of the peanut genome are both GC heterozygous).

[0103] The sample in the lower left corner close to the origin shows black, and the sample showing pink indicates a failed detection.

[0104] According to the above PCR amplification reaction system and amplification program, the genotyping of the recombinant single plants in the 11 RIL populations screened on chromosome 16 was performed.

[0105] The genotyping results (Table 3) show that the genotypes of 6 strains of Chr. 16.12966357 are GG, and their web blotting resistance is R or HR; the genotypes of 5 strains of Chr. 16.12966357 are CC, and their web blotting resistance is S or HS. The results show that the Chr. 16.12966357 marker can obtain stable PCR products in the 11 RIL population recombinant single plants, the two genotypes can be distinguished and clustered, and the Chr. 16.12966357 marker is consistent with the web blotting resistance phenotype identification results.

[0106] Table 3 Genotyping of recombinant single plants in the Chr. 16.12447069-Chr. 16.13614536 interval

[0107]

[0108] Note: HR means high resistance; R means resistance; HS means high susceptibility; S means susceptibility.

[0109] According to the PCR amplification system and the amplification procedure, the recombinant single plants in the 11 RIL populations screened on chromosome 13 were genotyped.

[0110] The genotyping results (Table 4) show that the genotypes of 6 plants of Chr.13.51828217 are GG, and the resistance to web blot disease is R or HR; the genotypes of 5 plants of Chr.13.51828217 are CC, and the resistance to web blot disease is S or HS. The results show that the Chr.13.51828217 marker can obtain stable PCR products in the 11 recombinant single plants of the RIL population, and the two genotypes can be obviously distinguished and clustered, and the Chr.13.51828217 marker is consistent with the identification results of the web blot disease resistance phenotype.

[0111] Therefore, the Chr.16.12966357 and Chr.13.51828217 markers of the present application can be used for molecular marker breeding of the peanut web blot disease resistance interval.

[0112] Table 4 Genotyping of recombinant single plants in the Chr.13.42196092- Chr.13.54733271 interval

[0113]

[0114] Example 2, detection and application of peanut SNP site genotypes

[0115] To verify the reliability and accuracy of the KASP markers, the two molecular markers were jointly analyzed and verified in a natural population containing 353 domestic and foreign germplasms, and the steps were as follows:

[0116] 1. Extracting the peanut genomic DNA to be tested: the total DNA of the peanut material to be tested was extracted by the CTAB method, and the specific method was as follows:

[0117] (1) Take the tender leaves of peanuts and grind them into powder in a pre-cooled mortar with liquid nitrogen. Put them into a 2mL centrifuge tube.

[0118] (2) Add 650μL of CTAB extraction solution (65℃ water bath preheating) to the centrifuge tube, mix well, and then incubate at 65℃ water bath for 40min, during which time the sample is inverted 3-4 times and mixed well.

[0119] (3) After cooling to room temperature, add an equal volume of chloroform:isopropyl alcohol mixture (volume ratio of chloroform:isopropyl alcohol is 24:1) to the centrifuge tube, invert and mix well, and centrifuge at 12000rpm for 10min;

[0120] (4) Take the supernatant and transfer it into a new 1.5 mL centrifuge tube, repeat step (3) once.

[0121] (5) Take the supernatant and transfer it into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix well by inverting, and precipitate at -20℃ for 30 min.

[0122] (6) Centrifuge at 12000 rpm for 10 min, discard the supernatant, and wash the precipitate with an appropriate volume of 75% ethanol twice.

[0123] (7) After air-drying the DNA precipitate, add 150 μL of ddH2O to dissolve it;

[0124] (8) After the DNA is fully dissolved, detect its concentration and purity.

[0125] 2. PCR amplification: KASP-1 primer mixture includes upstream primer Chr. 16.12966357-FAM (SEQ ID No. 1), upstream primer Chr. 16.12966357-HEX (SEQ ID No. 2), downstream primer Chr. 16.12966357-Com (SEQ ID No. 3), and ddH2O.

[0126] KASP-2 primer mixture includes upstream primer Chr. 13.51828217-FAM (SEQ ID No. 4), upstream primer Chr. 13.51828217-HEX (SEQ ID No. 5), downstream primer Chr. 13.51828217-Com (SEQ ID No. 6), and ddH2O.

[0127] The KASP primer mixture is mixed by an upstream primer, an upstream primer, a downstream primer, and pure water in a volume ratio of 6:6:15:23, with a concentration of 100 μM.

[0128] ① Use KASP primer mixture for PCR amplification reaction, which is performed in a water bath PCR instrument LGC HydroCycler2, and the PCR reaction system is: 30 ng / μL of DNA 2 μL, KASP primer mixture 1 μL, 1 × KASP Master Mix 1 μL.

[0129] ② PCR reaction program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 55℃-61℃ gradient annealing / extension for 60 s, with a decrease of 0.6℃ for each cycle, for a total of 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing / extension for 60 s, for a total of 26 cycles.

[0130] After the reaction, the fluorescence data of the reaction product was read on the PHERA Star Plus SNP instrument, and the 353 peanut germplasm resources were genotyped on a real-time fluorescence quantitative PCR instrument using KASP molecular marker primers to determine the genotypes of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome to be tested, i.e., whether the nucleotide at position 12966357 of chromosome 16 of the peanut genome is G or C, and whether the nucleotide at position 51828217 of chromosome 13 is G or C.

[0131] If the fluorescence signal data of the amplification product of the peanut to be tested is close to the Y axis (FAM signal), the genotypes of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome to be tested are both CC homozygous.

[0132] If the fluorescence signal data of the amplification product of the peanut to be tested is close to the X axis (HEX signal), the genotypes of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome to be tested are both GG homozygous.

[0133] The CC genotype indicates that the nucleotide species of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome are both C; the GG genotype indicates that the nucleotide species of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome are both G; finally, 17 natural germplasms (including Ji'nan 99) were screened from the 353 natural germplasms, with the marker Chr.16.12966357 being GG type and the marker Chr.13.51828217 being GG type (Table 5).

[0134] The Chr.16.12966357 genotype of the 353 natural populations was marked as AA, and the genotype was marked as aa; the Chr.13.51828217 genotype of the natural population was marked as BB, and the genotype was marked as bb. According to the marker type of Chr.16.12966357 and Chr.13.51828217 of each natural germplasm, the genotype of each natural germplasm was divided into four types: AABB, AAbb, aaBB, and aabb, and then the combined genotype of Chr.16.12966357 and Chr.13.51828217 of each germplasm in the natural population was analyzed in combination with the net spot disease index. Figure 4 ).

[0135] The genotyping results of the different peanut germplasm resources by Chr.16.12966357 and Chr.13.51828217 markers showed that the two genotypes could be clearly separated by the molecular markers, wherein 1.4% (5) of the peanut germplasm had the Chr.16.12966357 genotype GG, 3.7% (13) of the peanut germplasm had the Chr.13.51828217 genotype GG, and the peanut germplasm with the Chr.16.12966357 and Chr.13.51828217 marker GG genotypes had different degrees of resistance (high resistance to moderate resistance) to web blotting. In addition, Jinnong 99 with the Chr.16.12966357 and Chr.13.51828217 marker GG genotypes was highly resistant to web blotting.

[0136] Therefore, the KASP markers Chr.16.12966357 and Chr.13.51828217 of the present application can be used for the breeding of peanut web blotting-resistant germplasm, and can accurately genotype the peanut web blotting trait. The molecular markers can be applied to the screening of web blotting-resistant germplasm and assist peanut molecular breeding.

[0137] Table 5 Polymorphism analysis of Chr.16.12966357 and Chr.13.51828217 markers of 7 peanut germplasm resources

[0138]

Claims

1. A KASP molecular marker primer set for detecting peanut net blotch resistance, characterized in that: The primer set includes: The molecular marker Chr.16.12966357 includes upstream primer 1, upstream primer 2, and downstream primer 3; The molecular marker Chr.13.51828217 includes upstream primer 4, upstream primer 5, and downstream primer 6; Upstream primer 1: GAAGGTGACCAAGTTCATGCTTACACACCAGTTCAACACATGCC (SEQ ID NO.1) Upstream primer 2: GAAGGTCGGAGTCAACGGATTTACACACCAGTTCAACACATGCG (SEQ ID NO.2) Downstream primer 3: TGTGTTGCGAGCCATTGCAATTGTG (SEQ ID NO.3) Upstream primer 4: GAAGGTGACCAAGTTCATGCTTTACCTGGAACATAACGGGTACC (SEQ ID NO.4) Upstream primer 5: GAAGGTCGGAGTCAACGGATTTTACCTGGAACATAACGGGTACG (SEQ ID NO.5) Downstream primer 6: CATATGTATATTTTCCGCATAAAATACTTA (SEQ ID NO. 6).

2. The KASP molecular marker primer set according to claim 1, characterized in that: The KASP molecular markers are SNP sites Chr.16.12966357 and Chr.13.51828217. SNP site Chr.16.12966357 is located on peanut chromosome 16, with a G / C mutation site. The sequences 100 bp before and after this mutation site are as follows: TGCATTAAGGGAATATTGTGTGCACTGTGCTTATCTCTTTAATATTTGATTCAGTGATTTGTGTGTTGCGAGCCATTGCAATTGTGGGGTTGTAATTTAG (SEQ ID NO. 7); GCATGTGTTGAACTGGTGTGTACATTAGTTGACCAAGCGGTATTAATGAATTTTGTGGAAGCTACTAAATACTAATGTCTAATGCAACTCATGTGGACAA (SEQ ID NO. 8); SNP site Chr.13.51828217 is located on peanut chromosome 13, with a mutation site of G / C. The sequences 100 bp before and after this mutation site are as follows: ACATGAATTCACCAATTAGATAGCGTATCGCATACCAATTCATCTGCATATATACCAGAACGTCATATGTATATTTTCCGCATAAAATACTTACATATGG (SEQ ID NO. 9); GTACCCGTTATGTTCCAGGTAACTGGCTTGGAATGAGGAACAGAACACTAGGTTTGTGTACTCACCGTACTATTTCTTTCTTTAAGTTGATGACTCCCTA (SEQ ID NO. 10).

3. A detection reagent or kit containing the KASP molecular marker primer set as described in claim 1.

4. A method for detecting peanut net blotch resistance using the KASP molecular marker primer set described in claim 1, characterized in that, DNA was extracted from the peanut materials to be identified, and PCR identification was performed using KASP primers with molecular markers. When the genotypes of SNP sites Chr.16.12966357 and Chr.13.51828217 were GG, the peanut materials to be identified showed disease resistance.

5. The method for detecting peanut net blotch resistance using the KASP molecular marker primer set as described in claim 4, characterized in that, The PCR reaction program was as follows: pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing / extension at 55-61℃ for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, for 26 cycles.

6. The application of the KASP molecular marker primer set as described in claim 1 in the breeding of flower varieties resistant to net blotch disease, characterized in that, The SNP marker genotypes of the peanut materials to be identified were detected. When the genotypes of SNP sites Chr.16.12966357 and Chr.13.51828217 were both GG, the peanut materials to be identified showed disease resistance.

Images