Preparation method of nano antibody of PD1 and fluorescence labeling flow type and immunohistochemical application of antibody

Abstract

The invention relates to the technical field of biological detection reagents, in particular to a preparation method of a PD1 nano antibody and fluorescence labeling flow and immunohistochemical application of the antibody, the PD1 nano antibody comprises a heavy chain variable region, and the heavy chain variable region comprises the following CDRs: CDR1 as shown in an amino acid sequence NO.1, CDR2 as shown in an amino acid sequence NO.2 and CDR3 as shown in an amino acid sequence NO.3. The ELISA (enzyme-linked immuno sorbent assay) binding titer of the PD1 nano antibody disclosed by the invention and PD1 protein is more than 1: 20000. The flow application dilution multiple is 1: 1000 or above, and the nano antibody has the advantages of small molecular weight, small immunogenicity and better solubility and stability.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection reagents, and in particular to a method for preparing a nano antibody of PD1 and a fluorescently labeled flow cytometry application of the antibody. Background Art

[0002] In 1993, Belgian scientist Hamers-Casterman and his team first reported a special antibody lacking light chains found in the blood of camelids (camels, alpacas and their close relatives), namely heavy chain antibodies. Compared with ordinary antibodies, it only contains one heavy chain variable region (VHH) and two conventional CH2 and CH3 regions ( Figure 1 ). By cloning its variable region, a single-domain antibody consisting only of the heavy chain variable region can be obtained, which is called Nanobodies (Nbs). Later, scientists also found similar antibodies in cartilaginous fish such as nurse sharks, whitebait sharks and rays. The VHH crystal is 2.5 nanometers (millimeters), 4 nanometers long, and has a molecular weight of only 15KD (kilodaltons). It is the smallest functional antigen-binding fragment in nature. Compared with traditional antibodies, nanobodies are not just small, they have many advantages:

[0003] (1) Small size, only one-tenth of that of ordinary antibodies. Because of its small size, it has stronger penetration in animal tissues. For example, it can pass through human brain tissue and reach the inside of high-density tumors, which ordinary antibodies cannot do. The small size advantage of nano antibodies allows people to use them to treat certain tumors or brain diseases.

[0004] (2) Stable efficacy. Nanobodies can survive longer in the body than ordinary antibodies, which means that their efficacy lasts longer. They can also adapt to a wider temperature range and can still function at temperatures as high as 90°C, while traditional antibodies will be inactivated in such a state. Even at extreme pH values, their performance is very stable and they can even pass through the human stomach and remain effective.

[0005] (3) Good antigen specificity and easy genetic modification. Nanobodies can recognize unique antigen structural epitopes, have a wider antigen binding capacity than ordinary antibodies, and are easy to artificially modify to obtain antibodies against different pathogens. Nanobodies can be easily synthesized in microorganisms, can be expressed in large quantities in microorganisms such as bacteriophages, Escherichia coli, and yeast, and are easy to mass produce.

[0006] PD-1 (programmed death receptor 1) is an important immunosuppressive molecule, belonging to the immunoglobulin superfamily, and is a membrane protein of 288 amino acid residues. It was originally cloned from the apoptotic mouse T cell hybridoma 2B4.11. Immune regulation targeting PD-1 is of great significance in anti-tumor, anti-infection, anti-autoimmune disease, and organ transplant survival. The ligand of PD1, PD-L1, is highly expressed in several cancers, so the role of PD1 in cancer immune evasion has been well confirmed, and monoclonal antibodies targeting PD-1 are being developed to enhance the immune system for the treatment of cancer. Many tumor cells express PD-L1, an immunosuppressive PD-1 ligand; inhibiting the interaction between PD-1 and PD-L1 can enhance T cell responses in vitro and mediate preclinical anti-tumor activity, which is called immune checkpoint blockade. Combination therapy using anti-PD1 and anti-CTLA4 therapeutics has become an important tumor treatment within the field of checkpoint inhibition. Combinations of PD1 and CTLA4 antibodies have been shown to be more effective than either antibody alone in treating a variety of cancers. The effects of the two antibodies do not appear to be redundant. Anti-CTLA4 treatment results in enhanced antigen-specific T cell-dependent immune responses, while anti-PD-1 appears to reactivate the ability of PD1+ T cells to lyse cancer cells. In clinical trials, combination therapy has been shown to be effective in reducing tumor size in patients who were unresponsive to single co-inhibitory blockade, despite increased levels of toxicity due to anti-CTLA4 treatment. The combination of PD1 and CTLA4 induced up to ten-fold higher numbers of PD1+ T cells that were actively infiltrating tumor tissue. It is hypothesized that the higher levels of PD1+ T cell infiltration are due to anti-CTLA-4 inhibiting the conversion of CD4 T cells to T regulatory cells, and further reducing the T regulatory inhibition of anti-PD-1. The molecular factors and receptors necessary to make tumors receptive to anti-PD1 therapy remain unknown. PDL1 expression on the surface of cancer cells plays an important role. PDL1-positive tumors are twice as likely to respond to combination therapy; however, patients with PDL1-negative tumors also have limited responses to anti-PD1, suggesting that PDL1 expression is not an absolute determinant of treatment effectiveness. Higher mutational burden in tumors is associated with greater effects of anti-PD-1 therapy. In clinical trials, patients who benefited from anti-PD1 therapy had cancers such as melanoma, bladder cancer, and gastric cancer, and their median average number of mutations was higher than those who did not respond to treatment; however, the correlation between higher tumor burden and the clinical effectiveness of PD-1 immune blockade remains uncertain.

[0007] Therefore, PD1 nanoantibodies have great value in the treatment and diagnosis of diseases, and also have great development prospects in the antibody-targeted diagnosis and treatment of tumors. Summary of the invention

[0008] Therefore, the method for preparing nano antibodies of PD1 and the fluorescent labeling flow cytometry and immunohistochemistry applications of antibodies have specific recognition and binding capabilities and can achieve excellent detection effects in PD-L1 immunoassays, especially flow cytometry applications.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solution: comprising a variable region, wherein the variable region comprises any one or more of CDR1, CDR2 or CDR3 sequences:

[0010] (I), the CDR1 has the amino acid sequence shown in No.1, the CDR2 has the amino acid sequence shown in No.2, and the CDR3 has the amino acid sequence shown in ID No.3;

[0011] (II) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I), and having the same function as the amino acid sequence described in (I); or

[0012] (III) An amino acid sequence having 95% or more identity with the amino acid sequence described in (I) or (II).

[0013] Preferably, the method for preparing the nano-antibody of PD1 and the fluorescent labeling flow cytometry and immunohistochemistry application of the antibody, the variable region has:

[0014] (I), the amino acid sequence shown in No.4;

[0015] (II) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I), and having the same function as the amino acid sequence described in (I); or

[0016] (III) An amino acid sequence having 95% or more identity with the amino acid sequence described in (I) or (II).

[0017] Preferably, in the method for preparing nanobodies of PD1 and the fluorescent labeling flow cytometry and immunohistochemistry applications of the antibodies, the number of the substitutions, deletions or additions of one or more amino acids is 2, 3, 4 or 5.

[0018] The preferred method for preparing the PD1 nanobody and the fluorescent labeling flow cytometry and immunohistochemistry application of the antibody include a nucleic acid molecule, characterized in that the nucleic acid molecule has:

[0019] (I), the nucleotide sequence shown in No.5;

[0020] (II), a complementary nucleotide sequence to the nucleotide sequence shown in No. 5;

[0021] (III) a nucleotide sequence that encodes the same protein as the nucleotide sequence of (I) or (II) but is different from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or (IV) a nucleotide sequence obtained by replacing, deleting or adding one or two nucleotide sequences to the nucleotide sequence shown in (I), (II) or (III), and having the same or similar function as the nucleotide sequence shown in (I), (II) or (III); or (V) a nucleotide sequence that has at least 95% sequence identity with the nucleotide sequence described in (I), (II), (III) or (IV).

[0022] Preferably, the method for preparing the nano-antibody of PD1 and the fluorescent-labeled flow cytometry and immunohistochemistry application of the antibody, the conjugate includes a chemical label or a biological label. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The following is the sequence appendix table of the present invention;

[0024] Figure 2 This is the application of PD1 nanobody in flow cytometry in Example 3 of the present invention;

[0025] Figure 3 This is the expression identification of PD1 nanobody in Example 2 of the present invention;

[0026] Figure 4 This is the affinity identification of different dilutions of PD1 nanoantibody to PD1 antigen in Example 1 of the present invention;

[0027] Figure 5 This is a distribution diagram of PD1 nanobody-positive cells in tonsils identified in Example 4 of the present invention. Specific implementation methods

[0028] Example 1 Construction and screening of nanobody phage display library

[0029] Step (1) Animal immunization: After mixing PD1 antigen and Freund's adjuvant in a ratio of 1:1, immunize adult alpacas by subcutaneous injection at the back at a dose of 0.5 mg / time, for a total of 4 immunizations, with an immunization interval of 2 weeks.

[0030] Step (2) Extracting total RNA: 10 ml of peripheral blood from the immunized animal was taken, and PBMC was separated by density gradient centrifugation. 1 ml of PBMC was added with 500 ul Trizol and 100 ul chloroform, and the mixture was shaken vigorously for 15 s, and allowed to stand at room temperature for 5 min; centrifuged at 12000 g, 4°C for 10 min, and the supernatant was discarded. 500 ul of 75% ethanol was added to wash the precipitate; centrifuged at 7500 g, 4°C for 5 min, and the supernatant was discarded; dried at room temperature for 10 min, an appropriate amount of DEPC water was added, and the mixture was incubated at 55°C for 10 min. After the agarose gel was cut and recovered, the concentration was adjusted to 1 μg / μL with RNase-free water.

[0031] Step (3) Obtaining antibody variable region genes: Use the reverse transcription kit instructions to reverse transcribe cDNA using the RNA obtained in step (2) as a template. Amplification of antibody variable region genes: Use the cDNA obtained by reverse transcription as a template for PCR reaction. Amplification is performed in two rounds. The primer sequences for the first round of PCR are as follows:

[0032] No.7:GTCCTGGCTGCTCTTCTACAAGG

[0033] No.8:GGTACGTGCTGTTGAACTGTTCC

[0034] PCR reaction conditions and procedures were as follows: 95°C for 5 min; 95°C for 30 s, 57°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 7 min;

[0035] The band of about 700 bp was recovered using an agarose gel recovery kit, and the nucleic acid concentration was finally adjusted to 5 ng / μl with water.

[0036] The primer sequences for the second round of PCR are as follows:

[0037] No9: GATGTGCAGCTGCAGGAGTCTGGRGGAGG

[0038] No10: CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT

[0039] PCR reaction conditions and procedures are as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, 15 cycles; 72°C for 7 min, and agarose gel excision to recover the nanobody fragments.

[0040] Step (4) vector construction and clone selection: PstI and BstEII double-digest 10ug pHEN4 vector, 5ul 10x buffer, add water to 50ul, and digest at 37℃ for 1h; PstI and BstEII double-digest the antibody fragment in step (3), 5ul 10x buffer, add water to 50ul, and digest at 37℃ for 1h. Recover the vector and antibody fragment after digestion with agarose gel; take 100ng of antibody fragment recovered by digestion, 300ng of vector recovered by digestion, 2ul T4 ligase, 2ul 10x buffer, add water to 20ul, and connect at 16℃ overnight. Take 10μL of the purified ligation product, electrotransfer to 50μL Escherichia coli TG1 competent cells, dilute and plate after recovery culture, randomly select clones, and perform colony PCR identification. Calculate the library capacity based on the PCR positive rate (library capacity = number of clones × dilution factor × [positive rate] PCR identification × 10). The PCR primer sequences are as follows:

[0041] No.11:TTATGCTTCCGGCTCGTATG

[0042] No12:CCACAGACAGCCCTCATAG

[0043] Step (5) Phage screening of nanoantibodies: Take an appropriate amount of the bacterial library in step (4) and inoculate it into 200 mL of 2*YT medium containing tetracycline and ampicillin, culture at 37°C and 250 rpm until OD600 = 0.5, add 1 mL of helper phage M13KO7, and infect at 37°C for 30 min. Add kanamycin with a final concentration of 50 ug / mL and 200 uM

[0044] IPTG, 30°C, 250rpm overnight culture, PEG8000 / NaCl precipitation, PBS dissolution to obtain phagosomes

[0045] Bacteria display library. PD1 antigen was coated at a concentration of 2ug / ml, blocked with 3% BSA, and washed with PBST. 100uL of phage was added, incubated at room temperature for 2h, washed 10 times with PBST, and the eluted phage was transfected with TG1 and entered the next round of screening. After 3 rounds of screening, positive clones were verified by ELISA and sequenced.

[0046] Example 2 Expression and purification of PD1 antibody

[0047] Step (1) Plasmid preparation: The antibody gene sequence was directly synthesized into the eukaryotic expression vector pcDNA3.1 and transformed into Top10. The transformant was inoculated into 5 mL of LB medium and cultured overnight at 37°C, 200 rpm, and then inoculated into 400 mL of LB medium at 1% and cultured overnight at 37°C, 200 rpm. Centrifuge at 6000 rpm, room temperature for 6 minutes, and discard the supernatant. Then the plasmid was extracted using a plasmid extraction kit.

[0048] Step (2) plasmid expression: 293F cells are cultured and transfected at a cell density of 2×106 cells / ml and a viability of >95%. Taking the transfection of 20 ml of cells as an example, add 20 ug of DNA to the expression medium to make a final volume of 1 ml and mix by pipetting. Add 60 ul of PEI (1 mg / ml) to 940 ul of expression medium and mix by pipetting. Add the mixed PEI to the mixed DNA, mix by pipetting, and let stand at room temperature for 15 minutes. Slowly add the mixture to 18 ml of 293F cells, shake gently, and culture on a shaker at 37°C, 8% CO2, and 120 rpm for 5 days. The day of transfection is recorded as day 0, and supplements are added on days 1 and 3. On day 6, collect the supernatant.

[0049] Step (3) Antibody purification: Centrifuge the supernatant obtained in step (2) at 8000RPM for 15 minutes, add the supernatant to the activated nickel column, and react at 4°C for 2 hours. Wash the impurities with PBS. Elute with PBS + 500mM imidazole 3 times, 1-2-1mL each time, and let stand for 10 minutes each time. Collect the eluate and ultrafilter to obtain purified antibody.

[0050] Example 3 Labeling and flow cytometry of PD1 antibodies

[0051] Step (1) Antibody labeling: dilute the antibody with 0.1 M NaHCO 3 solution (pH 8.3) to a final concentration of 2 mg / mL.

[0052] Preheat a tube of 1 μmole YF647 fluorescein at room temperature, add 0.1 mL of anhydrous DMSO to the tube, and prepare a dye stock solution with a concentration of 10 mM. Stir or vortex to mix the protein solution, and gradually add 15-25 μL of the dye stock solution (10 mM) to make the dye / protein molar ratio range from 9:1 to 15:1. Stir the reaction at room temperature for 1 hour. Equilibrate a Sephadex G-25 dialysis column (10 mm × 300 mm) with PBS buffer (pH ~ 7.4). Add the reaction solution to the column and elute with 1× PBS buffer. Obtain the fluorescently labeled PD1 antibody.

[0053] Step (2) Flow cytometry of fluorescently labeled PD1 antibodies: 1. Cell resuspension: After cell processing and counting, resuspend the cells with cell washing solution (PBS containing 2% BSA) to a cell concentration of 1×107 / mL; 2. Control setting: Take 100uL of the above resuspended cells in each tube of blank control, isotype control, and test sample to make the number of cells in each tube reach 1×106 / tube; 3. Primary antibody incubation: No antibody is added to the blank control tube, and 5-20uL of isotype antibody and target antibody are added to the isotype control tube and the test sample tube, respectively. Mix well and incubate at 4°C for 30min. During the incubation period, shake the reaction tube every 10min. Allow cells and antibodies to fully react; 4. Cell washing: add appropriate amount of cell washing solution, centrifuge at 1000rpm for 5min, discard the supernatant, and wash repeatedly for 2 times; 5. Cell resuspending: use 100μL cell washing solution to resuspend the cells; 6. Secondary antibody incubation: add appropriate amount of fluorescently labeled secondary antibody to the isotype control tube and the test tube respectively, mix well, incubate at 4℃ in the dark for 30min or at room temperature in the dark for 30min in winter. Shake the reaction tube every 10min during the incubation period; 7. Cell washing: add appropriate amount of cell washing solution, centrifuge at 1000rpm for 5min, discard the supernatant, and wash repeatedly for 2 times; 8. Detect on the machine.

[0054] Example 4 Immunohistochemical detection of PD1 antibodies

[0055] Paraffin sections

[0056] Step (1) baking: take out the tonsil slices, insert them into a slide rack, and place them in an oven at 60-65° C. for 1-1.5 hours.

[0057] Step (2) Dewaxing to water: Paraffin sections are rapidly dewaxed to water.

[0058] 1) Xylene 10min

[0059] 2) Xylene 10min

[0060] 3) Xylene 5min

[0061] 4) Anhydrous ethanol 5min

[0062] 5) Anhydrous ethanol 5min

[0063] 6) 95% ethanol for 5 min

[0064] 7) 85% ethanol for 5 min

[0065] 8) Wash in tap water

[0066] Step (3) Antigen retrieval:

[0067] 1) Wash the dewaxed tissue sections with tap water, then rinse them five times with distilled water, and place the washed tissue sections in distilled water for later use.

[0068] 2) Place the pressure cooker on the induction cooker, pour antigen repair solution into the pressure cooker, plug in the power supply, heat on high heat until boiling, press the pause button without pressing the valve, put in the spare washed tissue sections (shake off the excess water on the slide rack before putting in), make sure the tissue on the sections is completely immersed in the antigen repair solution, then cover the lid, press the valve, continue heating until the pressure cooker sprays, then adjust the heat to low, continue spraying for 3-4 minutes, turn off the heat, and unplug the plug.

[0069] 3) Wait for the air valve to drop naturally, open the pressure cooker, and let the repair solution in the pot cool naturally.

[0070] 4) After the temperature of the repair solution drops to an appropriate temperature, take out the tissue sections and place them in a beaker filled with distilled water, and then rinse them with distilled water 5-6 times.

[0071] Step (4) blocking:

[0072] 1) After washing the slices, pour out the distilled water in the beaker, add 0.3% H2O2 to the beaker containing the tissue slices, and block for 2 minutes.

[0073] 2) Take out the slices, rinse them six times with distilled water, and place them in distilled water for later use.

[0074] Step (5) blocking and adding primary antibody:

[0075] 1) Take out a clean slice and shake off the excess water on the tissue slice. Use filter paper to wipe off the water around the tissue, and then use an immunohistochemistry pen to circle the tissue (the beginning and end must be closed and cannot be drawn on the tissue) to prevent the antibody from flowing out.

[0076] 2) After painting, soak it in a small tank filled with cleaning fluid.

[0077] 3) Take out the circled tissue slices, shake off the excess cleaning solution, and after the circle is completely revealed, add the sealing agent to ensure that the tissue is completely covered, and react at room temperature for 30 minutes.

[0078] 4) Directly shake off the sealant on the tissue section, do not soak or rinse, and directly add 200-fold diluted PD1 nanoantibody to the tissue until the tissue is completely covered.

[0079] 5) Cover the wet box and shake gently to ensure that the primary antibody is evenly covered on the tissue. Incubate in the wet box at 37°C for 1 hour.

[0080] Step (6) Enzyme labeling:

[0081] 1) Take out the incubation wet box and rewarm at room temperature for 30 minutes. After rinsing with clear water, soak the slides 4 times, each time for 5 minutes.

[0082] 2) Take the tissue section out of the slide rack, shake off excess liquid, put it into a wet box, add an appropriate amount of peroxidase-labeled His-tag antibody to the tissue until it completely covers the tissue, shake it slightly to evenly cover the tissue, cover the wet box, and place the wet box in a 37°C incubator for 30 minutes.

[0083] Step (7) color development:

[0084] 1) Take the wet box out of the incubator, rinse with clear water, and then soak the slides 4 times, 5 minutes each time.

[0085] 2) Shake off excess liquid and add DAB color developing solution to the tissue. Shake well and let it stand for no more than 2 minutes.

[0086] 4) After color development is completed, rinse the DAB color developing solution on the slide, place the slide in tap water to terminate the color development reaction, and rinse with running water for 2-5 minutes.

[0087] Step (8) Restaining

[0088] 1) Place the tissue sections that have been stained in hematoxylin for counterstaining for 30 seconds to 3 minutes.

[0089] 2) Rinse with running water for 1-2 minutes.

[0090] Step (9) Dehydration

[0091] 1) 85% ethanol for 2 min

[0092] 2) 95% ethanol for 2 min

[0093] 3) Anhydrous ethanol 2min

[0094] 4) Anhydrous ethanol 4min

[0095] Take out the tissue sections from the last cylinder of anhydrous ethanol, shake off the excess alcohol, blow dry the slides with a hair dryer on cold air, set aside, make them transparent with xylene, seal the slides with neutral gum, and then take pictures after drying.

[0096] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and alterations may be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. Preparation method of PD1 nano-antibodies and application of fluorescent labeling flow cytometry and immunohistochemistry of antibodies, Features: comprising a variable region comprising any one or more of a CDR1, CDR2 or CDR3 sequence: (I), the CDR1 has the amino acid sequence shown in No.1, the CDR2 has the amino acid sequence shown in No.2, and the CDR3 has the amino acid sequence shown in ID No.3; (II) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I), and having the same function as the amino acid sequence described in (I); or (III) An amino acid sequence having 95% or more identity with the amino acid sequence described in (I) or (II).

2. The method for preparing the PD1 nanobody according to claim 1 and the fluorescent labeling flow cytometry and immunohistochemistry application of the antibody, Features: The variable region has: (I), the amino acid sequence shown in No.4; (II) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I), and having the same function as the amino acid sequence described in (I); or (III) An amino acid sequence having 95% or more identity with the amino acid sequence described in (I) or (II).

3. The method for preparing the PD1 nanobody and the fluorescent labeling flow cytometry and immunohistochemistry application of the antibody according to claim 1, Features: The number of the substitution, deletion or addition of one or more amino acids is 2, 3, 4 or 5.

4. The method for preparing the nano-antibody of PD1 and the fluorescent labeling flow cytometry and immunohistochemistry application of the antibody according to claim 4, comprising a nucleic acid molecule, It is characterized in that The nucleic acid molecule has: (I), the nucleotide sequence shown in No.5; (II), a complementary nucleotide sequence to the nucleotide sequence shown in No. 5; (III) a nucleotide sequence that encodes the same protein as the nucleotide sequence of (I) or (II) but is different from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or (IV) a nucleotide sequence obtained by replacing, deleting or adding one or two nucleotide sequences to the nucleotide sequence shown in (I), (II) or (III), and having the same or similar function as the nucleotide sequence shown in (I), (II) or (III); or (V) a nucleotide sequence that has at least 95% sequence identity with the nucleotide sequence described in (I), (II), (III) or (IV).

5. The method for preparing the nano antibody of PD1 according to claim 1 and the fluorescent labeling flow cytometry and immunohistochemistry application of the antibody, Features: Conjugates include chemical labels or biological labels.

Images