Saccharomyces cerevisiae and its application in the preparation of superoxide dismutase

Abstract

The present invention belongs to the technical field of microorganisms and their enzyme products, and particularly relates to a Saccharomyces cerevisiae and its application in the preparation of superoxide dismutase. The preservation number of the Saccharomyces cerevisiae is CCTCC NO: M 20242101. The Saccharomyces cerevisiae SOD-1 strain provided by the present invention has the characteristics of high yield of superoxide dismutase (SOD), high activity of the produced SOD, and good thermal stability, providing a reliable bacterial cell raw material for SOD production. Moreover, the use of the aforementioned strain for fermenting and preparing SOD has the advantages of short growth cycle, low culture cost, simple culture conditions, simple post-treatment and purification process, and high production efficiency, providing a feasible way for the large-scale production of SOD by biological fermentation, with high industrial practicability and broad market prospects. In addition, the obtained SOD has high activity, good thermal stability, and excellent antioxidant performance, and has good application prospects in the field of animal feeding as a feed additive.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms and their enzyme products, and particularly relates to a Saccharomyces cerevisiae and its application in the preparation of superoxide dismutase. Background Art

[0002] Superoxide dismutase (SOD) widely exists in the biological world and is an important part of the antioxidant system in organisms. It can catalyze the dismutation reaction of superoxide anions to generate hydrogen peroxide and oxygen, thereby scavenging oxygen free radicals in the body, reducing the impact of oxidative stress on the body, and having various physiological functions such as anti-aging, improving the body's resistance to various diseases, and enhancing the body's adaptability to the external environment. It has broad application prospects in the fields of medicine, food, cosmetics, and agriculture. According to the different metal cofactors contained in SOD, it is usually divided into three types: Cu / Zn-SOD, Mn-SOD, and Fe-SOD.

[0003] At present, there are mainly four ways to obtain SOD: 1) extracting from animal blood; 2) extracting from plants; 3) producing by microbial fermentation; 4) heterologously expressing SOD by genetic engineering. Among the above methods, extracting from animal blood is easily affected by factors such as raw material sources, safety and unstable quality of blood products, and has been prohibited. Extracting from plants has problems such as complex processes, high costs, and low yields. Although genetic engineering can produce large amounts of SOD, it also has obvious limitations. For example, the biological activity and yield of the enzyme are greatly affected by the expression mode, and there are many problems such as low expression levels, misfolding of proteins affecting activity, and relatively complex purification methods. Using microorganisms such as yeast or bacteria for fermentation has advantages such as wide strain sources, fast reproduction, short culture time, low culture costs, and can achieve large-scale production, and has good application potential in the field of SOD preparation.

[0004] The key to producing SOD by microbial fermentation lies in the selection and breeding of excellent strains. However, judging from the currently reported microorganisms, their SOD production and / or enzyme activity need to be improved, which is not conducive to industrial production. Therefore, obtaining excellent strains with high SOD production has become the focus of current research. Summary of the Invention

[0005] Aiming at the deficiency of the lack of microorganisms with excellent SOD-producing performance in the prior art, the present invention provides a Saccharomyces cerevisiae. Based on the excellent characteristics of high SOD production and high SOD activity of this Saccharomyces cerevisiae strain, the present invention further provides the application and preparation method of this strain of Saccharomyces cerevisiae in the preparation of SOD, as well as the application of the produced SOD in improving animal production performance. The present invention is specifically realized through the following technical solutions:

[0006] In the first aspect of the present invention, a Saccharomyces cerevisiae is provided, with the deposit number CCTCC NO: M 20242101.

[0007] In the second aspect of the present invention, the application of the above-mentioned Saccharomyces cerevisiae in the preparation of superoxide dismutase is provided.

[0008] In the third aspect of the present invention, a method for preparing superoxide dismutase is provided, including the following steps: activating the above-mentioned Saccharomyces cerevisiae and inoculating it into a fermentation medium containing copper ions and zinc ions, culturing for a period of time, collecting the culture solution and centrifuging to obtain bacterial cells, resuspending the bacterial cells and performing cell disruption treatment, then heating the cell lysate at 70 °C for 30 - 60 min, collecting the supernatant to obtain an enzyme solution containing superoxide dismutase.

[0009] Furthermore, the fermentation medium includes 0.01 - 1 mmol / L of copper ions and 0.01 - 1 mmol / L of zinc ions.

[0010] Even further, the fermentation medium includes the following components by weight percentage: 1% yeast extract powder, 2% peptone, 2% glucose, 0.0025‰ copper sulfate pentahydrate, and 0.0028‰ zinc sulfate heptahydrate.

[0011] Furthermore, the culture conditions include: the pH of the fermentation broth is 5.0, the culture temperature is 28 °C, the rotation speed is 200 rpm / min, and the dissolved oxygen content is 40% - 60%.

[0012] In the fourth aspect of the present invention, a superoxide dismutase is provided, which is prepared by the method for preparing superoxide dismutase using Saccharomyces cerevisiae as described above.

[0013] In the fifth aspect of the present invention, the application of the above-mentioned superoxide dismutase in improving animal production performance is provided.

[0014] Furthermore, the application method includes the following steps: mixing the superoxide dismutase dry powder preparation with the basic feed of the animal and feeding it to the animal, and the addition amount of the superoxide dismutase dry powder preparation is 0.1 - 2‰ of the total mass of the basic feed.

[0015] Furthermore, the preparation method of the superoxide dismutase dry powder preparation includes: mixing the enzyme solution containing superoxide dismutase with corn starch, and then drying to prepare the superoxide dismutase dry powder preparation, and the specific activity of the superoxide dismutase dry powder preparation is 1 - 3 million U / g.

[0016] Furthermore, the animal includes laying hens or sows, and the animal production performance includes the production performance of late-stage laying hens or the antioxidant performance of sows.

[0017] The advantages and positive effects of the present invention are:

[0018] 1. The Saccharomyces cerevisiae SOD-1 strain provided by the present invention has the characteristics of high yield of superoxide dismutase (SOD), high activity of the produced SOD, and good thermal stability, providing a reliable bacterial cell raw material for SOD production. Moreover, the fermentation of SOD using the aforementioned strain has the advantages of short growth cycle, low culture cost, simple culture conditions, simple post-treatment purification process, and high production efficiency, providing a feasible way for the large-scale production of SOD by biological fermentation, with high industrial practicability and broad market prospects.

[0019] 2. The SOD isolated by fermenting Saccharomyces cerevisiae SOD-1 of the present invention has high activity, good thermal stability, and excellent antioxidant performance, and has good application prospects in the field of animal feeding as a feed additive, which is beneficial to improving the antioxidant capacity of fed animals, reducing the inflammatory response of the liver, reducing oxidative stress damage to the body, and improving the production performance of animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0021] Figure 1 It is the purification electrophoresis diagram of the superoxide dismutase fermented and produced by Saccharomyces cerevisiae SOD-1 in the embodiment of the present invention;

[0022] Figure 2 It is the enzyme activity curve of the superoxide dismutase fermented and produced by Saccharomyces cerevisiae SOD-1 in the embodiment of the present invention at 70 °C for different treatment times;

[0023] Figure 3 It is the broken line graph of the egg production rate of late laying hens fed with SOD dry powder preparation for different times in the embodiment of the present invention;

[0024] Figure 4 It is the bar graph of the egg quality of late laying hens fed with SOD dry powder preparation for 6 weeks in the embodiment of the present invention. From left to right, they are eggshell strength, albumen height, yolk color, Haugh unit, and egg fat content;

[0025] Figure 5 It is the bar graph of the serum antioxidant level of late laying hens fed with SOD dry powder preparation for 6 weeks in the embodiment of the present invention. From left to right, they are superoxide dismutase, glutathione peroxidase, catalase, total antioxidant capacity, and malondialdehyde.

[0026] Figure 6This is a histological section image of the liver fat distribution in late-stage laying hens fed with SOD dry powder preparation for 6 weeks in the embodiments of the present invention;

[0027] Figure 7 This is a bar graph of the serum lipid content in late-stage laying hens fed with SOD dry powder preparation for 6 weeks in the embodiments of the present invention. From left to right, they are total cholesterol, triglyceride, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol;

[0028] Figure 8 This is a bar graph of the liver lipid content in late-stage laying hens fed with SOD dry powder preparation for 6 weeks in the embodiments of the present invention. From left to right, they are total cholesterol, triglyceride, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol;

[0029] Figure 9 This is a bar graph of the expression levels of genes related to liver fat synthesis in late-stage laying hens fed with SOD dry powder preparation for 6 weeks in the embodiments of the present invention. From left to right, they are fatty acid synthase, peroxisome proliferator-activated receptor γ, and transmembrane protein 68;

[0030] Figure 10 This is a histological section image of the liver morphology in late-stage laying hens fed with SOD dry powder preparation for 6 weeks in the embodiments of the present invention;

[0031] Figure 11 This is a bar graph of the expression levels of genes related to liver inflammatory factors in late-stage laying hens fed with SOD dry powder preparation for 6 weeks in the embodiments of the present invention. From left to right, they are interleukin-1β, interleukin-6, and interleukin-10. Detailed implementation manners

[0032] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments. Unless otherwise specified, the equipment and reagents used in each embodiment and test example can be obtained from commercial channels. The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0033] Based on the information contained in this application, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only used to illustrate specific aspects of the present invention schematically. In fact, all various changes that those skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0034] For a better understanding of the present invention rather than limiting its scope, all numbers representing amounts, percentages, and other numerical values used in this application should be understood to be modified by the term "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may vary depending on the desired properties to be obtained. Each numerical parameter should be considered at least as obtained by the reported significant figures and by conventional rounding methods. Additionally, the meanings of terms such as "comprising", "including", "containing", "having", etc. are non-restrictive, i.e., other steps and other components can be added without affecting the result.

[0035] To make the above objects, features, and advantages of the present invention more apparent and understandable, the following detailed description of specific embodiments of the present invention will be given in conjunction with the accompanying drawings.

[0036] An embodiment of the present invention provides a Saccharomyces cerevisiae with a preservation number of CCTCC NO: M 20242101 and a preservation date of September 27, 2024. This strain was preserved at the China Center for Type Culture Collection on September 27, 2024, at the address No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province (Wuhan University), and the name of the culture is Saccharomyces cerevisiae SOD-1, with the taxonomic name being Saccharomyces cerevisiae.

[0037] The present invention conducts directional domestication of Saccharomyces cerevisiae by adding high concentrations of copper and zinc ions to induce the expression of superoxide dismutase (SOD). Taking the SOD enzyme activity of the fermentation broth of Saccharomyces cerevisiae at different domestication times as an index, the strain named Saccharomyces cerevisiae SOD-1 of the present invention was isolated. The enzyme activity of Saccharomyces cerevisiae SOD-1 fermented for 48 h was measured, and the SOD activity of the cells in the fermentation culture broth could reach 193 U / mL, and the SOD yield calculated based on the wet weight of the cells could reach 2412.5 U / g. It can be seen that the strain of the present invention has the characteristics of high SOD production, high SOD activity, and good stability, providing a reliable cell raw material for the large-scale production of SOD. In addition, using the strain of the present invention for fermentative production of SOD has the advantage of simple separation and purification of the target enzyme. Specifically, by centrifuging the fermentation broth to collect the cells, breaking the cells, and performing heat denaturation treatment at a high temperature (such as 70 °C) for a certain period of time (such as 30 - 60 min), and then centrifuging to collect the supernatant, an SOD enzyme solution with a purity greater than 85% can be separated and purified, which is beneficial to the large-scale production of SOD and has good market potential in the industry of biological fermentation for preparing SOD.

[0038] Another embodiment of the present invention provides the application of the above-mentioned Saccharomyces cerevisiae SOD-1 in the preparation of superoxide dismutase.

[0039] The fermentation of Saccharomyces cerevisiae SOD-1 to produce SOD in the present invention has the advantages of high yield and good activity. Moreover, Saccharomyces cerevisiae has a short growth cycle, low culture cost, and simple culture conditions, making it easy to achieve industrial production, providing a feasible way for the large-scale preparation of SOD by biological fermentation.

[0040] Based on the same inventive concept as above, the present invention also provides a method for preparing superoxide dismutase by fermenting Saccharomyces cerevisiae SOD-1, comprising the following steps:

[0041] Inoculate the activated Saccharomyces cerevisiae SOD-1 into a fermentation medium containing copper ions and zinc ions and culture for a period of time. Collect the culture solution and centrifuge to obtain the thalli. Resuspend the thalli and perform cell disruption treatment. Then heat-treat the cell lysate at 70 °C for 30 - 60 min, collect the supernatant to obtain an enzyme solution containing superoxide dismutase.

[0042] Since the Saccharomyces cerevisiae SOD-1 of the present invention has a high yield of SOD and SOD has good thermal stability, when incubated in a 70 °C water bath for 1 h, the enzyme activity loss is within 6%, and when incubated for 2 h, more than 80% of the enzyme activity can still be retained. Therefore, the present invention can remove impurities by simple high-temperature thermal denaturation treatment, and finally obtain SOD with a purity greater than 85% by centrifuging and separating the denatured precipitated impurities. In short, using the Saccharomyces cerevisiae SOD-1 of the present invention to ferment and produce SOD has the advantages of simple separation and purification, high enzyme yield, and high production efficiency, and has high industrial practicability.

[0043] The method for activating Saccharomyces cerevisiae adopts the conventional method in the art, for example, inoculating it into LB medium or the commonly used YPD medium for yeast and culturing for a period of time. The culture time can be adjusted adaptively based on the cell concentration and will not be elaborated here.

[0044] Optionally, the fermentation medium comprises copper ions with a molar concentration of 0.01 - 1 mmol / L and zinc ions with a molar concentration of 0.01 - 1 mmol / L.

[0045] In a preferred embodiment, the fermentation medium comprises the following components by weight percentage: 1% yeast extract powder, 2% peptone, 2% glucose, 0.0025‰ copper sulfate pentahydrate, and 0.0028‰ zinc sulfate heptahydrate.

[0046] The conditions for fermentation culture adopt the conventional yeast culture conditions, for example, the pH of the fermentation broth is 5.0, and it is cultured under the conditions of 28 °C, 200 rpm / min, and a dissolved oxygen content of 40% - 60%. The fermentation culture time is adjusted adaptively according to the cell yield and enzyme activity index. Generally speaking, a culture time of 48 h can obtain SOD with high content and high activity.

[0047] Another embodiment of the present invention provides a superoxide dismutase, which is prepared by the method for preparing superoxide dismutase by fermenting Saccharomyces cerevisiae SOD-1 as described above.

[0048] The SOD isolated by fermenting Saccharomyces cerevisiae SOD-1 in the present invention has the characteristics of high activity, good thermal stability, excellent antioxidant performance, has good application prospects in the field of animal feeding as a feed additive, is beneficial to improving the antioxidant capacity of fed animals and alleviating the inflammatory reaction of the liver, reducing the oxidative stress damage of the body, and improving the production performance of animals.

[0049] Based on this, another embodiment of the present invention provides a superoxide dismutase dry powder preparation, which comprises the superoxide dismutase as described above and acceptable excipients.

[0050] The specific activity of the SOD enzyme solution isolated by fermenting Saccharomyces cerevisiae SOD-1 in the present invention is high and the concentration is large. By adding acceptable excipients to disperse SOD, it is beneficial to the drying of the SOD enzyme solution, obtaining a dry powder with good dispersibility, and then realizing direct mixing with the basic feed in the subsequent process. The advantages of the superoxide dismutase dry powder preparation relative to the prior art are basically the same as those of the superoxide dismutase relative to the prior art, and will not be elaborated here.

[0051] Acceptable excipients refer to components that do not interfere with the biological activity efficacy of the active ingredient - SOD and have no obvious toxicity to the body (including the human body or animal body) at the concentration at which they are administered, including any one or a combination of at least two of solvents, dispersants, diluents, fillers, wetting agents, binders, disintegrants, lubricants, suspending agents, excipients, flavoring agents, protective agents, etc. Using the above components for enzyme preparations is well known in the art.

[0052] Optionally, the acceptable excipient is corn starch.

[0053] Optionally, the specific activity of SOD in the superoxide dismutase dry powder preparation is 1 - 3 million U / g. Specifically, it can be 100,000 U / g. After mixing corn starch and the SOD enzyme solution, drying is carried out to obtain the dry powder preparation of the present invention.

[0054] The specific activity of SOD in the dry powder preparation is adjusted by controlling the incorporation amount of corn starch. For example, if the enzyme solution activity is 100,000 U / mL, then 1 g of starch is mixed in and dried.

[0055] The embodiments of the present invention also provide the application of the superoxide dismutase or the superoxide dismutase dry powder preparation as described above in improving animal production performance.

[0056] Optionally, the animals include laying hens or sows, and the animal production performance includes the production performance of late-stage laying hens or the antioxidant performance of sows.

[0057] The superoxide dismutase of the present invention can improve the production performance of late-stage laying hens. Late-stage laying hens generally refer to the late laying period, that is, the period after 60 weeks of age. Specifically, it includes: 1) increasing the laying rate of late-stage laying hens and maintaining the laying rate of late-stage laying hens at about 95%; 2) improving the egg quality, increasing the eggshell strength, albumen height, yolk color, Haugh unit and fat content of eggs; 3) enhancing the serum antioxidant capacity, increasing the levels of SOD, glutathione peroxidase, catalase and total antioxidant capacity in the serum, and decreasing the level of malondialdehyde in the serum; 4) promoting liver fatty acid metabolism, reducing the accumulation of fat in the liver, and decreasing the lipid levels, including triglyceride, total cholesterol, low-density lipoprotein cholesterol and high-density lipoprotein cholesterol, and inhibiting the synthesis and expression of fatty acid synthase, peroxisome proliferator-activated receptor γ and transmembrane protein 68 genes; 5) inhibiting liver inflammation, reducing the infiltration of inflammatory cells in the liver, and inhibiting the synthesis and expression of interleukin-1β, interleukin-6 and interleukin-10 genes.

[0058] The superoxide dismutase of the present invention can improve the antioxidant performance of sows. Specifically, it includes: 1) increasing the serum antioxidant capacity, increasing the activities of superoxide dismutase, glutathione peroxidase and catalase, the content of glutathione and the level of total antioxidant capacity in the serum; 2) decreasing the serum oxidative damage level, and decreasing the contents of malondialdehyde, hydrogen peroxide and tumor necrosis factor-α in the serum.

[0059] In practical applications, the superoxide dismutase of the present invention or its dry powder preparation is directly mixed with the basic feed of animals and then fed to the animals. Since the specific activity of pure SOD after drying is very high, it is preferably prepared as a dry powder preparation and then mixed with the basic feed. The addition amount of the dry powder preparation is usually 0.1-2‰ of the total mass of the basic feed. Its addition amount varies slightly according to the differences of the fed animals, and those skilled in the art can adjust it according to the feeding requirements. For example, when raising laying hens, its addition amount is preferably 0.2‰, and when raising large animals such as sows, its addition amount can be increased, preferably 1‰.

[0060] The present invention will be further described below in conjunction with specific embodiments. The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" published by Cold Spring Harbor Laboratory, or usually according to the conditions recommended by the manufacturer.

[0061] In the present invention, the superoxide dismutase (SOD) activity was detected according to the national standard of the People's Republic of China, "GB / T 41906-2022 Detection Method for Superoxide Dismutase Activity". The enzyme activity is defined as: at 25°C, the amount of enzyme that inhibits the autoxidation rate of pyrogallol by 50% per minute in 1 mL of the reaction solution is one unit of superoxide dismutase activity (U).

[0062] Example 1 Domestication, Isolation and Identification of Saccharomyces cerevisiae SOD-1 with High Yield of SOD

[0063] Saccharomyces cerevisiae, also known as baker's yeast or budding yeast, is commonly used in making bread, steamed buns and brewing. As a high-quality functional and nutritional feed, Saccharomyces cerevisiae is approved to be directly added to animal diets and itself expresses Cu / Zn-SOD. Cu / Zn-SOD exerts its catalytic activity through the copper and zinc ions chelated with it. The absence of these two metal ions will cause it to lose its enzyme activity. Therefore, a high concentration of copper and zinc ion culture environment can stress it to produce SOD with high enzyme activity. The original Saccharomyces cerevisiae strain used for screening in the present invention was provided by Hubei Huada Ruier Technology Co., Ltd. After directional domestication in a culture solution containing 0-1 mM copper ions and 0-1 mM zinc ions, Saccharomyces cerevisiae SOD-1 with high yield of SOD was isolated. The specific steps are as follows:

[0064] (1) Activation of Saccharomyces cerevisiae: The Saccharomyces cerevisiae seed solution was inoculated into YPD medium (pH 5.0) and activated at 28°C and 200 rpm / min for 24 h. The YPD medium includes the following components: 1% yeast extract powder, 2% peptone and 2% glucose, sterilized at 115°C for 30 min, and the 2% glucose was sterilized separately and then mixed after cooling.

[0065] (2) Induction of Saccharomyces cerevisiae: The activated culture solution was respectively inoculated into YPD medium (30 mL) containing different concentrations of copper ions and zinc ions, and cultured at 28°C, pH 5.0 and 200 rpm / min for 24 h, 48 h and 72 h respectively. Subsequently, the culture solution was collected and centrifuged at 12,000 g for 5 min to collect the cells, 5 mL of resuspension buffer was added to the collected cells, and the SOD activity of the cell lysate was measured by sampling. The cell resuspension buffer is a phosphate buffer, including the following components: 0.059% sodium dihydrogen phosphate dihydrate, 0.58% disodium hydrogen phosphate dodecahydrate.

[0066] The SOD activity detection results of the cell lysate are shown in Table 1. It can be seen that the Saccharomyces cerevisiae domesticated and cultured for 48 h at a copper and zinc ion concentration of 0.1 mM / L has the highest enzyme activity, and the SOD enzyme activity has increased by 58.73% compared with the original strain.

[0067] Table 1 Determination results of superoxide dismutase enzyme activity under domestication culture with different copper and zinc ion concentrations

[0068]

[0069] (3) Screening of Saccharomyces cerevisiae: Take the group with the highest increase in enzyme activity, that is, the culture solution cultured at 0.1 mM / L copper and zinc ion concentrations for 48 h. After serial dilution, it was spread on solid YPD medium containing 0.1 mM / L copper and zinc ions, placed in an incubator at 28 °C, and cultured upside down for 2 - 4 d. Randomly select single colonies with typical yeast colony characteristics and inoculate them into YPD medium containing 0.1 mM / L copper and zinc ions, and culture at 28 °C and 200 rpm for 48 h to obtain candidate yeast strains.

[0070] (4) Identification of Saccharomyces cerevisiae: Conduct preliminary morphological identification on the screened Saccharomyces cerevisiae. Its colonies are milky white, shiny, flat, with neat edges, and most are round or oval. At the same time, send the screened Saccharomyces cerevisiae to Shanghai Majorbio Bio-Pharm Technology Co., Ltd. for sequencing identification. The sequencing primers are universal primers ITS1: 5’-TCCGTAGGTGAACCTGCGG-3’; ITS4: 5’-TCCTCCGCTTATTGATATGC-3’. The ITS sequence determination results are shown in SEQ ID NO.1. Perform Blast alignment analysis in the NCBI database. The similarity homology of the screened strain with the Saccharomyces cerevisiae isolate JGF21 (GenBank: MZ089538.1) is 97.1%, and it can be identified as Saccharomyces cerevisiae, named Saccharomyces cerevisiae SOD-1.

[0071] The ITS gene of Saccharomyces cerevisiae SOD-1 is specifically as follows:

[0072] GTGGCCTGGATTTATATTTTGAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCAAGAAAGGGTTCTCTGCCTGCTTGAAGGATAATGGAAGTACCGGCGGTTTAAGGTTTACCCACTGCGGCTAATCCTTTTTTATACTGAGCGTATTGGAACGGTATCGATTAGAAGAGAGCGTCTAAGCGAACATGGTCCTAAAGGTTGACCTCCAATCAAGTAGAGTACCCGGCTGACCTAAGCATATCAAA (see SEQ ID NO.1).

[0073] The above-mentioned Saccharomyces cerevisiae SOD-1 was deposited at the China Center for Type Culture Collection (CCTCC) on September 27, 2024, with the deposit number CCTCC M 20242101, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province (Wuhan University), and the culture classification name is Saccharomyces cerevisiae.

[0074] Study on the Characteristics of SOD Production by Saccharomyces cerevisiae SOD-1 in Fermentation

[0075] The production of SOD by Saccharomyces cerevisiae SOD-1 fermentation includes the following steps:

[0076] (1) Activation of Saccharomyces cerevisiae SOD-1 strain: Inoculate Saccharomyces cerevisiae SOD-1 into YPD medium and activate it at 28 °C and 200 rpm / min for 24 h.

[0077] (2) Fermentation culture of Saccharomyces cerevisiae SOD-1: Inoculate the activated Saccharomyces cerevisiae SOD-1 seed liquid into the fermentation medium (pH 5.0) at an inoculation amount of 3%, control the dissolved oxygen content at 40%-60%, and ferment at 28 °C and 200 rpm / min for 48 h. The fermentation medium includes the following components: 1% yeast extract powder, 2% peptone, 2% glucose, 0.0025‰ copper sulfate pentahydrate, and 0.0028‰ zinc sulfate heptahydrate. Sterilize at 115 °C for 30 min, and mix after sterilizing and cooling 2% glucose separately.

[0078] (3) Concentration and disruption of Saccharomyces cerevisiae SOD-1 cells: After the fermentation culture is completed, collect the culture solution and concentrate the cells using a disc centrifuge. Resuspend the cells with a resuspension buffer at a weight-to-volume ratio of 1:5, that is, add 5 mL of resuspension buffer per g of wet cell weight. Then, disrupt the cells through a high-pressure homogenizer at a pressure of 1500 bar for 5 times to obtain a cell disruption solution containing SOD.

[0079] (4) Heat the cell disruption solution containing SOD at 70 °C for 30 min, and centrifuge to obtain the supernatant containing SOD, which is the SOD enzyme solution. Mix the supernatant with loading buffer and perform sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The electrophoresis pattern is as Figure 1 shown, where lane 1 is the molecular marker Marker, and lanes 2-5 are the repeated sample loading of the SOD enzyme solution. It can be seen from the figure that the molecular weight of SOD in the present invention is 16 kDa, and the purity of SOD in the enzyme solution is relatively high, reaching more than 85%.

[0080] By measuring the SOD protein yield and its enzyme activity in different batches of fermentation broth, it is calculated that 50-80 g of wet bacteria can be obtained per liter (L) of fermentation broth of Saccharomyces cerevisiae SOD-1 in the present invention. The SOD activity of the cell disruption solution is 2000-2500 U / g of wet bacteria, and 30 mg-50 mg of enzyme can be purified.

[0081] SOD temperature tolerance: Divide the SOD enzyme solution obtained in step (4) into 10 tubes with a volume of 5 mL each, and incubate them in a water bath at 70 °C for 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 h respectively, and measure the enzyme activity at different denaturation times. The results are as Figure 2As shown, taking the enzyme solution without heat treatment as 100%, the relative enzyme activities at different heating times are 94.86%, 81.20%, 68.29%, 57.43%, 45.40%, 36.05%, 34.56%, 28.61%, 25.77%, and 19.79% respectively. It can be seen that the SOD produced by fermenting Saccharomyces cerevisiae SOD-1 in the present invention has good thermal stability. When incubated in a 70°C water bath for less than 1 hour, the enzyme activity is basically unaffected. When incubated for 2 hours, more than 80% of the enzyme activity can still be retained.

[0082] Due to the good thermal stability of the SOD enzyme in the present invention, the cell lysate can be treated at a high temperature of 70°C for 30 minutes. In this step, most of the proteins in the cell contents precipitate due to heat denaturation, while the SOD enzyme in the present invention is not affected. Thus, after one-step heat treatment, a relatively high-purity SOD enzyme can be obtained by centrifugation, greatly simplifying its preparation process.

[0083] Study on the effect of a feed additive containing SOD on the laying performance of late-stage laying hens in Example 3

[0084] Under normal circumstances, the oxidation level and antioxidant level in the body are in a balanced state. However, with the increase in age and the needs of production, the balance between the two is broken, resulting in a weakened ability of the liver and ovaries to cope with oxidative stress, thereby affecting their functions. Moreover, the lipid metabolism in the liver is active, and lipid peroxidation will further lead to oxidative stress. SOD can scavenge oxygen free radicals, thereby reducing the oxidative stress on the body. Therefore, by adding exogenous SOD, the antioxidant capacity of poultry and livestock can be improved, which is beneficial to their production and recovery.

[0085] This example aims to explore the effect of the SOD enzyme produced by using Saccharomyces cerevisiae SOD-1 on the laying performance of late-stage laying hens. The prepared SOD enzyme solution was mixed with corn starch and dried thoroughly in an oven at 60°C to adjust the specific activity of SOD in the dry powder to 100,000 U / g. This dry powder preparation was used as a feed additive, and the addition amount was 0.2‰, that is, 0.2 g of the aforementioned feed additive was added to each kg of the basal feed. The basal feed during the experiment was the compound feed for 324 laying hens of CP Group (product number: CP 324), and its composition and nutritional level are shown in Table 2.

[0086] Table 2 Composition of the basal feed for laying hens

[0087]

[0088] Grouping and feeding of laying hens: The breed of laying hens is Hy-Line Brown laying hens, 58 weeks old, and the test site is Hongteng Laying Hen Farm, Gong'an County, Jingzhou City, Hubei Province. The laying hens were randomly divided into a control group (NC) and an SOD experimental group (SOD), with 6 replicates in each group and 10 chickens in each replicate. The control group (NC) was fed a basal diet, and the SOD experimental group (SOD) was supplemented with 0.2‰ of the SOD dry powder described in the present invention on the basis of the control group (NC). During the experiment, the laying hens had free access to food and water, and the other conditions were carried out according to the standards of the breeding farm. The entire test period was 6 weeks, that is, 42 days.

[0089] Sample collection: During the entire test period, eggs were collected and counted at 12:00 noon every day. On the last day of the sixth week of the test period, that is, on the 42nd day, all eggs were collected, and 1 laying hen was randomly selected from each replicate, sacrificed after collecting blood from the coagulation tube by vein, and the liver was separated, cleaned and wiped clean in physiological saline. Then, a part was placed in 4% paraformaldehyde for fixation, and a part was placed in a 2 mL cryopreservation tube and frozen in liquid nitrogen for later measurement.

[0090] Data analysis: The data were statistically sorted in Microsoft Excel 2019, and the inter-group differences were analyzed by T-test using GraphPad Prism 8. The results were expressed as mean ± standard error (mean ± SE), and a significant difference was indicated by P < 0.05, where * indicated P < 0.05, ** indicated P < 0.01, *** indicated P < 0.001, and **** indicated P < 0.0001.

[0091] 3.1 Statistical analysis of egg production rate

[0092] Egg production rate (%) = (number of eggs produced / number of laying hens) × 100%. The change of egg production rate during the experiment is as Figure 3 shown. At the initial stage, the egg production rates of both the control group (NC) and the SOD experimental group (SOD) were about 90%. As the age of the laying hens increased, the egg production rate of the control group (NC) showed a downward trend, while the egg production rate of the SOD experimental group (SOD) gradually maintained at about 95%, indicating that feeding SOD to laying hens in the late laying period can greatly improve the egg production rate of laying hens.

[0093] 3.2 Detection of egg quality

[0094] The eggshell strength was detected using an eggshell strength tester (Guangzhou Runhu Instrument Co., Ltd., Guangzhou, China), the albumen height, yolk color, and Haugh unit were detected using a multi-functional egg quality analyzer (Robotmation Co., Ltd., Nanjing, China), and the fat content of eggs was detected according to the national standard of the People's Republic of China GB 5009.6-2016 "Determination of Fat in Foods". The detection steps and calculation formulas were strictly carried out according to the methods specified in this standard.

[0095] After the experiment, the changes in egg quality were as Figure 4 shown. There were significant differences between the control group (NC) and the SOD experimental group (SOD) in terms of eggshell strength, albumen height, yolk color, Haugh unit, and egg fat content. Moreover, the control group (NC) was significantly lower than the SOD experimental group (SOD), indicating that feeding SOD to laying hens during the laying period can significantly improve the quality of eggs.

[0096] 3.3 Detection of serum antioxidant levels

[0097] Detection kits for the contents of superoxide dismutase (product number: A001-1-2), glutathione peroxidase (product number: A005-1-2), catalase (product number: A007-1-1), total antioxidant capacity (product number: A015-2-1), and malondialdehyde (product number: A003-1-2) in serum were all purchased from Nanjing Jiancheng Bioengineering Institute. The detection steps and calculation formulas were carried out according to the kit instructions.

[0098] After the experiment, the serum biochemical indexes of laying hens were as Figure 5 shown. There were significant differences between the control group (NC) and the SOD experimental group (SOD) in terms of superoxide dismutase, glutathione peroxidase, catalase, and total antioxidant capacity. Moreover, the control group (NC) was significantly lower than the SOD experimental group (SOD), while the level of malondialdehyde in the control group (NC) was significantly higher than that in the SOD experimental group (SOD), indicating that feeding SOD to laying hens during the laying period can significantly improve the antioxidant capacity of laying hens.

[0099] 3.4 Detection of liver lipid distribution and liver and serum lipid contents

[0100] Through frozen sections of liver tissue and oil red O staining, the lipid distribution in the livers of laying hens was analyzed by microscopic examination. The results were as Figure 6 shown. Oil red O staining can stain lipid droplets in the liver into orange-red to bright red. It can be seen from the figure that the lipid droplet content in the control group (NC) was significantly higher than that in the SOD experimental group (SOD), indicating that feeding SOD to late-stage laying hens can significantly reduce the accumulation of fat in the livers of laying hens and has the effect of treating or preventing fatty liver.

[0101] The detection steps and calculation formulas for lipid contents in the liver and serum were carried out according to the instructions of the corresponding kits. Detection kits for the contents of triglyceride (product number: A110-1-1), total cholesterol (product number: A111-1-1), low-density lipoprotein cholesterol (product number: A113-1-1), and high-density lipoprotein cholesterol (product number: A112-1-1) were all purchased from Nanjing Jiancheng Bioengineering Institute.

[0102] The detection results of serum and liver lipid contents were respectively asFigures 7-8 As shown in the figure. It can be seen that the control group (NC) was significantly lower than the SOD experimental group (SOD) in terms of total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels. This indicates that feeding SOD to late-stage laying hens can significantly improve lipid transfer in the liver, transfer lipids to eggs through the liver-blood-egg pathway, thereby reducing lipid accumulation in the liver and improving egg quality.

[0103] 3.5 Detection of relative expression levels of lipid synthesis-related genes

[0104] Total RNA was extracted from the liver using the SPARKeasy Tissue / Cell RNA Rapid Extraction Kit (purchased from Shandong Sikejie Biotechnology Co., Ltd., product number: AC0202-B), and then the RNA was reverse transcribed into cDNA using the SPARKscriptⅡ All-in-one RT SuperMix for qPCR (purchased from Shandong Sikejie Biotechnology Co., Ltd., product number: AG0305-B) reverse transcription kit. The expression levels of genes were detected using real-time quantitative detection methods (RT-qPCR). Lipid synthesis-related genes included fatty acid synthase (FASN), peroxisome proliferator-activated receptor γ (PPARG), and transmembrane protein 68 (TMEM68). Before loading, pretreatment was performed using the 2×SYBR Green qPCR Mix (purchased from Shandong Sikejie Biotechnology Co., Ltd., product number: AH0104-B) reagent, and detection was carried out on a CFX96 Touch fluorescence quantitative PCR instrument (Bio-Rad, USA). The relative expression levels of each gene were calculated by the 2 -△△Ct method and normalized by the internal reference gene β-actin.

[0105] The relative expression levels of lipid synthesis-related genes are as Figure 9 shown. The expression levels of genes such as fatty acid synthase, peroxisome proliferator-activated receptor γ, and transmembrane protein 68 in the control group (NC) were significantly lower than those in the SOD experimental group (SOD), indicating that feeding SOD to late-stage laying hens can significantly inhibit lipid synthesis in the liver, thereby inhibiting lipid accumulation in the liver.

[0106] 3.6 Observation of liver tissue morphology and detection of inflammatory factor expression levels

[0107] Liver tissue paraffin-embedded sections were taken for HE staining, and the liver morphology was analyzed by microscopic examination. The results are as Figure 10 shown. The structure of hepatocytes in the field of view was clear, the cell nuclei were round, the cytoplasm was abundant, and there was no necrosis or degeneration. However, focal infiltration of inflammatory cells was visible in the liver tissue of the control group (NC), while only a small amount of inflammatory cell infiltration was observed in the liver tissue of the SOD experimental group (SOD), as indicated by the red arrow.

[0108] The expression levels of genes related to liver inflammatory factors are as Figure 11 shown. In the control group (NC), the expression levels of inflammatory factors such as interleukin-1β (IL-1β), interleukin-6 (IL-6), and interleukin-10 (IL-10) were significantly higher than those in the SOD experimental group (SOD). This indicates that feeding laying hens in the late stage with SOD can significantly inhibit the inflammatory response of the liver and achieve the effect of protecting the liver.

[0109] The primer sequences used in the above examples are shown in Table 3.

[0110] Table 3 Primer sequences for RT-qPCR

[0111]

[0112]

[0113] Based on the above data, it can be seen that feeding laying hens in the late stage with SOD can regulate lipid metabolism in the liver and promote lipid transfer. At the same time, it can improve the antioxidant capacity of the body, relieve the fatty liver phenomenon in laying hens in the late stage, and slow down the inflammatory response of the liver. Multiple factors act together to promote the improvement of their egg production rate.

[0114] Example 4 Study on the improvement of antioxidant performance of sows by a feed additive containing SOD

[0115] This example aims to explore the effect of SOD enzyme produced by Saccharomyces cerevisiae SOD-1 as a feed additive on the antioxidant capacity of parturient sows. The preparation method of the feed additive includes: mixing the above-prepared SOD enzyme solution with corn starch and drying it thoroughly in an oven at 60°C, and adjusting the specific activity of SOD in the dry powder to 100,000 U / g. The addition amount of the feed additive is 1‰ of the basal diet. The composition and nutritional level of the basal diet are shown in Table 4.

[0116] Table 4 Composition of the basal diet for sows

[0117]

[0118] Note: 1) The premix for the gestation period provides Cu 5 mg, I 0.15 mg, Fe 83 mg, Mn 20 mg, Zn 128 mg, VA 13,400 IU, VD3 3,000 IU, VE 22.4 mg, and VK3 3 mg per kilogram of feed. The premix for the lactation period provides: Cu 20 mg, I 0.12 mg, Fe 80 mg, Mn 44 mg, Zn 88 mg, VA 10,000 IU, VD3 14,000 IU, VE 4 IU, and VK3 1.28 mg per kilogram of diet. 2) The nutritional levels are calculated values.

[0119] Grouping and feeding of sows: The breed of sows is "Landrace×Large White" crossbred sows. The sows were assigned to the control group (NC) and the SOD experimental group (SOD) according to body condition scores, with 10 replicates in each group and 3 pigs in each replicate. The experiment started on the 86th day of sow pregnancy and ended on the 21st day of lactation after parturition. The control group (NC) was fed a basal diet, and the SOD experimental group (SOD) was supplemented with 1‰ of the SOD dry powder described in the present invention on the basis of the control group (NC).

[0120] Sample collection: Six sows with similar body conditions and the same parturition date were selected from each group for anterior vena cava blood collection. After standing and sedimentation, the serum was separated by centrifugation and stored on dry ice and transported back to the laboratory for storage at -80°C for testing.

[0121] Relevant kits from Nanjing Jiancheng Bioengineering Institute were used to detect the antioxidant indexes in sow serum, including the activities of catalase, superoxide dismutase, glutathione peroxidase and the content of glutathione (product number: A006-2-1) and the total antioxidant capacity. At the same time, the indexes of serum oxidative damage were measured, including the contents of malondialdehyde, hydrogen peroxide (product number: A064-1-1) and tumor necrosis factor-α (product number: H052-1-2). The relevant results are shown in Tables 5-6.

[0122] Table 5 Effects of SOD dry powder preparation on antioxidant indexes of sows

[0123]

[0124] Table 6 Effects of SOD dry powder preparation on indexes of serum oxidative damage of sows

[0125]

[0126] Compared with the control group, the antioxidant activities such as serum T-AOC, GSH-Px, GSH, CAT, SOD in the SOD experimental group were significantly increased (P<0.05), and the activities of serum T-AOC, GSH-Px, GSH, CAT, SOD were increased by 144.86%, 107.5%, 13.75%, 32.85% and 113.44% respectively. The contents of H2O2, MDA and TNF-α in the serum of the SOD experimental group were significantly decreased (P<0.05), and the contents of H2O2, MDA and TNF-α were decreased by 256.30%, 133.70% and 158.90% respectively. The results show that adding SOD to the diet can relieve oxidative stress in sows and enhance the antioxidant capacity of sows.

[0127] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A Saccharomyces cerevisiae, characterized in that, The preservation number is CCTCC NO: M 20242101.

2. Use of the Saccharomyces cerevisiae according to claim 1 in the preparation of superoxide dismutase.

3. A method for preparing superoxide dismutase, characterized in that, It includes the following steps: The Saccharomyces cerevisiae according to claim 1 is activated and then inoculated into a fermentation medium containing copper ions and zinc ions, cultured for a period of time, the culture solution is collected and centrifuged to obtain thalli, the thalli are resuspended and then subjected to cell disruption treatment, and then the cell lysate is heat-treated at 70 °C for 30 - 60 min, and the supernatant is collected to obtain an enzyme solution containing superoxide dismutase.

4. The method for preparing superoxide dismutase according to claim 3, characterized in that, The fermentation medium includes 0.01 - 1 mmol / L of copper ions and 0.01 - 1 mmol / L of zinc ions.

5. The method for preparing superoxide dismutase according to claim 4, wherein The fermentation medium includes the following components by weight percentage: 1% yeast extract powder, 2% peptone, 2% glucose, 0.0025‰ copper sulfate pentahydrate, and 0.0028‰ zinc sulfate heptahydrate.

6. A superoxide dismutase, characterized in that, It is prepared by the method for preparing superoxide dismutase according to any one of claims 3 - 5.

7. Use of the superoxide dismutase according to claim 6 in the preparation of feed for improving animal production performance for non-therapeutic purposes, the animals include laying hens or sows, and the animal production performance is the egg-laying performance of late-stage laying hens or the antioxidant performance of sows.

8. Use of the superoxide dismutase according to claim 7 in the preparation of feed for improving animal production performance for non-therapeutic purposes, characterized in that, The application method includes the following steps: The superoxide dismutase dry powder preparation is mixed with the basic feed of the animal and then fed to the animal, and the addition amount of the superoxide dismutase dry powder preparation is 0.1 - 2‰ of the total mass of the basic feed.

9. Use of the superoxide dismutase according to claim 8 in the preparation of feed for improving animal production performance for non-therapeutic purposes, characterized in that, The preparation method of the superoxide dismutase dry powder preparation includes: The enzyme solution containing superoxide dismutase is mixed with corn starch and then dried to prepare the superoxide dismutase dry powder preparation, and the specific activity of the superoxide dismutase dry powder preparation is 1 - 3 million U / g.

Images