A tumor diagnosis and treatment integrated probe and preparation method thereof

Abstract

The present invention relates to a probe for tumor diagnosis and / or treatment, and discloses an integrated tumor diagnosis and treatment probe and a preparation method thereof. The probe contains a nucleic acid aptamer, a tetrahedral framework nucleic acid, a nuclide chelating ligand, and a labeling nuclide; the nucleic acid aptamer is connected to the tetrahedral framework nucleic acid; the nuclide chelating ligand is coupled with a short single-stranded nucleic acid and is labeled by the labeling nuclide, and is connected to the tetrahedral framework nucleic acid. The present invention utilizes the controllable programming characteristics of DNA nucleic acid to orderly adjust the size of the tetrahedral framework nucleic acid and the number of nucleic acid aptamers hybridized on the tetrahedral framework nucleic acid, thereby improving the in vivo specific targeting binding ability of the nucleic acid aptamer, enhancing the tumor uptake effect, reducing the retention of normal tissues and organs, being able to modulate its pharmacokinetics, increasing the exposure of the nucleic acid aptamer at the tumor site, and being effectively used for the diagnosis and / or treatment of tumors.

Description

Technical Field

[0001] The present invention relates to a probe for tumor diagnosis and / or treatment, in particular to an integrated tumor diagnosis and treatment probe and a preparation method thereof. Background Art

[0002] Among radioactive diagnostic and therapeutic methods, PET examination can provide detailed functional and metabolic molecular information of lesions, and CT scanning can provide precise spatial positioning, and the two complement each other's advantages. Since the human body cannot emit gamma photons, the signal-to-noise ratio of PET / CT is higher than other imaging methods. At the same time, compared with traditional examination methods, it has higher sensitivity and accuracy, and is a powerful means for early tumor screening. Drug pharmacokinetic models can integrate drug properties and system-specific organism characteristics to describe drug biodistribution and provide information for preclinical in vivo testing. The high-accuracy data provided by PET / CT makes the PBPK model closer to the actual drug biodistribution process.

[0003] Aptamers (Apts) are known as chemists' antibodies. Compared with antibodies, they have advantages such as short screening time, easy modification, low cost, high affinity, and good biocompatibility. Among them, the aptamer SGC8 was screened for tyrosine kinase protein 7 (PTK7), which is abnormally expressed in colorectal cancer. At the same time, according to current research, Apt has a half-life of only a few minutes after entering the living body and is easily degraded, which is a problem to be solved for living imaging.

[0004] The emergence of nucleic acid nanotechnology has realized the engineering editing and assembly of biological molecules. As one of the representatives of framework nucleic acid nanostructures, tetrahedron nucleic acid (tFNA) has certain structural stability, excellent programmability, excellent biocompatibility, and even the ability to scavenge reactive oxygen species (ROS) and fight inflammation, all of which make it an ideal delivery carrier.

[0005] In the design process of molecular probes, the multivalent strategy means loading or modifying multiple modules with the same function on a carrier to enhance the corresponding function, which is a very effective means. Although some people have added multiple Apts to the framework nucleic acid for targeting or treatment, how to obtain a diagnostic and therapeutic integrated probe based on tetrahedral framework nucleic acid and with nucleic acid aptamers as the target head with good specific targeting effect, high tumor uptake, and less retention in normal tissues and organs is a problem that needs to be solved urgently. Summary of the invention

[0006] The purpose of the present invention is to provide an integrated diagnosis and treatment probe based on tetrahedral framework nucleic acid and using nucleic acid aptamers as target heads, which has good specific targeting effect, high tumor uptake, and less retention in normal tissues and organs. At the same time, the present invention also provides a preparation method and application of the integrated tumor diagnosis and treatment probe.

[0007] To achieve the purpose of the present invention, on the one hand, the present invention provides an integrated tumor diagnosis and treatment probe, which contains a nucleic acid aptamer, a tetrahedral framework nucleic acid, a radionuclide chelating ligand and a labeling radionuclide; the nucleic acid aptamer is connected to the tetrahedral framework nucleic acid; the radionuclide chelating ligand is coupled with a short single-stranded nucleic acid and is labeled with the labeling radionuclide, and is connected to the tetrahedral framework nucleic acid.

[0008] The integrated tumor diagnosis and treatment probe provided by the present invention is a compound formed by connecting a nucleic acid aptamer, a tetrahedral framework nucleic acid, a nuclide chelating ligand and a labeling nuclide, wherein the nucleic acid aptamer is connected to the tetrahedral framework nucleic acid, and the nuclide chelating ligand is first coupled with a short single-stranded nucleic acid, then labeled with the labeling nuclide, and finally connected to the tetrahedral framework nucleic acid connected with the nucleic acid aptamer. In the probe, after the tetrahedral framework nucleic acid is connected to the nucleic acid aptamer, the nucleic acid aptamer can be effectively enhanced to be taken up by the living tumor of the nucleic acid aptamer, and at the same time, by further connecting a nuclide chelating ligand coupled with a short single-stranded nucleic acid and labeled with a nuclide on the tetrahedral framework nucleic acid, the size of the tetrahedral framework nucleic acid can be effectively controlled and optimized, and by adjusting the number of nucleic acid aptamers connected to the tetrahedral framework nucleic acid, the specific targeting ability of the nucleic acid aptamer is significantly improved, the retention of normal tissues is reduced, and the exposure of the nucleic acid aptamer at the tumor site is increased.

[0009] Preferably, the tetrahedral framework nucleic acid contains four or eight nucleic acid single strands; the nucleotide sequence of the nucleic acid single strand is shown in any one of SEQ ID NOs: 1 to 24.

[0010] The inventors of the present application have designed the nucleotide sequence of a single-stranded nucleic acid in a tetrahedral framework nucleic acid through research. The tetrahedral framework nucleic acid is prepared using four or eight single-stranded nucleic acids, and the nucleotide sequence of the single-stranded nucleic acid is selected from SEQ ID NOs: 1 to 24.

[0011] Preferably, the tetrahedral framework nucleic acid contains eight nucleic acid strands, and the nucleotide sequences of the eight nucleic acid strands are selected from SEQ ID NOs: 5 to 24. More preferably, the tetrahedral framework nucleic acid contains eight nucleic acid strands, and the nucleotide sequences of the eight nucleic acid strands are shown in SEQ ID NOs: 5 to 14 or SEQ ID NOs: 15 to 24, respectively.

[0012] Furthermore, the tetrahedral framework nucleic acid contains eight nucleic acid single strands, and the nucleotide sequences of the eight nucleic acid single strands are shown in SEQ ID NOs: 5, 8 to 14; or the nucleotide sequences of the eight nucleic acid single strands are shown in SEQ ID NOs: 15, 18 to 24.

[0013] Preferably, the tetrahedral framework nucleic acid contains four nucleic acid single strands, and the nucleotide sequences of the four nucleic acid single strands are respectively shown as SEQ ID NOs 1 to 4. The inventors of the present application found in the process of preparing the tetrahedral framework nucleic acid that when the tetrahedral framework nucleic acid contains four nucleic acid single strands, and the nucleotide sequences of the four nucleic acid single strands are respectively shown as SEQ ID NOs 1 to 4, the prepared tetrahedral framework nucleic acid has the most tumor uptake and the least retention in normal tissues and organs compared with other nucleic acid single strands, and has the best application effect.

[0014] In the integrated tumor diagnosis and treatment probe of the present invention, the tetrahedral framework nucleic acid is prepared by mixing four or eight nucleic acid single strands in equimolar amounts and gradient annealing using a PCR instrument. The size of a tetrahedral framework nucleic acid is determined by the number and length of the nucleic acid single strands.

[0015] Preferably, in the integrated tumor diagnosis and treatment probe of the present invention, 1 to 3 nucleic acid aptamers are connected to each of the tetrahedral framework nucleic acids. In the probe, 1 to 3 nucleic acid aptamers can be connected to the tetrahedral framework nucleic acid, and three probes with different valences can be obtained according to the number of connected nucleic acid aptamers, with different properties. The nucleic acid aptamers are connected to the tetrahedral framework nucleic acid by base complementary pairing, and one, two or three nucleic acid aptamers can be connected to each tetrahedral framework nucleic acid. The nucleic acid aptamer can be connected to any position of the tetrahedral framework nucleic acid, such as vertices, side edges, etc. Preferably, the tetrahedral framework nucleic acid has four vertices, and the nucleic acid aptamer is connected to the vertices of the tetrahedral framework nucleic acid. More preferably, the nucleic acid aptamer is connected to the tetrahedral framework nucleic acid by hybridization. When the nucleic acid aptamer is connected to the tetrahedral framework nucleic acid, it is preferred but not limited to mixing the nucleic acid single strand constituting the tetrahedral framework nucleic acid with the nucleic acid aptamer whose 5 end is extended by 15 bases, and further annealing to obtain a product of the nucleic acid aptamer hybridized and connected to the tetrahedral framework nucleic acid. Specifically, the 5 end of the nucleic acid aptamer is extended by 15 bases, and one, two or three vertices of the tetrahedral framework nucleic acid extend 15 bases complementary to the nucleic acid aptamer, thereby achieving hybridization connection between the two.

[0016] Preferably, in the integrated tumor diagnosis and treatment probe, the short single-stranded nucleic acid coupled to the nuclide chelating ligand contains a 15-base nucleic acid sequence, and one vertex of the tetrahedral framework nucleic acid contains a 15-base nucleic acid sequence complementary to the short single-stranded nucleic acid. The nuclide chelating ligand is hybridized and connected with the tetrahedral framework nucleic acid through the 15-base nucleic acid sequence of the short single-stranded nucleic acid coupled to it. The short single-stranded nucleic acid contains a specific 15-base sequence, and one vertex of the tetrahedral framework nucleic acid extends a 15-base nucleic acid sequence complementary to the short single-stranded nucleic acid, thereby realizing the hybridization connection between the tetrahedral framework nucleic acid and the nuclide chelating ligand coupled with the short single-stranded nucleic acid. More preferably, the nucleotide sequence of the short single-stranded nucleic acid is 5'-TGT CATAGA AGG GTT-3'. The nucleotide sequence of the short single-stranded nucleic acid is preferably, but not limited to, as shown in SEQ ID NO: 25.

[0017] The nucleic acid aptamer described in the present invention is a synthetic single-stranded DNA or RNA, which is usually obtained by in vitro screening using the exponential enrichment ligand system evolution technology SELEX method, and has high affinity and specificity with the target ligand. Preferably, in the integrated tumor diagnosis and treatment probe, the nucleic acid aptamer is SGC8 with 15 bases extended at the 5 end. The nucleotide sequence of the nucleic acid aptamer is TTATTCCGATGTATT ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA.

[0018] Preferably, the nuclide chelating ligand comprises at least one of 10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) and 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA).

[0019] Preferably, the labeling nuclides are Tc-99m, Ga-68, F-18, I-123, I-125, I-131, I-124, In-111, Ga-67, Cu-64, Zr-89, C-11, Lu-177, Re-188, Y-86, Mn-52, Sc-44, Y-90, Ac-225, As-211, Bi-212, Bi-213, Cs-137, Cr-51, Co-60, Dy-1 Preferably, the labeling nuclide is at least one of Ga-68, Lu-177, or Er-169, Fm-255, Au-198, Ho-166, I-125, I-131, Ir-192, Fe-59, Pb212, Mo-99, Pd-103, P-32, K-42, Re-186, Re-188, Sm-153, Ra-223, Ru-106, Na-24, Sr-89, Tb149, Th-227, Xe-133, Yb-169, and Yb-177. More preferably, the labeling nuclide is Ga-68 or Lu-177.

[0020] Preferably, the nucleic acid aptamer (Apt) is SGC8 with 15 bases extended at the 5 end, and its nucleotide sequence is TTATTCCGATGTATT ATCTAACTGCTGCGCCGCCGGGAAAA TACTGTACGGTTAGA, as shown in SEQ ID NO: 26; the nuclide chelating ligand is 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA), and the labeling nuclide is Ga-68. The obtained tumor diagnosis and treatment integrated probe is represented by [ 68 Ga]NOTA-Apt-tFNA has outstanding effects in noninvasive radioactive PET / CT imaging.

[0021] Preferably, the nucleic acid aptamer (Apt) is SGC8 with 15 bases extended at the 5 end, and its nucleotide sequence is TTATTCCGATGTATT ATCTAACTGCTGCGCCGCCGGGAAAA TACTGTACGGTTAGA, as shown in SEQ ID NO: 26; the nuclide chelating ligand is 10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), and the labeling nuclide is Lu-177. The obtained integrated tumor diagnosis and treatment probe is represented by [ 177 Lu]DOTA-Apt-tFNA, which has outstanding effects in internal irradiation radiotherapy.

[0022] The tumor diagnosis and treatment integrated probe of the present invention uses PET / CT imaging without background interference and accurate positioning to perform in vivo radionuclide imaging of mice by tetrahedrons of three different sizes (17, 26 and 37 base pairs (bp) in edge length) and three different valence states (monovalent, divalent and trivalent) and SGC8 multivalent substances (Apt-tFNA). The biodistribution process of nine multivalent substances was quantitatively and systematically studied by pharmacokinetics, and an Apt-tFNA with the highest tumor uptake and less retention in normal tissues and organs was selected for radionuclide radiotherapy and obtained good therapeutic effects, ultimately providing a radionuclide probe with integrated diagnosis and treatment capabilities.

[0023] On the other hand, the present invention also provides a method for preparing the above-mentioned integrated tumor diagnosis and treatment probe, the method comprising the following steps:

[0024] Step (1): connecting the tetrahedral framework nucleic acid and the nucleic acid aptamer to obtain product a;

[0025] Step (2): coupling the short single-stranded nucleic acid with the radionuclide chelating ligand, and then adding the labeling radionuclide solution to obtain product b after the reaction;

[0026] Step (3): Mix product a and product b to react, thereby obtaining the integrated tumor diagnosis and treatment probe.

[0027] In the preparation method of the integrated tumor diagnosis and treatment probe described in the present invention, the tetrahedral framework nucleic acid and the nucleic acid aptamer are first connected to obtain product a. The connection process can be performed by solid-phase synthesis using a DNA synthesizer, which can not only be customized, but also has small differences between batches; then, the short single-stranded nucleic acid, the radionuclide chelating ligand and the labeling radionuclide are added in a certain order and reacted to obtain product b, and finally the products a and b are mixed and reacted, and the radionuclide chelating ligand coupled with the short single-stranded nucleic acid and labeled with the radionuclide is further connected to the tetrahedral framework nucleic acid. Compared with the traditional antibody probe preparation method, the reaction conditions are simple.

[0028] Preferably, the step (1) is: mixing equimolar amounts of nucleic acid single strands contained in the tetrahedral framework nucleic acid, then adding 1 to 3 times the molar amount of nucleic acid aptamers to the nucleic acid single strands, annealing in a PCR instrument to obtain product a; the annealing treatment is: first rapidly heating to 95°C and maintaining for 5 minutes, then cooling to 4°C at a rate of 1°C per minute to complete annealing.

[0029] In the step (1), the sequence and length of the nucleic acid single strands constituting the tetrahedral framework nucleic acid are selected according to the required tetrahedron size, and the nucleic acid single strands constituting the tetrahedral framework nucleic acid are mixed in equimolar amounts, and then a nucleic acid aptamer with 15 bases extended from the 5 end is added in an amount of 1 to 3 times the molar amount of the nucleic acid single strand. When the molar amount of the nucleic acid aptamer is the same as the molar amount of the single nucleic acid single strand constituting the tetrahedral framework nucleic acid, a monovalent tetrahedral framework nucleic acid is prepared; when the molar amount of the nucleic acid aptamer is twice the molar amount of the single nucleic acid single strand constituting the tetrahedral framework nucleic acid, a divalent tetrahedral framework nucleic acid is prepared; when the molar amount of the nucleic acid aptamer is three times the molar amount of the single nucleic acid single strand constituting the tetrahedral framework nucleic acid, a trivalent tetrahedral framework nucleic acid is prepared. That is, the ratio of the nucleic acid aptamer to the nucleic acid single strand constituting the tetrahedral framework nucleic acid needs to be selected according to the designed valence. Then the mixture is placed in a PCR instrument for annealing treatment to obtain a tetrahedral framework nucleic acid connected with a nucleic acid aptamer. The annealing treatment conditions are preferably but not limited to: firstly quickly heating to 95° C. and maintaining for 5 minutes, and then cooling to 4° C. at a rate of decreasing by 1° C. per minute to complete the annealing.

[0030] Preferably, the nucleic acid chains are obtained by solid phase synthesis.

[0031] Preferably, in the step (2), the labeling nuclide solution is prepared by dissolving the labeling nuclide with hydrochloric acid and then adding sodium acetate buffer to adjust the pH to 4-4.5. The labeling nuclide needs to be prepared into a labeling nuclide solution when used, and the labeling nuclide solution is prepared by first dissolving the labeling nuclide with hydrochloric acid and then adding sodium acetate buffer to adjust to a specific pH. The concentration of the hydrochloric acid solution is preferably but not limited to 0.1 mol / L. More preferably, in the step (2), the radioactive dose of the labeling nuclide in the labeling nuclide solution is 2 mCi-10 mCi. In the labeling nuclide solution, the radioactive dose of the labeling nuclide is preferably but not limited to 2 mCi-10 mCi, which can be determined according to the selection and demand of the labeling nuclide. For example, when Ga-68 is used as the labeling nuclide, the radioactive dose of the nuclide in the labeling nuclide solution is 2mCi~10mCi; when Lu-177 is used as the labeling nuclide, the radioactive dose of the nuclide in the labeling nuclide solution is 3mCi~5mCi.

[0032] Preferably, the reaction temperature in step (2) is 95°C and the reaction time is 15 minutes. After the short single-stranded nucleic acid is coupled to the radionuclide chelating ligand, the labeling radionuclide solution is added and mixed, preferably but not limited to, shaking and reacting at 95°C for 15 minutes to obtain the radionuclide chelating ligand labeled with the labeling radionuclide and coupled with the short single-stranded nucleic acid.

[0033] Preferably, the product b obtained in step (2) needs to be further purified before being mixed with the product a for reaction. The method for further purifying the product b includes but is not limited to purification using a GE Life MiniTrip G-25 desalting purification column.

[0034] Preferably, the nucleic acid aptamer and the short single-stranded nucleic acid are both freeze-dried powders.

[0035] Finally, the present invention also provides the use of the above-mentioned integrated tumor diagnosis and treatment probe in the preparation of products for diagnosing and / or treating tumors. The integrated tumor diagnosis and treatment probe of the present invention can be effectively used for diagnosing and / or treating tumors, such as a radionuclide labeled PET imaging probe [ 68 Ga]NOTA-Apt-tFNA can be used for noninvasive visual molecular imaging of malignant colorectal cancer. 177 The Lu]DOTA-Apt-tFNA probe can be used for radiotherapy of malignant colorectal cancer, providing a new product option for the diagnosis and / or treatment of tumors. Moreover, the inventors of the present application used mice bearing malignant colorectal cancer tumor models to verify the radioactive imaging and therapeutic efficacy of the probe molecule.

[0036] The integrated tumor diagnosis and treatment probe of the present invention selects a specific tetrahedral framework nucleic acid by studying and designing tetrahedral framework nucleic acids of different sizes and structures, and connects a specific nucleic acid aptamer, a nuclide chelating ligand coupled with a specific nucleic acid short single strand and labeled with a nuclide, and utilizes the controllable programming characteristics of DNA nucleic acid to orderly adjust the size of the tetrahedral framework nucleic acid and the number of nucleic acid aptamers hybridized on the tetrahedral framework nucleic acid, thereby improving the in vivo specific targeting binding ability of the nucleic acid aptamer, enhancing the tumor uptake effect, reducing the retention of normal tissues and organs, being able to modulate its pharmacokinetics, increasing the exposure of the nucleic acid aptamer at the tumor site, and being able to be effectively used for the diagnosis and / or treatment of tumors.

[0037] The preparation method of the integrated tumor diagnosis and treatment probe of the present invention, when the tetrahedral framework nucleic acid is connected to the nucleic acid aptamer, the sequence constituting the tetrahedral framework nucleic acid and the nucleic acid aptamer can be solid-phase synthesized using a DNA synthesizer, the sequence can be customized, the batch-to-batch difference is small, and the reaction conditions are simple compared with the preparation of traditional antibody probes. The method can be generally used for the preparation of molecular probes for other molecular targets and different nuclides, and has broad application prospects and very high clinical transformation value in the diagnosis and precision treatment of tumor tissues in the future, and has the advantages of simple preparation process, low cost, high specificity, high stability, high imaging signal-to-multiple ratio, and easy clinical transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1A schematic diagram of the preparation process of an integrated tumor diagnosis and treatment probe according to an embodiment of the present invention;

[0039] Figure 2 A schematic diagram of the process of coupling a short single-stranded nucleic acid with a nuclide chelating ligand according to an embodiment of the present invention;

[0040] Figure 3 This is a high performance liquid chromatogram of a short single-stranded nucleic acid coupled with a nuclide chelating ligand NOTA according to an embodiment of the present invention;

[0041] Figure 4 This is a high performance liquid chromatogram of a short single-stranded nucleic acid coupled with a nuclide chelating ligand DOTA according to an embodiment of the present invention;

[0042] Figure 5 This is a high-resolution mass spectrum of a short single-stranded nucleic acid coupled with a nuclide chelating ligand NOTA according to an embodiment of the present invention;

[0043] Figure 6 This is a high-resolution mass spectrum of a short single-stranded nucleic acid coupled with a nuclide chelating ligand DOTA according to an embodiment of the present invention;

[0044] Figure 7 This is a PET / CT image of a tumor-bearing mouse two hours after the tail vein injection of the integrated tumor diagnosis and treatment probe according to an embodiment of the present invention;

[0045] Figure 8 This is a data diagram of the distribution of various organs of the integrated tumor diagnosis and treatment probe according to one embodiment of the present invention two hours after the tail vein injection of tumor-bearing mice;

[0046] Fig. 9 The signal intensity ratio of the tumor site and the muscle tissue of the integrated tumor diagnosis and treatment probe of one embodiment of the present invention after two hours of tail vein injection of tumor-bearing mice;

[0047] Fig.10 This is a digital image of the in vitro tumor of tumor-bearing mice 16 days after tail vein injection of the integrated tumor diagnosis and treatment probe according to an embodiment of the present invention and normal saline and a control group. DETAILED DESCRIPTION

[0048] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0049] Embodiments 1 to 36

[0050] The specific embodiments of the integrated tumor diagnosis and treatment probe of the present invention are as follows: in Embodiments 1 to 36, except for the addition amount of nucleic acid aptamers, the selection of nucleic acid single strands of tetrahedral framework nucleic acids, the selection of radionuclide chelating ligands, the selection of labeling radionuclides, etc., the remaining steps are the same.

[0051] The preparation method of the integrated tumor diagnosis and treatment probe described in Examples 1 to 36 is as shown in the attached Figure 1 As shown, the specific steps include:

[0052] (1) Preparation of product a

[0053] The nucleic acid single strands constituting the tetrahedral framework nucleic acid are mixed in equimolar amounts, and then a nucleic acid aptamer is added in an amount of 1 to 3 times the molar amount of a single nucleic acid single strand, and the mixture is placed in a PCR instrument for annealing treatment: firstly, the mixture is rapidly heated to 95°C and maintained for 5 minutes, and then the mixture is cooled to 4°C at a rate of 1°C per minute to complete annealing, thereby obtaining a product a; the nucleic acid aptamer (Apt) is SGC8 with 15 bases extended at the 5 end, and the nucleotide sequence thereof is: TTATTCCGATGTATT ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA, as shown in SEQ ID NO: 26 in Table 1;

[0054] (2) Preparation of product b

[0055] As attached Figure 2 The preparation process shown in the figure is to couple a short single-stranded nucleic acid with a nuclide chelating ligand NOTA or DOTA: NOTA or DOTA with NHS is dissolved in DMSO, and the dissolved NOTA-NHS or DOTA-NHS is added to a short single-stranded nucleic acid modified with a 5-terminal amino group (carbonate dissolved), wherein the nucleotide sequence of the short single-stranded nucleic acid is: 5'-TGT CAT AGA AGGGTT-3', as shown in SEQ ID NO: 25 in Table 1; react at room temperature for 120 min, then purify by high performance liquid chromatography HPLC, and confirm the molecular weight of the product by high resolution mass spectrometry, as shown in the attached Figures 3 to 6 As shown; attached Figure 3 Figure 1 is the HPLC chromatogram of the short nucleic acid strand after the NOTA ligand coupling. The main peak with a retention time of 9.05 min is the main product NOTA-short nucleic acid strand. Figure 4 The HPLC chromatogram of the short nucleic acid strand after DOTA ligand coupling, the main product DOTA-nucleic acid short strand is at a retention time of 10.91 min; Figure 5 This is a high-resolution mass spectrum of the short nucleic acid strands after NOTA ligand coupling. The main product, NOTA-short nucleic acid strands, has a molecular weight of 5122. Figure 6 This is the high-resolution mass spectrum of the short nucleic acid strand after DOTA ligand coupling. The main product, DOTA-short nucleic acid strand, has a molecular weight of 5213.6.

[0056] Then, the nuclide chelating ligands NOTA-nucleic acid short single strand or DOTA-nucleic acid short single strand coupled with nucleic acid short single strand were mixed with the labeling nuclide solution, heated to 95°C and shaken for 15 minutes, and then PBS was used as the mobile phase, and the free nucleic acid in the product was purified and separated using a pre-equilibrated MiniTrip PD-10 desalting column (GE Life). 68 Ga or 177 Lu ions, and product b is obtained; the preparation method of the labeling nuclide solution is: take 1 ml 68 Ga or 177 0.1M hydrochloric acid solution of Lu, and add 0.125ml 1M sodium carbonate solution to it, adjust the pH value to about 4-4.5, and let it stand for 5 minutes to form a labeling nuclide solution;

[0057] (3) Preparation of probe

[0058] The product a obtained in step (1) and the product b obtained in step (2) are mixed and reacted to obtain an integrated tumor diagnosis and treatment probe, and finally a radiochemical purity (RCP) of the probe is determined using a radio-thin layer chromatography (Radio-TLC, Eckert & Ziegler Radiopharma Inc).

[0059] The nucleic acid single-stranded sequences of the tetrahedral framework nucleic acids described in each embodiment are shown in Table 1, and the addition ratio of nucleic acid aptamers, the selection of nucleic acid single-stranded tetrahedral framework nucleic acids, the selection of radionuclide chelating ligands, and the selection of labeling radionuclides described in each embodiment are shown in Table 2.

[0060] Table 1

[0061]

[0062] In Table 1, the sequences SEQ ID NO: 1 to 4 are 17 bp tFNA (5' to 3'), the sequences SEQ ID NO: 5 to 14 are 26 bp tFNA (5' to 3'), and the sequences SEQ ID NO: 15 to 24 are 37 bp tFNA (5' to 3')

[0063] Table 2 Material selection in each example

[0064]

[0065] Effect Example 1

[0066] Experimental study on the effect of PET / CT molecular imaging of subcutaneous colorectal cancer using the integrated tumor diagnosis and treatment probe of the present invention

[0067] This effect example uses the probes prepared in the above Examples 1 to 9 as test objects, and the specific test method is as follows:

[0068] 1. Construction of PTK7-positive colorectal cancer tumor-bearing mouse model

[0069] (1) The HCT116 colorectal cancer cell line, which was confirmed to be PTK7-positive by Western blot, was pre-cultured;

[0070] (2) Digest the cultured HCT116 tumor cells and resuspend them in cell culture medium, then mix them with matrix gel (Corning 354234) at a ratio of 1:1. Place the mixed cell suspension on ice and perform tumor implantation as soon as possible.

[0071] (3) Take 100 μl of the cell suspension from step 2 (containing 1×10 6 The subcutaneous tumor transplantation model was established by injecting 4-5 week-old Balb / c nude mice (source) into the right axilla.

[0072] 2. Molecular imaging of subcutaneous colorectal cancer using probe PET / CT

[0073] (1) The tumor-bearing nude mice constructed by the above method were randomly divided into 9 groups, namely experimental groups 1 to 9, with 6 mice in each group. About 3.7 MBq of probe was injected into the nude mice of each group through the tail vein. Experimental groups 1 to 9 were injected with the probes prepared in Examples 1 to 9 respectively;

[0074] (2) Two hours after injection, the tumor-bearing nude mice were anesthetized with isoflurane (3%) mixed with oxygen and placed in a prone position on the IRIS small animal PET / CT scanning bed in a deeply anesthetized state. PET and CT images were acquired sequentially and image reconstruction was completed using the IRIS system's own software. The results are shown in the attached figure. Figure 7 As shown;

[0075] (3) Use the OsiriX Lite image processing workstation (Pixmeo SARL) to outline the regions of interest such as the tumor, heart, and major tissue organs (liver, spleen, lung, kidney, muscle) on the reconstructed PET images, as shown in the attached figure. Figure 7 shown.

[0076] Attached Figure 7In the figure, a tumor-bearing mouse was randomly selected from each group and the PET / CT diagnosis and treatment integration diagram was obtained two hours after the probe was injected into the tail vein. Each group showed a separate PET image, CT image and PET / CT fusion image. The first row was the result images of experimental groups 1 to 3 (using the probes prepared in Examples 1 to 3). The probes prepared in Examples 1 to 3 were molecular probes of tetrahedral framework nucleic acids with an edge length of 17 bases hybridized with one, two, and three nucleic acid aptamers, respectively; the second row was the result images of experimental groups 4 to 6 (using the probes prepared in Examples 4 to 6). The probes prepared in Examples 4 to 6 were molecular probes of tetrahedral framework nucleic acids with an edge length of 26 bases hybridized with one, two, and three nucleic acid aptamers, respectively; the third row was the result images of experimental groups 7 to 9 (using the probes prepared in Examples 7 to 9). The probes prepared in Examples 7 to 9 were molecular probes of tetrahedral framework nucleic acids with an edge length of 37 bases hybridized with one, two, and three nucleic acid aptamers, respectively.

[0077] By the attached Figure 7 It can be seen that each group of molecular probes can accurately molecularly image subcutaneous colorectal cancer tumors, namely HCT116 tumors. This shows that the tumor diagnosis and treatment integrated probe of the present invention can be used for PET / CT molecular imaging of subcutaneous colorectal cancer. In addition, according to the attached Figure 7 OsiriX Lite image processing workstation (Pixmeo SARL) was used to outline the regions of interest such as tumor, heart, and major tissue organs (liver, spleen, lung, kidney, muscle) on the reconstructed PET images. It can be seen that two hours after the injection of the probes in each group, the molecular probes in each group showed obvious changes in uptake in the tumor tissue. It is worth noting that the most obvious tumor enrichment signal was observed in experimental group 1 (molecular probes prepared in Example 1 using a tetrahedral framework nucleic acid with an edge length of 17 bases hybridized to a nucleic acid aptamer) two hours after injection.

[0078] Effect Example 2

[0079] Biodistribution test of the integrated tumor diagnosis and treatment probe of the present invention in a tumor-bearing mouse model

[0080] The method for constructing the tumor-bearing mouse model used in this effect example is the same as that in effect example 1.

[0081] This effect example specifically includes the following steps:

[0082] (1) The constructed tumor-bearing nude mouse model was randomly divided into 9 groups, namely experimental groups 1 to 9, with 6 mice in each group. About 3.7 MBq of probe was injected into the tumor-bearing nude mice of each group through the tail vein. Experimental groups 1 to 9 were injected with the probes prepared in Examples 1 to 9 respectively;

[0083] (2) Two hours after the probe injection, the mice were euthanized and dissected; the tumor, heart and major tissues and organs (liver, spleen, lung, kidney, muscle, heart, blood, bone, brain, large intestine, small intestine, etc.) were collected and weighed, and then the radioactivity of each tissue was measured using a γ-counter. The radioactivity uptake values ​​of the tumor and each tissue were calculated in %ID / g, and the biodistribution data of each organ of each group of tumor-bearing mice 2 hours after the probe was injected into the tail vein were counted, especially the data in the tumor area and muscle tissue. The results are shown in the attached figure. Figure 8 .

[0084] By the attached Figure 8 It can be seen that the molecular probes prepared in Examples 1 to 9 have a higher uptake in tumor tissues, and also have non-specific uptake in major excretion and metabolic organs (liver, kidney).

[0085] In addition, the signal intensity ratio between the tumor site and the muscle tissue was calculated two hours after the probe was injected into the tail vein of each group of mice. The results are shown in the attached figure. Fig. 9 As shown, the horizontal axes 1 to 9 represent experimental groups 1 to 9 respectively.

[0086] Depend on Fig. 9 It can be seen that 2 hours after the tail vein injection of the probes prepared in Examples 1 to 9, most of the tumor areas had signals more than five times higher than those of the muscle tissue, especially in Experimental Group 1 (a molecular probe prepared in Example 1 using a tetrahedral framework nucleic acid with an edge length of 17 bases hybridized to a nucleic acid aptamer) with a ratio as high as 25 or more, which can achieve high-contrast PET / CT imaging results.

[0087] Effect Example 3

[0088] Experimental study on the radiotherapy effect of the integrated tumor diagnosis and treatment probe in a tumor-bearing mouse model

[0089] The method for constructing the tumor-bearing mouse model in this effect example is the same as that in effect example 1.

[0090] The experimental method of this effect example specifically includes the following steps:

[0091] (1) The constructed tumor-bearing nude mouse model was randomly divided into 3 groups, 5 mice in each group, namely the experimental group, the control group and the normal saline group. The treatment methods of each group were as follows:

[0092] Experimental group: using the probe prepared in Example 28, injecting about 10 MBq of the probe prepared in Example 28 into each tumor-bearing nude mouse via the tail vein;

[0093] Control group: using the probe prepared by the control group, the control group differs from Example 28 in that the control chain TTATTCCGATGTATT NNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNN is used to replace the nucleic acid aptamer in Example 28, and the rest of the selection, addition amount and preparation method are the same as those in Example 28; about 10 MBq of the probe prepared by the control group is injected into each tumor-bearing nude mouse through the tail vein;

[0094] Normal saline group: injected with an equal volume of normal saline;

[0095] The length and width of the tumors of each group were measured every two days after injection, and the weight of the mice was recorded. Continuous observation was performed. When the tumor volume exceeded 1500 mm 3 The experiment was terminated when the tumor ruptured or the mouse body weight decreased by more than 20%. In this experiment, all mice were euthanized on the 16th day of radiotherapy.

[0096] During the experiment, it was found that the tumors in the saline group grew rapidly, with a compound exponential growth trend, and the tumor volume did not exceed 1500 mm 3 The mice in the saline control group were euthanized at the same time; the tumor growth rate in the control group was basically the same as that in the saline group, and it did not inhibit tumor growth; the tumor growth rate in the experimental group was slower than that in the above two groups, and there was a significant difference, showing effective ability to inhibit tumor growth. The mice in the saline group were euthanized to terminate the experiment. The tumor volumes of the mice in each group were compared, and the results are shown in the attached figure. Fig.10 As shown, it can be seen that the tumor volume of the experimental group is smaller than that of the saline group and the control group. In addition, the body weight of all mice in this experiment fluctuated within a small range, and no serious toxic side effects occurred.

[0097] It can be seen from this effect example that the integrated tumor diagnosis and treatment probe of the present invention has the ability to inhibit tumor growth, and no obvious physiological toxicity was found.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A tumor diagnosis and treatment integrated probe, characterized in that: The probe contains a nucleic acid aptamer, a tetrahedral framework nucleic acid, a radionuclide chelating ligand and a labeling radionuclide; each of the tetrahedral framework nucleic acids is connected to a nucleic acid aptamer, and the nucleic acid aptamer and the tetrahedral framework nucleic acid are connected by hybridization; the radionuclide chelating ligand is coupled to a short single-stranded nucleic acid and is labeled by the labeling radionuclide, and is connected to the tetrahedral framework nucleic acid; The tetrahedral framework nucleic acid contains four nucleic acid single strands, and the nucleotide sequences of the four nucleic acid single strands are shown in SEQ ID NOs 1 to 4 respectively; The short single-stranded nucleic acid coupled to the nuclide chelating ligand contains a 15-base nucleic acid sequence, one vertex of the tetrahedral framework nucleic acid contains a 15-base nucleic acid sequence complementary to the short single-stranded nucleic acid, and the nuclide chelating ligand is hybridized and connected to the tetrahedral framework nucleic acid through the 15-base nucleic acid sequence of the short single-stranded nucleic acid coupled to it; the nucleotide sequence of the short single-stranded nucleic acid is 5'-TGT CAT AGA AGG GTT-3'; The nucleotide sequence of the nucleic acid aptamer is 5'-TTATTCCGATGTATT ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3'; The nuclide chelating ligand is 1,4,7-triazacyclononane-1,4,7-triacetic acid, and the labeling nuclide is Ga-68; Alternatively, the nuclide chelating ligand is 10-tetraazacyclododecane-1,4,7,10-tetraacetic acid, and the labeling nuclide is Lu-177.

2. The method for preparing the integrated tumor diagnosis and treatment probe according to claim 1, characterized in that: The preparation method comprises the following steps: Step (1): Connecting the tetrahedral framework nucleic acid with the nucleic acid aptamer: mixing the nucleic acid single strands contained in the tetrahedral framework nucleic acid in equal molar amounts, then adding the nucleic acid aptamer in equal molar amounts to the nucleic acid single strands, and annealing in a PCR instrument to obtain product a; the annealing treatment is: firstly rapidly heating to 95°C and maintaining for 5 minutes, and then cooling to 4°C at a rate of decreasing by 1°C per minute to complete annealing, to obtain product a; Step (2): coupling a short single-stranded nucleic acid with a radionuclide chelating ligand, then adding a labeling radionuclide solution, reacting at 95° C. for 15 minutes, and obtaining a product b after the reaction; the labeling radionuclide solution is prepared by dissolving the labeling radionuclide with hydrochloric acid, and then adding sodium acetate buffer to adjust the pH to 4-4.5; the radioactive dose of the labeling radionuclide in the labeling radionuclide solution is 2 mCi-10 mCi; Step (3): Mix product a and product b to react, thereby obtaining the integrated tumor diagnosis and treatment probe.

3. The method for preparing the integrated tumor diagnosis and treatment probe according to claim 2, characterized in that: The nucleic acid aptamer is a freeze-dried powder; And / or, the short single-stranded nucleic acid is a freeze-dried powder.

4. Use of the integrated tumor diagnosis and treatment probe as claimed in claim 1 in the preparation of products for diagnosing and / or treating tumors.

Images