Trichoderma reesei with low beta-glucosidase activity and high filter paper enzyme activity, and construction method and application thereof
By knocking out the cel3a and cel3b genes in Trichoderma reesei PX3, strains with low β-glucosidase activity and high filter paper enzyme activity were constructed, solving the problem of lagging cellulase production in existing technologies and improving cellobiose production capacity and cellulase degradation efficiency.
Patent Information
- Application Number
- CN202410998807.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-24
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2044-07-24
AI Technical Summary
Existing techniques for knocking out the β-glucosidase gene in Trichoderma reesei lead to delayed cellulase production and reduced enzyme levels, making it difficult to reduce β-glucosidase activity without affecting cellulase activity.
In Trichoderma reesei PX3, strains with low β-glucosidase activity and high filter paper enzyme activity were constructed by knocking out the β-glucosidase synthesis genes cel3a and cel3b and under the condition of continuous activation of cellulase transcription activator. Gene editing was performed using homologous recombination and the CRISPR-Cas9 system.
It achieved a significant reduction in β-glucosidase activity without decreasing cellulase activity, thereby improving cellobiose production capacity and cellulase degradation efficiency.
Smart Images

Figure CN119120229B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering, and particularly relates to a Trichoderma reesei with low beta-glucosidase activity and high filter paper enzyme activity, and a construction method and application thereof. BACKGROUND
[0002] The statements in this section merely provide background information related to the present application and do not necessarily constitute prior art.
[0003] In the strategy of starch production from straw, cellulose is partially degraded into cellotriose or cellobiose under the action of cellulase, and then glucose-1-phosphate can be generated under the action of cellobiose / cellotriose phosphorylase, and then linear starch is synthesized by the catalysis of alpha-glucan phosphorylase. This process directly generates glucose-1-phosphate without additional energy, and the whole conversion process is economical and energy-saving, which is a beneficial exploration for synthesizing edible starch from cellulose.
[0004] Trichoderma reesei is one of the most representative cellulose-degrading microorganisms, which can produce a large amount of exocellobiohydrolase (CBH) and endocellobiohydrolase (EG), and exhibit strong lignocellulose hydrolysis effect; in addition, under the optimized fermentation conditions, the protein secretion level of Trichoderma reesei is significantly high, which can reach 100 g / L, and can be used as a cellulase production strain in the strategy of cellulose synthesis starch. The cellulose-degrading enzymes secreted by Trichoderma reesei include endocellobiohydrolase, exocellobiohydrolase and beta-glucosidase (BG), cellulose is degraded into cellobiose under the action of endocellobiohydrolase and exocellobiohydrolase, and then cellobiose is degraded into glucose by beta-glucosidase, and the final degradation product is glucose.
[0005] In actual production, if Trichoderma reesei is to accumulate cellobiose, the BG responsible for degrading cellobiose in the cellulase system of Trichoderma reesei needs to be removed to reconfigure its cellulase system, so that the main product of cellulase hydrolysis can be changed from glucose to cellobiose. However, it has been reported that although knocking out BG genes such as cel1a, cel1b and cel3a in Trichoderma reesei can reduce BG enzyme activity, it will also cause the production of cellulase enzyme system to lag behind and the yield to decrease. Therefore, it is necessary to obtain an engineered strain with reduced BG enzyme activity but without affecting or improving cellulase activity through artificial modification. SUMMARY
[0006] In order to overcome the above-mentioned deficiencies of the prior art, the present application provides a Trichoderma reesei with low beta-glucosidase activity and high filter paper enzyme activity, and a construction method and application thereof.
[0007] In order to achieve the above-mentioned purpose, one or more embodiments of the present application provide the following technical solutions:
[0008] In a first aspect of the present application, a Trichoderma reesei with low beta-glucosidase activity and high filter paper enzyme activity is provided, which is obtained by knocking out beta-glucosidase synthesis genes from a Trichoderma reesei PXK1 strain.
[0009] The beta-glucosidase synthesis genes are cel3a and cel3b, the cel3a gene is TRIREDRAFT_76672, and the cel3b gene is TRIREDRAFT_121735.
[0010] In the specific embodiments of the present application, the Trichoderma reesei PXK1 is obtained by knocking out Ku70 protein from a Trichoderma reesei PX3 strain with a sustainably activated cellulase transcriptional activator.
[0011] The filter paper enzyme activity (FPA) reflects the total enzyme activity of a complex enzyme system composed of three cellulase hydrolysis enzymes, namely exoglucanase, endoglucanase and beta-glucosidase, after synergistic action, that is, the cellulase in the present application.
[0012] In a second aspect of the present application, a construction method of a Trichoderma reesei with low beta-glucosidase activity and high filter paper enzyme activity is provided.
[0013] The method is obtained by activating a cellulase transcriptional activator in Trichoderma reesei and knocking out one or more coding genes of beta-glucosidase.
[0014] In the specific embodiments of the present application, the method comprises:
[0015] 1) Constructing a Trichoderma reesei ku70 knockout mutant PXK1 and preparing protoplasts;
[0016] 2) Constructing a plasmid for knocking out beta-glucosidase synthesis genes; the plasmid comprises an sgRNA expression cassette targeting the beta-glucosidase synthesis genes;
[0017] 3) constructing a Donor DNA for knocking out a β-glucosidase synthesis gene;
[0018] 4) transforming the plasmid and the Donor DNA obtained in step 2) into PXK1 protoplasts at a concentration of 5×10 5-7 5) placing the protoplasts obtained in step 4) on a single spore culture medium to obtain target transformants by identifying the mycelial genome;
[0019] 5) placing the protoplasts obtained in step 4) on a single spore culture medium to obtain target transformants by identifying the mycelial genome;
[0020] In the specific embodiment of the present application, when the β-glucosidase synthesis gene is cel3a, the Donor DNA is obtained by amplifying the Trichoderma reesei PX3 genome with primers 3A-U-F / 3A-U-R or 3A-D-F / 3A-D-R to obtain the upstream homologous arm and the downstream homologous arm, respectively;
[0021] or, when the β-glucosidase synthesis genes are cel3a and cel3b, the Donor DNA is obtained by amplifying the Trichoderma reesei PX3 genome with primers 3A-U-F / 3A-U-R or 3A-D-F2 / 3A-D-R to obtain the upstream homologous arm and the downstream homologous arm of the cel3a gene, respectively, and the Donor DNA is obtained by amplifying the Trichoderma reesei PX3 genome with primers 3B-U-F / 3B-U-R or 3B-D-F2 / 3B-D-R to obtain the upstream homologous arm and the downstream homologous arm of the cel3b gene, respectively; wherein the nucleotide sequence of the primer 3A-U-F is shown in SEQ ID NO. 35; the nucleotide sequence of the primer 3A-U-R is shown in SEQ ID NO. 36; the nucleotide sequence of the primer 3A-D-F is shown in SEQ ID NO. 37; the nucleotide sequence of the primer 3A-D-R is shown in SEQ ID NO. 38; the nucleotide sequence of the primer 3A-D-F2 is shown in SEQ ID NO. 47; the nucleotide sequence of the primer 3B-U-F is shown in SEQ ID NO. 50; the nucleotide sequence of the primer 3B-U-R is shown in SEQ ID NO. 51; the nucleotide sequence of the primer 3B-D-F2 is shown in SEQ ID NO. 52; and the nucleotide sequence of the primer 3B-D-R is shown in SEQ ID NO. 53.
[0022] In the specific embodiment of the present application, the method for constructing the Trichoderma reesei ku70 knockout mutant PXK1 comprises the following steps:
[0023] 1-1) preparing protoplasts of Trichoderma reesei PX3;
[0024] 1-2) Constructing a knockout vector;
[0025] 1-3) ku70-U-F / R and primer ku70-D-F / R are used to amplify the donor DNA of ku70;
[0026] 1-4) 1-2 μg of donor DNA and 1.5-3 μg of knockout vector are added to 5*10 5-7 protoplasts, 1-2 μg of donor DNA and 1.5-3 μg of knockout vector are added to 5*10
[0027] The nucleotide sequences of the primers ku70-U-F / R and ku70-D-F / R are shown in SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, and SEQ ID NO. 14, respectively, the gene knockout vector includes an sgRNA target point targeting ku70, and the sequence of the sgRNA target point is shown in SEQ ID NO. 4.
[0028] In a third aspect of the present application, a low-beta-glucosidase-activity and high-filter-paper-enzyme-activity Trichoderma reesei or a construction method thereof is applied in any one or more of the following:
[0029] A1: application in degrading cellulose;
[0030] A2: application in producing cellobiose;
[0031] A3: application in producing an enzyme system with high filter paper enzyme activity and low beta-glucosidase activity;
[0032] The high activity is represented by a filter paper enzyme activity of 6.7-8 U / mL after 7 days of fermentation in 100-200 mL of medium, and the low activity is represented by a beta-glucosidase activity of 0.1-0.3 U / mL after 7 days of fermentation in 100-200 mL of medium.
[0033] In a fourth aspect of the present application, a method for producing low-activity beta-glucosidase is provided, which uses the low-beta-glucosidase-activity and high-filter-paper-enzyme-activity Trichoderma reesei enzyme production fermentation in the first aspect.
[0034] The above one or more technical solutions have the following beneficial effects:
[0035] The present application constructs a series of low BG enzyme activity and high filter paper enzyme activity or high filter paper enzyme activity strains by knocking out the BG gene in the strain (PXK1) expressing the continuously activated cellulase transcription activator, avoids the negative impact on cellulase production after BG knockout, and improves the cellulose degradation capacity. The cellulase provided by the present application can effectively degrade cellulose to generate cellobiose, improve the industrial production capacity of cellobiose, and has practical application value.
[0036] Advantages of the additional aspects of the present application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS
[0037] The drawings accompanying the specification of this application form a part thereof, serve to explain the principles of the application, and, together with a description of the illustrative embodiments, serve to explain the application, and do not limit the application unduly.
[0038] Figure 1 It is a schematic diagram of the overall technical route of the present application.
[0039] Figure 2 It is a schematic diagram of the pCPT0 plasmid in Example 1 of the present application.
[0040] Figure 3 It is a schematic diagram of the pCPT1 plasmid in Example 2 of the present application.
[0041] Figure 4 It is the strategy for assembling the tRNA-sgRNA expression array in Example 2 of the present application and the final P-L-(t-N-S-L) n Schematic diagram of knockout plasmid in the form of t-T.
[0042] Figure 5 It is a comparison of the enzyme activity and extracellular protein concentration of the cel3a single knockout strain in Example Four and Example Five of the present application and the cellobiose yield of PXK1, wherein A is the filter paper enzyme activity at 7 days of culture, B is the pNPG enzyme activity at 7 days of culture, and C is the cellobiose yield after 12h of reaction.
[0043] Figure 6 It is a comparison of the enzyme activity and cellobiose yield of the cel3a and cel3b double knockout strain in Example Four and Example Five of the present application and the cel3a single knockout strain and PXK1, wherein A is the filter paper enzyme activity at 7 days of culture, B is the pNPG enzyme activity at 7 days of culture, and C is the cellobiose yield after 12h of reaction. DETAILED DESCRIPTION
[0044] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application.
[0045] It should be noted that the present application is not exhaustive, which is known to those skilled in the art. The experimental methods in the following examples are not specified, and the experimental steps not described in detail are generally carried out according to the conventional conditions or according to the conditions recommended by the manufacturer, and are referred to the Guide to Molecular Cloning (USA) M.R. Green (USA) J. Sambrook, editor, fourth edition), Pathophysiology Experiment, online database, etc.
[0046] In the following examples, the materials, reagents, etc. used are obtained from commercial channels unless otherwise specified.
[0047] In the present application, "gene knockout" refers to deleting a specific gene from the genome by a certain method, so that the function of the specific gene is lost.
[0048] In the present application, "expression cassette" refers to an independent component of vector DNA, which is composed of genes and regulatory sequences expressed by transfected cells. The expression cassette is composed of three parts: a promoter sequence, an open reading frame, and a 3' untranslated region, which usually contains a polyadenylation site in eukaryotes. Different expression cassettes can be transfected into different organisms such as bacteria, yeast, plants, and plants.
[0049] In the present application, "plasmid" refers to a DNA molecule independent of the host cell chromosome, and in the present application, it specifically refers to an artificially constructed plasmid. In the specific embodiments of the present application, the "plasmid for knocking out the β-glucosidase synthesis gene" includes an autonomous replication element capable of replication in Trichoderma reesei, a CRISPR cas9 expression cassette capable of performing cleavage function, an expression cassette capable of expressing target sgRNA, and some screening markers; wherein, except that the target sgRNA needs to be designed according to the different targeted genes, all other elements in the plasmid can be known to those skilled in the art. For example, the autonomous replication element can use AMA1; the screening marker can be a nutrition-deficient screening marker, a fluorescent protein screening marker or an antibiotic screening marker, and in the specific embodiments of the present application, the uracil nutrition-deficient gene pyrG is used.
[0050] In the present application, the main experimental methods used are as follows:
[0051] 1. Detection of enzyme activity
[0052] Cellulose fermentation medium (1L): microcrystalline cellulose 20.0g, KH2PO4 5g, (NH4)2SO4 5.0g, CaCl2 1.0g, MgSO4 7H2O 0.6g, corn syrup 20.0g, 121℃ sterilization for 30min.
[0053] DNS solution (5L): weigh 104 g NaOH, add about 3L of distilled water to dissolve thoroughly, then add 910 g of potassium sodium tartrate and 25 g of anhydrous sodium sulfite, then add 30 g of 3,5-dinitrosalicylic acid (DNS), and finally add 25 g of heavy steam phenol in a fume hood and stir for one day, and then fill into a brown reagent bottle after being dissolved thoroughly, and store at room temperature for one week before use.
[0054] 0.2M acetic acid-sodium acetate buffer (1L): 4.84 mL of glacial acetic acid, 9.68 g of anhydrous sodium acetate, and distilled water to 1L, adjust the pH to 4.8.
[0055] 2. Filter paper enzyme activity assay (FPase activity):
[0056] (1) Take 7 Whatman No. 1 filter papers and punch out 5mm diameter circular filter paper pieces with a puncher, then take three as a group and add them to a 25mL enzyme activity assay tube as a substrate.
[0057] (2) Add 1.5 mL of acetic acid-sodium acetate buffer and 0.5 mL of diluted enzyme solution (no enzyme added for the control group) to the enzyme activity assay tube. Mix all the reaction systems thoroughly and place them in a 50°C water bath for 1h.
[0058] (3) After the reaction is completed, add 3 mL of DNS to terminate the reaction, add 0.5 mL of diluted enzyme solution to the control group, mix thoroughly, and then place in a boiling water bath for 10 min.
[0059] (4) Immediately after the boiling water bath is completed, place it in ice water to cool, then add distilled water to make up to 25 mL, and mix well by inverting.
[0060] (5) Take 200 μL of the reaction solution from each system to an enzyme-labeled tube, and measure the OD value at 540 nm wavelength, and then calculate it according to the glucose standard curve measured under the same conditions.
[0061] One unit of enzyme activity is defined as the amount of enzyme required to produce 1 μmol of reducing sugar per minute.
[0062] β-glucosidase activity assay (with pNPG as substrate):
[0063] (1) Take 1.5 mL of centrifuge tube and add 50 μL of 1 mg / mL pNPG substrate.
[0064] (2) Add 100 μL of enzyme solution diluted with 0.2M acetic acid-sodium acetate buffer, mix well, and then place in a 50°C water bath for 30 min.
[0065] (3) After the reaction is completed, 150 μL of 10% Na2CO3 solution is added to terminate the reaction.
[0066] (4) 200 μL of the reaction solution is taken into an enzyme-labeled tube, and the OD value is measured at 540 nm wavelength, and is substituted into the pNP standard curve measured under the same conditions for calculation.
[0067] β-glucosidase activity determination (with cellobiose as substrate):
[0068] (1) A 1.5 mL centrifuge tube is taken, and 100 μL of 2% cellobiose substrate is added.
[0069] (2) 100 μL of diluted enzyme solution (not added in the control group) and 100 μL of 0.2M acetic acid-sodium acetate buffer are added, mixed, and then placed in a 50°C water bath for 30 min.
[0070] (3) After the reaction is completed, 100 μL of diluted enzyme solution is added to the control group, and boiled in a water bath for 10 min.
[0071] (4) The sample is treated, and the glucose content is detected by HPLC.
[0072] Enzyme activity unit definition: The amount of enzyme required to produce 1 μmol of pNP or glucose per minute under the enzyme activity determination conditions.
[0073] 3. Determination of extracellular protein content
[0074] The determination method refers to the instructions of Modified Bradford Reagent (Shengong): First, a standard curve of Bradford solution is drawn, then 200 μL of Bradford reagent is added to the enzyme-labeled strip, 20 μL of diluted fermentation supernatant is added and blown evenly, and the OD value is measured at 595 nm wavelength after being reacted at room temperature for 5 min; the extracellular protein concentration in the fermentation supernatant is calculated according to the standard curve.
[0075] 4. Saccharification to produce cellobiose
[0076] The total saccharification system is 20 mL. The substrate addition amount is 10% (w / v, based on dry weight), 5 mL of 0.2M pH 4.8 acetic acid-sodium acetate buffer is added to maintain pH stability, 0.4% (w / v) of potassium sorbate and sodium benzoate are added as preservatives, and distilled water is added to make up to 20 mL. Reaction at 50°C, 150 rpm, sample is taken and analyzed by high performance liquid chromatography (HPLC).
[0077] Hydrothermal pretreatment of corn stalks: cut the stalks into 2-3 cm small pieces, solid-liquid ratio 1:10, 190℃ pretreatment for 15min, rinse the solid residue with water to neutral.
[0078] The strain and vector information used in the application are as follows:
[0079] Trichoderma reesei PX3 is a strain constructed by the applicant's research group, see Zhao Q, Zhang Z, Liu Z, et al. A closed-loop strategy for on-site production of saccharolytic enzymes for lignocellulose biorefinery using internal lignocellulosic hydrolysates [J]. Chemical Engineering Journal, 2024, 480: 148272. Escherichia coli competent cell Trans5a is purchased from Beijing Zomanbio Technology Co., Ltd.
[0080] Plasmid pFC330 is previously preserved by the applicant's research group, and the specific sequence and use method are shown in Nodvig C S, Nielsen J B, Kogle M E, et al. A CRISPR-Cas9 system for genetic engineering of filamentous fungi [J]. PLOS ONE, 2015, 10 (7). The specific sequence of plasmid pUC19 is shown in Norrander J, Kempe T, Messing J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis [J]. Gene, 1983, 26 (1): 101-106.
[0081] Plasmid pGG-Tr5S is constructed by the applicant, which can be used to construct sgRNA expression cassette through Golden Gate assembly, and is only used for knocking out ku70 gene. The construction method is shown in Example I. Plasmid psgRNA-tRNA Gly The plasmid is constructed by the applicant and synthesized by Beijing Qianke Biological Technology Co., Ltd. The S-L-t sequence is inserted at the multiple cloning site of the pUC19 plasmid, which is used to amplify the S-L-t sequence. The S-L-t sequence is the sgRNA backbone sequence-linking sequence-tRNA sequence, and the overall sequence of this part is as follows:
[0082] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG CACCGAGTCGGTGCAAACAAGCGTAATTGGTTTAGTGGTAAAATTCTCCGTTGCCATCGGGGAGCCCTGGGTTCGATTCCCAGATTACGCA.
[0083] The specific sequence and use method of pCas9-2 can be found in Wang Q, Zhao Q, Liu Q, et al. CRISPR / Cas9-mediated genome editing in Penicillium oxalicum and Trichoderma reesei using 5S rRNA promoter-driven guide RNAs [J]. Biotechnol Lett, 2021, 43(2): 495-502.
[0084] The present application will be further described in detail below in combination with specific examples, and it should be pointed out that the specific examples are an explanation of the present application rather than a limitation.
[0085] Example 1
[0086] The present embodiment discloses Trichoderma reesei PXK1 and a construction method thereof.
[0087] In order to improve the integration efficiency of exogenous genes, the repair mechanism of non-homologous end joining mediated by Ku70 / Ku80 protein in Trichoderma reesei PX3 is used in the present application, and ku70 is knocked out. Among them, Trichoderma reesei PX3 has been disclosed in Zhao Q, Zhang Z, Liu Z, et al. A closed-loop strategy for on-site production of saccharolytic enzymes for lignocellulose biorefinery using internal lignocellulosic hydrolysates [J]. Chemical Engineering Journal, 2024, 480: 148272;
[0088] The method is specifically implemented as follows:
[0089] (1) Using the Trichoderma reesei PX3 genome as a template, the 5S promoter sequence of Trichoderma reesei is amplified using primer pair GG-5S-F / GG-5S-BsaI-R, so that the 3' end of the amplified promoter has two BsaI enzyme cutting sites in opposite directions (the sticky ends after enzyme cutting are TATG and TTTC, respectively), a TTTTTT terminator and a homologous region at one end of the linearized pUC19 plasmid, and the 5' end has a homologous region at the other end of the linearized pUC19 plasmid. The pUC19 plasmid is cut with KpnI, and the 5S promoter sequence is connected to the linearized pUC19 plasmid by ClonExpress IIOne Step Cloning Kit kit to construct an auxiliary plasmid pGG-Tr5S containing the 5S rRNA promoter (the sequence is SEQ ID NO. 2 in the published text CN 116179544A), two BsaI enzyme cutting sites and a TTTTTT terminator.
[0090] (2) The 20bp sgRNA target for knocking out the ku70 gene is designed using the sgRNA design website CHOPCHOP, and the sgRNA skeleton with the 20bp sgRNA target is amplified using primer pair sgku70-GG-F / sgku70-GG-R with psgRNA-tRNA Gly as a template. The sgRNA skeleton with the corresponding target is connected to pGG-Tr5S by Golden Gate assembly, and then pGG-Tr5S with the connected target is amplified using primer pair 5S-OC-F / 5S-OC-R to obtain an sgRNA expression cassette containing the 5S rRNA promoter, the complete sgRNA and the TTTTTT terminator. The complete sgRNA expression cassette is inserted into the pFC330 plasmid by ClonExpress IIOne Step Cloning Kit kit to construct the complete knockout plasmid. The corresponding target of ku70 is shown in SEQ ID NO. 4 (CGAGACTCTGAAAGACGAGG).
[0091] (3) The upstream fragment of the ku70 gene is amplified using primer pair ku70-U-F / ku70-U-R with the Trichoderma reesei PX3 genome as a template, and the downstream fragment of the ku70 gene is amplified using primer pair ku70-D-F / ku70-D-R with the Trichoderma reesei PX3 genome as a template. The donor DNA (Donor DNA) without a selection marker is constructed by fusion PCR and amplification using primer pair.
[0092] (4) The donor DNA (1.5 μg) and the knockout plasmid (2 μg, pFC330 with the sgRNA targeting ku70) are transformed into Trichoderma reesei PX3 protoplasts by protoplast transformation method.
[0093] (5) Pick the transformants and place them on the single spore medium to grow, and extract the genome after the mycelium grows, and use primer pair ku70-YZ-F / ku70-YZ-R to verify the genotype.
[0094] (6) Purify the transformants to obtain the ku70 gene knockout strain PXK1.
[0095] The nucleotide sequences of the primers used above are shown in Table 1 as follows:
[0096] Table 1: Primers required for knockout vector construction
[0097]
[0098]
[0099] In order to improve the gene knockout efficiency, the present application also designs a new plasmid pCPT1 for knocking out the target gene.
[0100] The specific construction method is as follows:
[0101] Firstly, the plasmid pCPT0 for reverse screening and high-efficiency expression of Cas9 protein is constructed, including the following steps:
[0102] (1) Use PacI and NheI to cut the pFC330 plasmid, and cut down AMA1, E. coli replication origin and ampicillin resistance gene ampR.
[0103] (2) Use the Trichoderma reesei genome as a template, and use primer pair OC-Ppdc-Cas9-F / Ppdc-Cas9-R to amplify the endogenous pdc promoter of Trichoderma reesei (SEQ ID NO. 2), so that the 3' end of the amplified promoter has a homologous region of the Cas9 protein coding sequence, and the 5' end has a homologous region of the other end of the pFC330 plasmid, and a new SgsI enzyme cutting site is added between the 5' homologous region and the promoter sequence; use Cas9-Tpdc-F / Tpdc-pyrG-R to amplify the pdc terminator (SEQ ID NO. 3).
[0104] Using pCas9-2 containing a complete expression cassette of Cas9 gene as a template, the primer pair Cas9-flag-F / Cas9-flag-R was used to amplify the SV40 NLS sequence and 3xFLAG sequence in the coding sequence of Cas9 protein, and the 5' end SV40 NLS sequence and the 5' end Cas9 protein sequence were codon-optimized for T. reesei (SEQ ID NO. 1) so that the codons corresponding to the sequence were adapted to T. reesei. The primer pair Cas9-op-F / Cas9-Tpdc-R was used to amplify the Cas9 protein and nucleoplasmin NLS sequence in the coding sequence of Cas9 protein; the primer pair Tpdc-pyrG-F / OC-pyrG-330-R was used to amplify pyrG selection marker from pCas9-2 as a template, so that the amplified pyrG fragment had a homologous region at one end of pFC330 plasmid at the 3' end, and a new NheI restriction site was added between the homologous region and the fragment sequence, and the 5' end had a homologous region of the 3' end of the pdc terminator. Subsequently, ClonExpress IIOne Step Cloning Kit was used for vector construction, and all fragments were connected into a complete plasmid to construct pCPT0 plasmid, as shown in Figure 2 .
[0105] The primer nucleotide sequences used above are shown in Table 2 below:
[0106] Table 2: Primers required for plasmid construction Secondly, the plasmid pCPT1 for assembling tRNA-sgRNA expression array by homologous recombination method was constructed.
[0107] The pCPT0 plasmid was digested with NheI. The primer pair GG-M13R(-48)-F / OC-5GSG-R0 was used to amplify the 5S promoter from pGG-Tr5S as a template, so that the 5' end of the amplified promoter had a homologous region at one end of the linearized pCPT0 plasmid, and the 3' end had a tRNA Gly homologous region; the primer pair OC-5GSG-F1 / OC-5GSG-R1 was used to amplify the tRNA sequence, so that the 3' end of the amplified tRNA sequence had a homologous region at one end of the sgRNA, and the 5' end had a homologous region of the 5S promoter. The three sequences were inserted into the pCPT0 plasmid by one-step cloning to construct the pCPT1 plasmid, as shown in Figure 3 . The primer pair was used to amplify the sgRNA-tRNA sequence, so that the 5' end of the amplified promoter had a tRNA GlyThe homologous region at the 3' end with the other end of the linearized pCPT0 plasmid, and the two sequences are inserted into the pCPT0 plasmid by one-step cloning to construct the pCPT1 plasmid, as shown in Figure 3 The sequence of the tRNA is shown in SEQ ID NO. 27 (GCGTAATTGGTTTAGTGGTAAAATTCTC-CGTTGCCATCGGGGAGCCCTGGGTTCGATTCCCAGATTACGCA
[0108] The sgRNA skeleton sequence is shown in SEQ ID NO. 28 (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC).
[0109] The nucleotide sequences of the primers used above are shown in Table 3:
[0110]
[0111] Example II
[0112] The present example provides a Trichoderma reesei single gene knockout strain with low beta-glucosidase activity and high filter paper enzyme activity and a method for constructing the same.
[0113] (1) According to the method of Double-joint PCR, see Yu J H, Hamari Z, Han K H, et al. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi [J]. Fungal Genet Biol, 2004, 41(11): 973-981. First, find the location of the cel3a gene on the genome according to the genomic information of Trichoderma reesei QM6a (website: https: / / mycocosm.jgi.doe.gov / Trire_Chr / Trire_Chr.home.html). Use the corresponding primer pair to amplify the upstream homologous arm (3A-U-F / 3A-U-R) and the downstream homologous arm (3A-D-F / 3A-D-R) using the Trichoderma reesei genome as the template. Use the primer pair pyrG-F / pyrG-R to amplify the selection marker gene pyrG using the pCPT0 plasmid as the template. After cutting and recovering the above three fragments, perform fusion PCR on the upstream homologous arm, pyrG, and downstream homologous arm at a molar ratio of 1:2:1. Then, use the nested PCR primer pair (such as 3A-CS-F / 3A-CS-R) to amplify the fusion product, and cut and recover to obtain the knockout cassette for knocking out the β-glucosidase gene.
[0114] (3) Transform the knockout cassette into Trichoderma reesei PXK1 protoplasts.
[0115] (4) Pick the transformants and place them on a single spore culture medium for growth. After the mycelium grows, extract the genome and use the primer pair 3A-YZ-F / 3A-YZ-R to verify the genotype.
[0116] (5) Purify the transformants to obtain Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity.
[0117] The primer nucleotide sequences used above are shown in Table 4 below:
[0118] Table 4: Primers required for knockout cassette construction
[0119]
[0120]
[0121] Example Three
[0122] This example provides a Trichoderma reesei multi-gene knockout strain with low β-glucosidase activity and high filter paper enzyme activity and a method for constructing the same.
[0123] For ease of understanding, this embodiment will be described using the knockout of cel3a and cel3b as an example.
[0124] Specifically, the following steps are included:
[0125] (1) The coding sequences of cel3a and cel3b genes were found in the genome, and the corresponding sgRNAs were designed using CHOPCHOP. The sgRNA sequences are TCAAGGTAGCTCAACATCGG and AGGCGTCCGATGATCCAGCA (SEQ ID NO.43, SEQ ID NO.44).
[0126] (2) The pCPT1 plasmid was digested with NheI. psgRNA-tRNA was then used. Gly Using primer pairs as templates
[0127] The SLt sequence was amplified using OC-tG-3b-3a-F / OC-tG-3b-3a-R, so that the 5′ end of the amplified promoter contained a homologous region of the pCPT1 plasmid and a 20bp sgRNA target site of the cel3b gene, and the 3′ end contained a 20bp sgRNA target site of the cel3a gene and a homologous region of the pCPT1 plasmid. Ligation was performed using a one-step cloning process to construct a complete editing plasmid. When knocking out three or more genes, multiple SLt sequences were amplified, each with sgRNA target sites of different genes at both ends, and then ligated using a one-step cloning process to construct a plasmid as shown below. Figure 4 The PL-(tNSL) shown n -tT knockout plasmids, where P is the promoter, L is the linker sequence, t is the tRNA sequence of Trichoderma reesei, N is the sgRNA sequence targeting different genes, S is the sgRNA backbone sequence, n is the number of target sites, and T is the terminator.
[0128] (3) Using the Trichoderma reesei PX3 genome as a template, primer pairs 3A-UF / 3A-UR were used to amplify the upstream fragment of the cel3a gene, 3A-D-F2 / 3A-DR to amplify the downstream fragment of the cel3a gene, 3B-UF / 3B-UR to amplify the upstream fragment of the cel3b gene, and 3B-D-F2 / 3B-DR to amplify the downstream fragment of the cel3b gene. The upstream and downstream fragments of the cel3a gene and the cel3b gene were then connected by fusion PCR to construct a donor DNA without selection markers.
[0129] (4) The two donor DNAs and the knockout plasmid obtained in step (2) were co-transformed into Trichoderma reesei PXK1 protoplasts, with each donor DNA added at a rate of 3 μg, the knockout plasmid added at a rate of 2 μg, and the PXK1 protoplast concentration at 5 × 10⁻⁶. 60.5 to 1.0 mg / mL.
[0130] (5) The transformants were picked and placed on single-spore medium for growth. After the mycelium grew, the genome was extracted, and primers 3A-YZ-F / YZ-pyrG-R2 and 3B-YZ-F / YZ-pyrG-R2 were used to verify the knock-out of cel3a and cel3b, respectively. The verification of cel3b found that the starting strain could not amplify a band, and the knock-out strain could amplify a 2.4 kb band. The verification of cel3a found that the starting strain could not amplify a band, and the knock-out strain could amplify a 2.8 kb band. The results showed that the double knock-out efficiency could reach 82.14%.
[0131] The nucleotide sequences of the primers used are shown in Table 5 below:
[0132] Table 5: Required primers
[0133]
[0134]
[0135] Example Four
[0136] This example provides enzyme activity detection of BG knock-out strains.
[0137] The BG knock-out strains were inoculated into cellulase fermentation medium and cultured at 50°C and 200 rpm for 7 days. After 7 days of fermentation, the extracellular enzyme solution of the BG knock-out strains was taken to detect the β-glucosidase and filter paper enzyme activity. At the seventh day, the knock-out of cel3a reduced the extracellular β-glucosidase activity from 1.32 U / mL of PXK1 to 0.28 U / mL, a decrease of 79%, and also increased the filter paper enzyme activity from 5.55 U / mL of PXK1 strain to 6.39 U / mL. Figure 5 It can be seen that, compared with Δcel3a, the double knock-out strain of cel3a and cel3b further reduces the extracellular BG activity while ensuring that the filter paper enzyme activity does not decrease, from 0.222 U / mL of Δcel3a to 0.196 U / mL at the seventh day, a decrease of 12%.
[0138] Example Five
[0139] This example provides detection of the cellobiose production capacity of BG knock-out strains.
[0140] Detection of the cellobiose production capacity of single knock-out strains:
[0141] Using 10% (w / v) microcrystalline cellulose (MCC) as the substrate, the enzyme solution of the cel3a single knock-out strain was added at 5 mg protein / g MCC for saccharification experiments, and the results are shown in Figure 6 A and Figure 6 B, respectively.Figure 6 The cellobiose production of the 12h saccharification product composition of A can be seen, the enzyme system hydrolysis of Δcel3a produces cellobiose significantly increased, from PXK1 6.46mg / mL to 12.72mg / mL increased by 97%.
[0142] cel3a and cel3b knockout strain of cellobiose production capacity test:
[0143] The saccharification experiment was carried out with 10%(w / v) hot water pretreated corn stalk as the substrate, and the enzyme solution was added at 6mg protein / g MCC. The results are shown in Table 2. Figure 6 C, at 12 hours, the cellobiose yield of the single knockout strain increased from 8.10mg / mL of PXK1 to 13.93mg / mL, and the double knockout strain continued to increase the cellobiose yield on the basis of the single knockout strain, from 13.93mg / mL to 14.81mg / mL, and reduced the glucose yield, from 3.82mg / mL to 3.42mg / mL.
[0144] The details of the present application are known.
[0145] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Although the foregoing embodiments of the present application have been described in detail, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.
Claims
1. A low beta-glucosidase activity and high filter paper activity Trichoderma reesei, characterized in that, A Trichoderma reesei PXK1 is used as a starting strain, and a β-glucosidase synthesis gene is knocked out to obtain; The beta-glucosidase synthetic gene is cel3a and cel3b ; the cel3a gene number is TRIREDRAFT_76672; the cel3b gene number is TRIREDRAFT_121735; the sgRNAs for knocking out cel3a and cel3b the genes are shown in SEQ ID NO. 43 and SEQ ID NO. 44, respectively; The Trichoderma reesei PXK1 is used as a starting strain, and a ku70 protein is knocked out by homologous recombination to obtain.
2. A method for constructing a Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity, characterized in that, A cellulase transcriptional activator is activated in Trichoderma reesei, and a β-glucosidase coding gene is knocked out to obtain; A Trichoderma reesei PXK1 is used as a starting strain, and a β-glucosidase synthesis gene is knocked out to obtain; The beta-glucosidase synthetic gene is cel3a and cel3b ; the cel3a gene number is TRIREDRAFT_76672; the cel3b gene number is TRIREDRAFT_121735; the sgRNAs for knocking out cel3a and cel3b the genes are shown in SEQ ID NO. 43 and SEQ ID NO. 44, respectively; The Trichoderma reesei PXK1 is used as a starting strain, and a ku70 protein is knocked out by homologous recombination to obtain.
3. The construction method of claim 2, wherein, It comprises: 1) constructing a Trichoderma reesei ku70 knockout mutant PXK1 and preparing protoplasts; 2) constructing a plasmid for knocking out a β-glucosidase synthesis gene; the plasmid comprises an sgRNA expression box targeting the β-glucosidase synthesis gene; 3) constructing a Donor DNA for knocking out a β-glucosidase synthesis gene; 4) Transform the plasmid obtained in step 2) and the Donor DNA into PXK1 protoplasts at a concentration of 5 x 10 5-7 individual genes, 2-4 μg for double genes) to the protoplasts at a concentration of 5 x 10 5) placing the obtained in step 4) on a single spore culture medium, and obtaining a target transformant by identifying the mycelial genome.
4. The construction method of claim 3, wherein, When the β-glucosidase synthesis gene is cel3a and cel3b the Donor DNA is amplified from the Trichoderma reesei PX3 genome by primers 3A-U-F / 3A-U-R or 3A-D-F2 / 3A-D-R to obtain the homologous arm upstream of the cel3a gene and the homologous arm downstream of the cel3a gene, respectively, and the Donor DNA is amplified from the Trichoderma reesei PX3 genome by primers 3B-U-F / 3B-U-R or 3B-D-F2 / 3B-D-R to obtain the homologous arm upstream of the cel3b gene and the homologous arm downstream of the cel3b gene, respectively; The nucleotide sequence of the primer 3A-U-F is shown in SEQ ID NO. 35; the nucleotide sequence of the primer 3A-U-R is shown in SEQ ID NO. 36; the nucleotide sequence of the primer 3A-D-F is shown in SEQ ID NO. 37; the nucleotide sequence of the primer 3A-D-R is shown in SEQ ID NO. 38; the nucleotide sequence of the primer 3A-D-F2 is shown in SEQ ID NO. 47; the nucleotide sequence of the primer 3B-U-F is shown in SEQ ID NO. 50; the nucleotide sequence of the primer 3B-U-R is shown in SEQ ID NO. 51; the nucleotide sequence of the primer 3B-D-F2 is shown in SEQ ID NO. 52; and the nucleotide sequence of the primer 3B-D-R is shown in SEQ ID NO.
53.
5. The construction method of claim 3, wherein, The method for constructing the Trichoderma reesei ku70 knockout mutant PXK1 comprises the following steps: 1-1) preparing protoplasts of Trichoderma reesei PX3; 1-2) constructing a knockout vector; 1-3) amplifying ku70 Donor DNA by using primers ku70-U-F / R and ku70-D-F / R; 1-4) In 5 x 10 5-7 protoplasts, 1-2 μg of Donor DNA and 1.5-3 μg of knockout vector are added, and after protoplast transformation, transformants are picked and grown on single spore medium, and are obtained after identification of the mycelial genome, The nucleotide sequences of the primers ku70-U-F / R and ku70-D-F / R are shown in SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, and SEQ ID NO. 14, respectively, and the knockout vector comprises an sgRNA target point targeting ku70.
6. The construction method of claim 5, wherein, The sgRNA target point sequence targeting ku70 is shown in SEQ ID NO.
4.
7. Use of the low β-glucosidase activity and high filter paper enzyme activity of Trichoderma reesei of claim 1 or the construction method of claim 2 in any one or more of the following: A1. In the degradation of cellulose; A2. In the production of cellobiose; A3. In the production of high activity filter paper enzyme, low β-glucosidase activity; said high activity being 6.7-8 U / mL filter paper enzyme activity after 7 days of fermentation in 100-200 mL of medium, and low being 0.1-0.3 U / mL β-glucosidase activity after 7 days of fermentation in 100-200 mL of medium. obtained using the low β-glucosidase activity and high filter paper enzyme activity of Trichoderma reesei of claim 1. 8. A method for producing low active β-glucosidase, characterized by,
Citation Information
Patent Citations
Establishment method for expressing trichoderma reesei CRISPR / Cas9 by utilizing multiple tandem sgRNAs of tRNA and application
CN116179544A
Application of a fungi cellulase enzyme system composition / characteristic regulatory gene
CN103224921A
Method for producing microbial oil through mixed fermentation one-pot method based on carbon-nitrogen flow directional adjustment and control
CN106755148A