Preparation method of DNA (Deoxyribose Nucleic Acid) microspheres based on hyperbranched rolling circle amplification technology

Abstract

The invention relates to a preparation method of a DNA (deoxyribonucleic acid) microsphere based on a hyperbranched rolling circle amplification technology. The preparation method comprises the following steps: 1) respectively synthesizing an annular template fragment, a chain extension primer and a branching primer; (2) preparing an organic phase reaction solution and a water phase reaction solution, the organic phase reaction solution contains a surfactant with positive charges, the water phase reaction solution contains a multi-primer rolling circle amplification reaction system, and the multi-primer rolling circle amplification reaction system comprises the annular template fragment, the chain extension primer, the branched primer, dNTP and phi29 DNA polymerase; 3) mixing the organic phase reaction liquid and the water phase reaction liquid in an oscillating manner to form a vesicle structure in which the water phase is wrapped by the organic phase, and performing amplification for 2-4 hours according to the reaction temperature of the multi-primer rolling circle amplification reaction system, and 4) forming the DNA microspheres formed by cross-linking hyperbranched DNA chains in the vesicle structure after the amplification is completed.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a method for preparing a DNA microcapsule based on a hyperbranched rolling circle amplification technology. Background Art

[0002] With the development and improvement of DNA nanotechnology, DNA self-assembly systems with complex three-dimensional structures and specific biological functions have emerged in recent years, and have shown great development potential and application prospects in the fields of precision diagnosis and treatment of major diseases such as tumors, bioimaging and biosensing. Compared with synthetic polymer materials, DNA has unique advantages such as biocompatibility and sequence specificity. However, the synthesis of traditional DNA cross-linked structures often relies on non-directional self-assembly processes mediated by base complementary pairing. This method is simple and feasible in the preparation of some macroscopic gel materials or solid micro-nano materials based on double-stranded DNA skeletons, but due to the poor controllability of the cross-linking process, it is difficult to use it to prepare drug carriers with spherical shells and cavity structures, which limits the application of DNA self-assembly systems in drug delivery. Summary of the invention

[0003] The purpose of the present invention is to disclose a method for preparing a DNA microcapsule based on hyperbranched rolling circle amplification technology to solve one or more technical problems existing in the prior art and provide at least one beneficial option or create conditions.

[0004] The first aspect of the present invention is to provide a method for preparing DNA microcapsules based on hyperbranched rolling circle amplification technology.

[0005] The second aspect of the present invention is to provide a DNA microcapsule.

[0006] The third aspect of the present invention is to provide the use of the DNA microcapsule described in the second aspect of the present invention in drug delivery technology.

[0007] The preparation method described in the first aspect of the present invention comprises the following steps: 1) Synthesizing circular template fragments, chain extension primers and branching primers respectively; 2) preparing an organic phase reaction solution and an aqueous phase reaction solution, wherein the organic phase reaction solution contains a surfactant with a positive charge, and the aqueous phase reaction solution contains a multi-primer rolling circle amplification reaction system, wherein the multi-primer rolling circle amplification reaction system includes the circular template fragment, the chain extension primer, the branching primer, dNTP and phi29 DNA polymerase; 3) mixing the organic phase reaction solution and the aqueous phase reaction solution by oscillation to form a vesicle structure in which the organic phase encapsulates the aqueous phase, and performing amplification at the reaction temperature of the multi-primer rolling circle amplification reaction system for 2 to 4 hours; 4) After the amplification is completed, a DNA microcapsule formed by cross-linking of hyperbranched DNA chains is formed in the vesicle structure.

[0008] The preparation method is to combine the DNA polymerase-mediated multi-primer rolling circle amplification reaction with the directional cross-linking process of oligonucleotides at the oil-water interface to synthesize a micron-scale spherical shell DNA hydrogel carrier-DNA microcapsule. Since the organic phase reaction liquid contains a surfactant, a large number of micro-level vesicle structures can be generated by appropriate oscillation. The surfactant acts as a spherical membrane that separates the aqueous phase reaction liquid from the organic phase reaction liquid, and wraps the aqueous phase reaction liquid in the core part of the vesicle structure. When the selected surfactant contains a positive charge, the DNA part with negatively charged phosphate groups can be automatically adsorbed on the inner surface of the vesicle structure. Under the action of phi29 DNA polymerase, dNTP is used as the raw material of the reactant to amplify and generate ultra-long single-stranded DNA, and the single strand generates branched cross-linking under the action of branched primers to obtain a hyperbranched rolling circle amplification product. Since the entire hyperbranched rolling circle amplification process is carried out on the inner surface of the vesicle structure, a hollow sphere formed by cross-linking of DNA chains will eventually be formed under the action of DNA polymerase, which is the DNA microcapsule.

[0009] Preferably, the use of a more efficient super phi29 DNA polymerase can shorten the time required for amplification and ensure that the prepared DNA microcapsules have sufficient molecular weight.

[0010] In some application embodiments of the first aspect of the present invention, the total length of the circular template fragment is 40 to 120 nt, including a first complementary region, a second complementary region and a spacer sequence, the first complementary region is complementary to the chain extension primer, the branching primer has the same sequence as the second complementary region, the spacer sequence is located between the first complementary region and the second complementary region, and the spacer sequence is 8 to 12 nt in length.

[0011] Preferably, the total length of the circular template fragment is 60-110 nt.

[0012] When the sequence length of the circular template fragment is too short (<40 nt), the DNA chain will have a large steric hindrance and synthesis will be difficult; when the sequence length is too long (>120 nt), many DNA chains with shorter sequences will be obtained in the process of synthesizing the circular template fragment. It is speculated that the synthesized DNA chain may be unstable due to its long length and will break due to high temperature when removing by-products, resulting in a large number of fragmented DNA chains.

[0013] In some application embodiments of the first aspect of the present invention, the organic phase reaction liquid includes liquid paraffin.

[0014] In some application embodiments of the first aspect of the present invention, the surfactant is selected from at least one of Span 80, oleylamine, dioleoyl phosphatidylcholine or 1,2-dioleoyl-3-coacetylcholine, alkyl dimethyl betaine, sulfobetaine or dodecylaminopropionic acid.

[0015] In order to realize a one-pot preparation method, the surfactant and liquid paraffin can be fully dissolved with the aid of high temperature and ultrasound, and then the aqueous reaction liquid is added to prepare the DNA microcapsules.

[0016] In some application embodiments of the first aspect of the present invention, the preparation method further comprises the following steps after step 4: 5) adding a non-ionic surfactant to break the wrapping of the DNA microsphere capsule by the vesicle structure.

[0017] In some application embodiments of the first aspect of the present invention, the multi-primer rolling circle amplification reaction system further comprises dithiothreitol (DTT) and / or bovine serum albumin (BSA). The main purpose of DTT and BSA is to protect the activity of super phi29 DNA polymerase and improve the efficiency of the multi-primer rolling circle amplification reaction system.

[0018] In some application embodiments of the first aspect of the present invention, the volume ratio of the aqueous phase reaction liquid to the organic phase reaction liquid is 1 to 10:50. By adjusting the volume ratio of the aqueous phase reaction liquid to the organic phase reaction liquid, the average diameter of the DNA microcapsule can be adjusted to meet the requirements of different drug delivery components. The average diameter of the DNA microcapsule increases as the proportion of the aqueous phase reaction liquid increases.

[0019] The DNA microcapsule described in the second aspect of the present invention is prepared by the above-mentioned preparation method.

[0020] In some application embodiments of the second aspect of the present invention, a DNA microcapsule is provided. The DNA microcapsule is made of a specific circular template fragment, a chain extension primer and a branching primer according to the preparation method provided by the first aspect of the present invention; the sequence of the circular template fragment is shown in SEQ ID No: 1, the sequence of the chain extension primer is shown in SEQ ID No: 2, and the sequence of the branching primer is shown in SEQ ID No: 3.

[0021] The third application of the present invention refers to the use of the DNA microcapsule for drug delivery.

[0022] The beneficial effects of the present invention are: (1) A new method using interface-directed self-assembly was developed. The DNA component cannot be dissolved in the organic phase reaction solution and can only be enriched in the aqueous phase reaction solution. In addition, the electrostatic interaction between the surfactant and the DNA chain can achieve the directed self-assembly of the DNA component on the inner side of the vesicle structure.

[0023] (2) A new strategy for constructing hollow vesicle nanostructures is provided. After the DNA component is enriched in the liquid phase, it can be amplified with the help of phi 29 DNA polymerase to obtain DNA microcapsules with hollow structures. The hollow structure makes it possible for DNA microcapsules to load various drugs.

[0024] (3) The one-pot construction method is convenient and quick to operate. Without complicated operations, the construction of the vesicle structure and the multi-primer rolling circle amplification reaction system can be achieved simultaneously by mixing and oscillating the aqueous phase reaction solution and the organic phase reaction solution. The vesicle structure containing the raw materials required for the multi-primer rolling circle amplification reaction system can start the amplification reaction at 42°C.

[0025] (4) The prepared cavity has a stable structure and controllable size. The outer layer of the DNA microcapsule is composed of hyperbranched DNA chains. Different from the physical entanglement of general DNA hydrogels, the hyperbranched DNA chains are chemically cross-linked by hydrogen bonding of base pairs between cross-linked chains, and the structure is more stable. In addition, the size of the vesicle structure can be adjusted by adjusting the volume ratio between the aqueous phase reaction liquid and the organic phase reaction liquid, thereby achieving control of the size of the DNA microcapsule. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is a schematic diagram of the principle of synthesizing the circular template fragment in Example 1; Figure 2 is the electrophoresis diagram of the products of each step when synthesizing the circular template fragment in Example 1; Figure 3 is a schematic diagram of the principle of constructing a multi-primer rolling circle amplification reaction system in Example 2; Figure 4 is an electrophoresis diagram of the amplification product of the multi-primer rolling circle amplification reaction system in Example 2; Figure 5 is a schematic diagram of the principle of preparing DNA microcapsules in Example 3; Figure 6 is a microscopic observation photograph in Example 3, with a scale bar of 100 μm; Figure 7 This is a staining photograph observed by laser scanning confocal microscope in Example 3, with a scale bar of 50 μm; Figure 8 is a microscopic observation photograph of the vesicle structure generated by different solution volume ratios in Example 3, with a scale bar of 100 μm; Fig. 9 This is a laser scanning confocal microscope staining photograph of the horizontal control experiment in Example 4, scale bar 50 μm; Fig.10 This is a staining photograph of the extracted DNA microcapsules observed under a laser scanning confocal microscope in Example 4, with a scale bar of 50 μm. DETAILED DESCRIPTION

[0027] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications and substitutions made to the methods, steps or conditions of the present invention all belong to the scope of the present invention.

[0028] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0029] The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the Molecular Cloning Experiment Guide (3rd edition) or in accordance with the kits and product instructions; the biological materials of the kits, unless otherwise specified, can be obtained from commercial channels.

[0030] Example 1: Synthesis and purification of circular template fragments Based on the concept of the DNA microcapsule preparation method, it is necessary to first design a circular template fragment that can be used in a multi-primer rolling circle amplification reaction system and a corresponding chain extension primer.

[0031] The linearized nucleotide sequence of the circular template fragment (L1) is: 5'-[Phos] TCGTTTGATG TTCCTAACGTACCAACGCACACGCAGTATTATGGACTGGCAGTTGATCCTTTGGATACCCTGGAGCATAGAG GCATTGGCTG -3' (SEQ ID No: 1). The nucleotide sequence of the chain extension primer (P1) is: 5'-CATCAAACGACAGCCAATGC-3' (SEQ ID No: 2). The single underlined portion in the circular template fragment is complementary to the chain extension primer.

[0032] The specific method for synthesizing the circular template fragment is as follows Figure 1As shown in the figure, the blue area near the 5' end and the 3' end of L1 is the first complementary region complementary to P1. The specific synthesis process includes the following steps: the first step is to synthesize the linear single-stranded L1 and the primer P1, and then anneal L1 and P1 to form a ring structure with a gap. The second step is to use T4 DNA ligase to close the gap of L1 to form a complete ring structure. The third step is to add exonuclease Ⅰ (EXO Ⅰ) and exonuclease Ⅲ (EXO Ⅲ) to remove the by-products in the first two steps. The fourth step is to inactivate EXO Ⅰ and EXO Ⅲ at high temperature to prevent them from affecting subsequent reactions.

[0033] Samples were kept for each step of the synthesis of the circular template fragment and subjected to polyacrylamide gel electrophoresis to obtain the following Figure 2 The electrophoresis diagram shown. Lane 1 and Lane 3 correspond to the lengths of P1 and L1, respectively. P1 is located lower than L1, which means that the chain of P1 is shorter and moves more in the gel at the same voltage. Lane 4 is the product after annealing of P1 and L1. Unlike the clear bands of P1 and L1, it presents a wide distribution, which means that the product is no longer single, which is also in line with the design: double-stranded DNA containing products and by-products appears. Then Lane 5 is the product after adding T4 DNA polymerase. The band above becomes clear and presents a single distribution, which means that the product (ring structure with a gap) paired with L1 and P1 is produced as expected. Lane 6 is the image after adding EXO Ⅰ and EXO Ⅲ. It is found that it is different from the band of Lane 5, and the band of P1 at the bottom also disappears, which means that EXO Ⅰ and EXO Ⅲ act on the product and digest the unreacted single-stranded and double-stranded by-products.

[0034] Example 2: Multi-primer rolling circle amplification reaction design Based on the circular template fragment obtained in Example 1, the multi-primer rolling circle amplification (MCA) reaction system was constructed. The construction method is as follows: Figure 3As shown. In the MCA process, phi29 DNA polymerase is selected. Once the chain extension primer is complementary to the first complementary region of the circular template fragment, phi29 DNA polymerase can guide the synthesis of a new DNA single strand along the 3' end of the circular template fragment; similarly, there is a region complementary to the second complementary region in the DNA single strand amplified by the chain extension primer, and this region will also be complementary to the branching primer. At this time, phi29 DNA polymerase will continue to synthesize another new chain along the DNA single strand to achieve branching of the DNA chain. During the synthesis process, phi29 DNA polymerase will pair dNTP with the single-stranded DNA at the 3' end of the circular template fragment, and catalyze the formation of phosphodiester bonds at the active site of the enzyme to connect dNTP to the new DNA chain. During the synthesis of the new DNA chain, phi29 DNA polymerase will continuously guide the synthesis of the new DNA chain along the 3' end of the DNA template until it reaches the end of the template or encounters an obstacle. Once the synthesis of the polymer chain is completed, phi29 DNA polymerase will be released from the 3' end of the DNA template and the synthesized DNA chain will be kept on the template DNA. During the amplification process of phi29 DNA polymerase, each polymerase molecule can synthesize a DNA chain of about 70 kb. Since phi29 DNA polymerase is highly processive, only a few polymerase molecules are needed to synthesize a large number of DNA chains in a short period of time. Therefore, the amplification process of phi29 DNA polymerase can achieve cyclic amplification, that is, in each round of amplification, the generated DNA chain can be used as a template for the next round of amplification, thereby achieving exponential amplification.

[0035] The nucleotide sequence (P2) of the branched primer adapted in Example 1 is: 5'-TACCAACGCACACGCAGTAT-3' (SEQ ID No: 3). The constructed MCA reaction system includes: P1 (5 nM), P2 (5 nM), L1 (10 nM), dNTP (1.563 mM), super phi29 DNA polymerase and its buffer, DTT (1 mM), BSA (0.2 mg / mL) and an appropriate amount of deionized water; react at 42°C for 2 hours.

[0036] Agarose gel electrophoresis was used to characterize the reaction products of MCA. Figure 4As shown, Lane 3 is a Rolling Circle Amplification (RCA) reaction system without P2, which is used as a control. Lane 7 and Lane 8 are MAC reaction systems containing P2. Compared with Lane 7 and Lane 8, Lane 3 has obvious differences in bands, and the tailing phenomenon of the latter two is more obvious, which means that the molecular weight distribution of the synthesized product is wider and the overall structure has increased branching and cross-linking. Figure 4 The DNA molecular weight standard marker is added on the far right, which is a mixture of 8 single DNA bands, namely: 100 base pairs (bp), 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp. By comparison, we can roughly know that the molecular weight of the products amplified by the RCA and MAC reaction systems are far greater than 2000 bp.

[0037] Example 3, Characterization of vesicle structure Water-insoluble liquid paraffin is selected as the organic phase reaction liquid. In order to achieve the separation of the organic phase reaction liquid and the aqueous phase reaction liquid and the subsequent extraction of the DNA microcapsules, a surfactant containing both a hydrophobic group and a hydrophilic group is further introduced. After the addition of the surfactant, one side of the hydrophilic group combines with the aqueous phase reaction liquid, and the hydrophobic group combines with the outer layer of liquid paraffin. A large number of microscopic vesicle structures can be produced by tapping the centrifuge tube or oscillating appropriately. Under the action of the surfactant solution, the aqueous phase reaction liquid containing the MCA reaction system is wrapped inside and exists as the core part of the vesicle structure. The surfactant acts as a "cell membrane" that separates the aqueous phase reaction liquid from the external organic phase reaction liquid.

[0038] The surfactants selected in this embodiment are Span 80 and oleylamine. These two types are respectively cationic and non-ionic, which together constitute a surfactant solution. Among them, Span 80 is produced by the esterification of one or more sorbitan hydroxyl groups and fatty acids. It is hydrophobic, and the lipophilic group has good oil solubility and is easier to emulsify. It is widely used as an oil-in-water emulsifier. Therefore, it is used as one of the surfactant components to stabilize the overall liquid phase. Oleylamine is a common surfactant that can be used as an emulsifier, dispersant and plasticizer. Since the pKa value is about 10.0~10.7, when the pH of the reaction system is 8.0, the amine groups contained in oleylamine are protonated and carry a positive charge. Therefore, the DNA part with negatively charged phosphate groups in the liquid phase is adsorbed near the surface activity, that is, the inner surface of the vesicle structure, thereby realizing the directional self-assembly of the DNA nanostructure. The schematic diagram of the preparation method is shown in Figure 5As shown, after the enrichment of various reaction substrates is completed, dNTP is used as the raw material of the reactant under the action of phi29 DNA polymerase to produce ultra-long single-stranded DNA, and then branched cross-linking is generated under the action of P2 to obtain a hyperbranched rolling circle amplification product, and finally a demulsifier is used to extract the DNA microcapsule.

[0039] Preparation of organic phase reaction solution: Add Span 80 to a test tube containing liquid paraffin to prepare a mixture with a Span 80 concentration of 20 mM. Vortex the mixture thoroughly and then use an ultrasonic bath (CPX1800h-J, Branson) at 50°C for 1 hour. Prepare a liquid paraffin mixture with an oleylamine concentration of 20 mM in the same way. Mix Span 80 with an oleylamine solution at a molar ratio of 1:3 and dilute to prepare an organic phase reaction solution with a surfactant concentration of 10 mM. Ultrasonicate the prepared organic phase reaction solution again at 50°C for 1 hour to make it thoroughly dispersed.

[0040] Prepare the aqueous reaction solution: Prepare the MCA reaction system as the aqueous reaction solution: P1 (5 nM), P2 (5 nM), L1 (10 nM), dNTP (1.563 mM), DTT (1 mM), phi29 DNA polymerase (10~50 U) and its matching buffer.

[0041] 4 μL of aqueous phase reaction solution and 50 μL of organic phase reaction solution were mixed and shaken appropriately for a one-pot reaction. After reacting at 42 °C for 2 hours, 2 μL of the mixed solution was taken out and placed on a cell culture dish and observed under an inverted fluorescence microscope in the bright field, with the eyepiece selected at 10× and the objective lens selected at 40×. Figure 6 The spherical object shown.

[0042] To verify whether the observed spherical objects are oil-in-water vesicle structures, 5 μL of acridine orange (AO) staining solution, 85 μL of deionized water and 10 μL of 10× phosphate buffered saline (PBS) solution were fully mixed to obtain a total volume of 100 μL of AO stain. Then 2 μL of AO stain was taken out and mixed with 2 μL of aqueous phase reaction solution, and then 100 μL of organic phase reaction solution was added and mixed and shaken appropriately. 2 μL was taken out and dropped into the cell culture dish. After the vesicle structure was observed under an inverted fluorescence microscope, 2 μL was taken out again and dropped into the cell culture dish after reacting in a 42 ℃ constant temperature metal bath for 2 hours and observed using a laser scanning confocal microscope (Nikon, Japan, C2+&N-SIME). The objective lens selected was 20×, the excitation wavelength selected was 488 nm, and the receiving range was between 525 and 550 nm. Simultaneous observation in the DIC and fluorescence channels showed that Figure 7 The picture shown confirms that the spherical object indeed contains the aqueous reaction liquid stained with AO, that is, the observed spherical object is the vesicle structure.

[0043] Take 1 μL, 2 μL, 5 μL and 10 μL of the aqueous phase reaction solution and mix with 50 μL of the organic phase reaction solution to prepare test groups with different volume ratios. Oscillate each test group in the same way and with the same intensity, and observe under a microscope in the bright field to obtain Figure 8 The scale bars in the figures are all 100 μm, and it can be seen that the average diameter of the DNA microcapsules increases as the proportion of the aqueous phase reaction solution increases.

[0044] Example 4, Preparation and Extraction of DNA Microcapsules The specific method for preparing DNA microcapsules is as follows: 1) L1 described in Example 1 is used as the circular template fragment, P1 is used as the chain extension primer, and P2 described in Example 2 is used as the branching primer; 2) preparing an organic phase reaction solution and an aqueous phase reaction solution according to the method described in Example 3; 3) Oscillating and mixing the organic phase reaction liquid and the aqueous phase reaction liquid to form a vesicle structure in which the organic phase encapsulates the aqueous phase. Amplification is performed at an ambient temperature of 42°C. Since the raw materials required for the amplification process are enriched inside the vesicle structure under the influence of the charge, the branched DNA chains formed by the amplification product are also cross-linked inside the vesicle structure. After more than 2 hours of MCA reaction, hyperbranched DNA microcapsules encapsulated by the vesicle structure can be obtained.

[0045] 4) Using an organic demulsifier to break the vesicle structure, after separation and washing, the DNA microsphere capsule can be obtained. The organic demulsifier selected here is Triton-X. The solubility of Span 80 and oleylamine in Triton-X 100 is higher than that in liquid paraffin, so they will dissolve in Triton-X 100 to achieve the effect of breaking the vesicle structure. In addition, Triton-X 100 is a relatively mild ingredient, commonly used in cell membrane-related experiments, and has low cytotoxicity.

[0046] The complete MCA reaction system was used as the experimental group, and a control group was set up for horizontal comparison. Control group 1 was MCA without P1 and P2, control group 2 was MCA without L1 and P2, and control group 3 was MCA without L1 and P1. After each group reacted at 42°C for 2 hours, laser scanning confocal microscopy was used to find that the three parallel control groups were different from the experimental group that underwent the normal MCA process. The results are shown in Fig. 9 As shown in the figure, the control group with only a single component (L1, P1 or P2) did not show fluorescence, and only the experimental group with the three reaction raw materials mixed showed fluorescence. This shows that: first, the single reaction raw material cannot be stained with fluorescence by the AO dye due to its low concentration, that is, the fluorescence in the experimental group is not caused by the reaction raw material. Secondly, the product of the MCA process did achieve directed self-assembly inside the surfactant layer of the general DNA microcapsule as expected. Some of the solid spherical shells in the figure are likely to be small vesicle structures that have been completely filled with MCA products.

[0047] Triton-X 100 with a volume ratio of 2% was used to extract DNA microcapsules. The results were observed under a laser scanning confocal microscope. Fig.10 As shown in the figure, the expected irregular round vesicle structure appeared in the clear liquid at the bottom. This is because oleylamine and Span 80 were dissolved in Triton-X 100, which broke the original spherical vesicle structure and exposed the DNA microcapsules in the aqueous reaction liquid to present an irregular elliptical shape.

[0048] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

Claims

1. A method for preparing a DNA microcapsule, characterized in that: Includes steps: 1) Synthesizing circular template fragments, chain extension primers and branching primers respectively; 2) preparing an organic phase reaction liquid and an aqueous phase reaction liquid, wherein the organic phase reaction liquid contains a surfactant that ensures droplet stability and carries a positive charge, and the aqueous phase reaction liquid contains a multi-primer rolling circle amplification reaction system, wherein the multi-primer rolling circle amplification reaction system includes the circular template fragment, the chain extension primer, the branching primer, dNTP and phi29 DNA polymerase; 3) mixing the organic phase reaction solution and the aqueous phase reaction solution by oscillation to form a vesicle structure in which the organic phase encapsulates the aqueous phase, and performing amplification at the reaction temperature of the multi-primer rolling circle amplification reaction system for 2 to 4 hours; 4) After the amplification is completed, a DNA microcapsule formed by cross-linking of hyperbranched DNA chains is formed in the vesicle structure.

2. The preparation method according to claim 1, characterized in that: The total length of the circular template fragment is 40 to 120 nt, including a first complementary region, a second complementary region and a spacer sequence, the first complementary region is complementary to the chain extension primer, the branching primer has the same sequence as the second complementary region, the spacer sequence is located between the first complementary region and the second complementary region, and the length of the spacer sequence is 8 to 12 nt.

3. The preparation method according to claim 1, characterized in that: The organic phase reaction liquid includes liquid paraffin.

4. The preparation method according to claim 1, characterized in that: The surfactant is selected from at least one of Span 80, oleylamine, dioleoyl phosphatidylcholine or 1,2-dioleoyl-3-coacetylcholine, alkyl dimethyl betaine, sulfobetaine or dodecylaminopropionic acid.

5. The preparation method according to claim 1, characterized in that: Also includes the steps: 5) adding an organic demulsifier to break the encapsulation of the DNA microsphere capsule by the vesicle structure.

6. The preparation method according to claim 1, characterized in that: The multi-primer rolling circle amplification reaction system also includes dithiothreitol and / or bovine serum albumin.

7. The preparation method according to claim 1, characterized in that: The volume ratio of the aqueous phase reaction liquid to the organic phase reaction liquid is 1-10:

50.

8. A DNA microcapsule, characterized in that: Prepared by the preparation method according to any one of claims 1 to 7.

9. The DNA microcapsule according to claim 8, characterized in that: The sequence of the circular template fragment is shown in SEQ ID No: 1, the sequence of the chain extension primer is shown in SEQ ID No: 2, and the sequence of the branching primer is shown in SEQ ID No:

3.

10. Use of the DNA microcapsule according to claim 8 or 9 in drug delivery.

Images