A gene sequence fragment related to red rice amylose content and a method for improving red rice amylose content
By editing the promoter region of the rice Wx gene, the amylose content of Guizhou "Piguzhan" red rice was precisely regulated using the CRISPR/Cas9 system, solving the problem of poor taste of red rice, reducing amylose content and increasing gel consistency, and improving rice quality.
Patent Information
- Application Number
- CN202411064569.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-05
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-08-05
AI Technical Summary
Existing technologies cannot effectively reduce the amylose content of Guizhou "piguzhan" red rice and other varieties without altering their quality, thus hindering their palatability. This results in high nutritional quality but poor taste, limiting their promotion and application.
By editing the promoter region of the Wx gene in rice, specific sgRNAs were designed using the CRISPR/Cas9 system to target the promoter region of the Wx gene, inserting or deleting specific nucleotide sequences to precisely regulate amylose content, including target editing in the 2206-2183bp and 2050-2027bp regions, to achieve a moderate decrease in Wx gene expression.
The content of amylose in the "sticky skin" rice was successfully reduced from 20% to about 5%, and the gel consistency was increased from 61mm to 99mm, which improved the taste of the rice and made it suitable for molecular breeding and widespread cultivation as a high-quality rice.
Smart Images

Figure CN119120464B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic agricultural technology, and particularly relates to a gene sequence fragment related to amylose content of red rice and a method for improving the amylose content of red rice. BACKGROUND
[0002] Rice is the most important food crop in the world, and more than half of the world's population relies on rice as their staple food. White rice, which is commonly eaten in daily life, is usually milled rice, and 80% of the nutrients are lost during processing. Red rice and other colored rice are rich in anthocyanins, unsaturated fatty acids, vitamin, and various minerals, and have the effects of antioxidant, free radical scavenging, blood sugar control, and anti-aging. Red rice is a food with high nutritional value. However, red rice is usually eaten as brown rice, and its taste is not as good as white rice, and it is difficult to digest. Therefore, red rice is rarely used as a staple food. Therefore, red rice is only used as a foodstuff and occasionally appears on the dining table. It is of great significance to promote the development of the red rice industry to improve the amylose content of red rice and improve its palatability, and to cultivate red rice varieties that are both delicious and nutritious.
[0003] Piguobian is a high-quality characteristic germplasm resource in Guizhou, which was collected in Panzhou, Guizhou Province. It was listed as a national geographical indication product in 2016 as a member of Panzhou red rice. The rice has a red color, is rich in nutrients, and has medicinal effects such as antioxidant and blood sugar lowering, and is one of the rice that can be used as both medicine and food. However, the amylose content of Piguobian is relatively high (about 20%), and red rice is usually eaten as brown rice, which makes it difficult to digest and limits its promotion and application. How to reduce the amylose content of Piguobian and improve its palatability is a problem that needs to be solved.
[0004] Studies have shown that starch is the main component of endosperm in rice (accounting for 90% of dry weight), and the content, composition and structure of starch determine the softness and palatability of rice. Generally speaking, cooked rice grains with low or medium amylose content have elastic, sticky and smooth texture, and better palatability (Li H, Prakash S, Nicholson T M, et al. The importance of amylose and amylopectin fine structure for textural properties of cooked rice grains. Food Chemistry, 2016, 196: 702-711.). Wx gene is the major gene controlling amylose content, which encodes GBSSI enzyme to catalyze the synthesis of amylose (Wang Z, Wu Z L, Xing Y Y, et al. Nucleotide sequence of rice waxy gene. Nucleic Acids Research, 1990, 18(19): 5898.). The diversity of amylose content is largely attributed to allelic variation at the Wx locus, and the waxy and non-waxy of rice is also caused by variation of Wx gene. So far, at least eight Wx complex alleles Wxlv, Wxa, Wxin, Wxb, Wxop, Wxhp, Wxmq and Wx have been proved to be associated with five types of amylose content in rice varieties (Zhang C, Zhu J, Chen S, et al. Wxlv, the ancestral allele of rice Waxy gene. Molecular Plant, 2019, 12(8): 1157-1166.). Different Wx loci show different amylose content and cooking quality (Lin L, Wang Y, Xu X, et al. Relationships between starch molecular components and eating and cooking qualities of rice using single-segment substitution lines with different Wx loci. Journal of Cereal Science, 2023, 114: 103765.). In addition to Wx, FLO19, BEIIb, BEIIa also have a certain effect on the regulation of rice amylose.
[0005] Knocking out the coding region of Wx gene will cause the complete loss of Wx gene expression, and the rice will directly become waxy rice with almost no amylose. Therefore, how to coordinate the amylose content and excellent nutritional quality of rice, especially red rice such as "Piguangzhi", and accurately improve the amylose content of red rice such as "Piguangzhi", but not change its quality, is not only the realistic need to improve the eating quality of rice, but also the need for sustainable development of agriculture. SUMMARY
[0006] In order to solve the above problems existing in the prior art, the present application provides a gene sequence fragment related to the amylose content of red rice and a method for improving the amylose content of red rice, which is realized by the following technical scheme.
[0007] A gene sequence fragment related to the amylose content of red rice, which is located in the region of 2206-2183bp upstream of the start codon of the promoter region of starch granule type binding enzyme Wx gene and the region of 2050-2027bp upstream of the start codon of Wx gene. The nucleotide sequence is shown in SEQ ID No. 1:
[0008] SEQ ID No. 1:
[0009]
[0010] The gene sequence fragment comprises a CT region with 2034-2033 bp inserted or not inserted A.
[0011] The gene sequence fragment is applied to rice improvement and breeding.
[0012] Further, the rice improvement and breeding specifically refers to inhibiting or knocking out the gene sequence fragment, which can effectively reduce the amylose content of rice; overexpressing the gene sequence fragment can effectively increase the amylose content of rice.
[0013] The editing method of the gene sequence fragment comprises the following steps:
[0014] The sgRNA of the CRISPR / Cas9 system is located in the promoter region, and the sequence connected to the 3' end of the target sequence is NGG; the length of the target sequence is 19-20 bp, and N is any one of A, T, G and C. Genome editing can be realized by means of CRISPR / Cas9 system. The target sequence of the CRISPR / Cas9 method is the XXX sequence on any nucleotide sequence including XXXNGG in the Wx gene. Designing the target sequence of the sgRNA of the CRISPR / Cas9 system in the promoter region can effectively ensure that the expression amount of the target gene is moderately reduced.
[0015] Further, the target sequence is located in the region of 2206-2183 bp upstream of the start codon of the Wx gene and the region of 2050-2027 bp upstream of the start codon of the Wx gene, and after gene editing, a mutant rice plant can be obtained, and one or two target sequences on the mutant rice plant are mutated.
[0016] Further, the sgRNA is sgRNA1 and sgRNA2; the target sequence of the sgRNA1 is shown in SEQ ID No. 4, and the target sequence of the sgRNA2 is shown in SEQ ID No. 5:
[0017] SEQ ID No. 4: Target 1: 5'-CATCGATCATCCCTTTGTCGAGG-3' (SEQ ID No. 4, as shown in the segment of 2206-2183 bp from the Wx gene start codon ATG on SEQ ID No. 1, and the PAM is AGG);
[0018] SEQ ID No. 5: Target 2: 5'-CGCCCTGCATGAGAAGCTCGCGG-3' (SEQ ID No. 5, as shown in the segment of SEQ ID No. 1 at a distance of 2050-2027 bp from the Wx gene start codon ATG, PAM is CGG).
[0019] A method for precisely improving the amylose content of red rice is performed by inhibiting or knocking out the gene sequence fragment.
[0020] Further, the inhibition or knocking out of the gene sequence fragment is performed by using the above editing method for knocking out, and after gene editing, a mutant red rice plant is obtained, and one or both of the target sequences on the red rice plant are mutated.
[0021] Finally, the red rice obtained after gene editing is a plant that meets the following conditions: the base sequence in the promoter region of the Wx gene is mutated in the target region of one or two sgRNAs. The genetically modified red rice is understood to include not only the first generation to the second generation of transgenic rice, but also its offspring. For transgenic rice, the gene can be inherited in the species, or the gene can be transferred into other varieties of the same species using conventional breeding techniques, especially including commercial varieties. The transgenic rice includes seeds, callus, whole plants and cells.
[0022] A method for creating new rice germplasm with good amylose content is performed by inhibiting or knocking out the above gene sequence fragment in the target rice.
[0023] The gene editing reagents / methods described in the application can be used to inhibit the expression of the Wx gene, and / or to reduce the abundance of the Wx protein, and / or to knock out the Wx gene, and for use in rice molecular breeding; after treatment with the reagents, a mutant plant is obtained, and the relative expression amount of the Wx gene in the Wx-1 material is significantly reduced to about 0.3 compared with the wild type Piduobian, while the relative expression amount of the Wx gene in the Wx-2 and Wx-3 materials does not appear to be significantly reduced compared with the wild type Piduobian.
[0024] Compared with the prior art, the technical effects created by the application are embodied in:
[0025] The inventors of this application have discovered that the Wx gene promoter sequence is a key gene site affecting the amylose content of rice and thus its palatability; different Wx gene sites result in different amylose contents. This invention utilizes gene editing technology to knock out multiple segments of the granule-binding starch synthase Wx gene promoter sequence in the "Piguzhan" rice variety. It was found that knocking out a specific segment upstream of the ATG gene moderately decreased Wx gene expression, reducing the amylose content of "Piguzhan" from 20% to approximately 5%, while increasing the gel consistency from 61 mm to approximately 99 mm. This invention can be applied to the precise regulation of rice amylose and to molecular breeding practices for high-quality local rice in Guizhou. This invention provides a method for reducing amylose content by moderately reducing Wx gene expression. Specific embodiments of this invention demonstrate that by editing the Wx gene promoter sequence, the amylose content of the high-quality local rice "Piguzhan" from Guizhou can be precisely improved, improving rice quality, facilitating the promotion and planting of this variety, and aiding in the preservation of high-quality germplasm resources. Attached Figure Description
[0026] Figure 1 This is a comparison chart of the appearance phenotype, amylose content, total starch and gel consistency of different rice varieties in Example 1.
[0027] Figure 2 This is a schematic diagram of the promoter sequence knockout target design for the Wx gene in Example 1.
[0028] Figure 3 This is a diagram of the carrier skeleton for Example 1.
[0029] Figure 4 This is a schematic diagram showing the sequencing results after knocking out different sites of the Wx gene promoter.
[0030] Figure 5 The relative expression levels of the Wx gene (mean ± SD, n = 6) in knockout mutants of different sites on the promoter of the Wx gene.
[0031] Figure 6 Amylose content (mean ± SD, n = 6) of different sequence knockout mutants of the Wx gene promoter.
[0032] Figure 7 Gel consistency (mean ± SD, n = 6) of knockout mutants at different sites of the Wx gene promoter.
[0033] Figure 8 The sequencing results are shown for the Wx gene promoter sequence mutant line Wx-1-4 from Example 2.
[0034] Figure 9 The sequencing data shows the Wx-1-7 mutant line of the Wx gene promoter sequence in Example 2.
[0035] Figure 10 Sequencing results of Wx-1-12, a Wx gene promoter sequence mutant strain of Example 2.
[0036] Figure 11 Appearance, brown rice rate, 1000-grain weight and proanthocyanidin content of 3 mutant strains of the Wx gene promoter sequence of Example 2 (mean ± SD, n = 6). DETAILED DESCRIPTION
[0037] The technical solutions of the present application are further limited in the following specific embodiments, but the scope of protection is not limited to the description. If not specifically indicated, the technical means used in the following examples are conventional means known to those skilled in the art; the experimental methods used are conventional methods, and the materials, reagents, etc. used can be obtained from commercial channels.
[0038] The expression vectors pYLsgRNA-OsU3, pYLsgRNA-OsU6a and the binary vector pYLCRISPR / Cas9Pubi-H can be obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.
[0039] The transcript used in the following examples is Wx-1, which is only an example and does not limit the editing site in application. If not specifically indicated, the examples are carried out according to the conventional experimental conditions or the product instruction conditions. In the following examples, if not specifically indicated, the 1st nucleotide of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last nucleotide is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0040] Example 1: Construction of promoter knockout vector
[0041] Applicants have previously collected high-quality rice "Pigu sticky" material (material planted in Guiyang, Guizhou Province) and compared with other common red rice Xiahuang sticky, Niweisticky, Chishi, Hongxunuo, etc. It was found that the amylose content of "Pigu sticky" was higher Figure 1 A-B, C), the total starch content was lower Figure 1 A-B, D), and the gel consistency was lower Figure 1 D). Among them, in Figure 1 , A is the appearance phenotype of rice Pigu sticky, Xiahuang sticky, Niweisticky, Chishi, Hongxunuo and Echinochloa crusgalli 31, respectively; B is the amylose content statistics; C is the total starch content statistics; D is the gel consistency determination; B-D statistical data: mean ± SD, n = 3. The results were analyzed for significant difference using Duncan's test, and the lower case letters were marked above the data. In the same figure, different lower case letters represent significant difference, p < 0.05, and the same below.
[0042] I. Selection of target sequence
[0043] The coding sequence of "Piguo sticky" Wx is the sequence shown as SEQ ID No. 2 in the sequence listing, and the amino acid sequence thereof is shown as SEQ ID No. 3; the promoter sequence of the Wx gene is the sequence shown as SEQ ID No. 1 in the sequence listing.
[0044] SEQ ID No. 1 (5'-3', underlined indicates Target 1 and Target 2):
[0045] TGTATCTGGTTTTGCGGTTGAAGGACGGAAATTGGATTTATTGACAAGTCAAGGGACCTTAGATGAACTTATTCCTTTTTATATTTGCACAGGCCTAATTTCAAGTCCAGCCCAGCTTTCTTCAGCCTGTTTGATAATTCTCTCTAGCTTATTACAGCCGTGGGAGAGGAGATATACAGCTACAAGATTACAAGTCGATGTATACAGCAAACCCATGAGCTGATTGCCTGATTAGACGGTAAGAATGCATCCCTGAGAAGCAAATGCATCACCAAATTTGTAGCTTAGATAAATGCTGTGACCTGCAAGAAAATAAAATTAAAATCAAAATAAAAGAAAAGCGCAGGTAATTGACACCCCACGCATATAAGTGTAGATACATAACACGTTCATCTAATCATCTTAATTAGACTTAGGTAAAACTACAATGAGGTTTATGTCCTACGGAATGACGACAAGCTAGCAGCACAGAGGCACAGATCATATCGTCTCCAGACTCAAGTGCACGTTGATCGTTCGCTCACTGCTT CATCGATCATCCCTTTGTCGAGG CGTTAGTTGGCAGGCACTAATAGCTACAGTAAAGTAAAGAGCAACGTGCCAACGTACGCACGCTAACGTGAGTCATGTAGCGTAATTCCAAGTTCTTTTTTTTTTGTCAGCACGTACAAGCAGCCGCTAGCCT CGCCCTGCATGAGAAGCTCGCGG
[0046] SEQ ID No. 2 (5'-3'):
[0047]
[0048] SEQ ID No. 3:
[0049] MSA LTT SQL ATS ATG FGI ADR SAP SSL LRH GFQ GLKPRS PAG GDA TSL SVTTSA RAT PKQ QRS VQR GSR RFP SVVVYA TGA GMN VVF VGA EMA PWS KTG GLG DVL GGLPPAMAA NGH RVM VIS PRY DQY KDA WDT SVV AEI KVA DRYERV RFF HCY KRG VDR VFIDHPSFL EKV WGK TGE KIY GPDTGV DYK DNQ MRF SLL CQA ALE APR ILN LNN NPY FKG TYGEDVVFV CND WHT GPL ASY LKN NYQ PNG IYRNAK VAF CIHNIS YQG RFA FED YPE LNL SER FRSSFD FID GYD TPV EGRKIN WMK AGI LEA DRV LTV SPY YAE ELI SGI ARG CEL DNIMRL TGITGI VNG MDV SEW DPS KDK YIT AKY DAT TAI EAKALN KEA LQA EAG LPV DRK IPL IAFIGR LEE QKG PDV MAAAIP ELM QED VQI VLL GTG KKK FEK LLK SME EKY PGK VRAVVK FNAPLA HLI MAG ADV LAV PSR FEP CGL IQL QGM RYGTPC ACA STG GLV DTV IEG KTG FHMGRL SVD CKV VEP SDVKKV AAT LKR AIK VVG TPA YEE MVR NCM NQD LSW KGPAKN WEN VLLGLG VAG SAP GIE GDE IAP LAK ENV AAP*
[0050] The promoter sequence of Wx in "Pigumzhi" has been amplified and sequenced in the early stage. The double targets of CRISPR vector were designed in the region where the cis-acting elements of the promoter sequence of the gene were relatively concentrated, and the promoter sequence knockout vector was constructed. See Figure 2The vector and the obtained material of the combination of Target 1 and Target 2 are named as Wx-1, the vector and the obtained material of the combination of Target 3 and Target 4 are named as Wx-2, and the vector and the obtained material of the combination of Target 5 and Target 6 are named as Wx-3.
[0051] The target sequence of Wx-1 is as follows:
[0052] Target 1: 5'-CATCGATCATCCCTTTGTCGAGG-3' (SEQ ID No. 2, as shown in the segment of 2183-2206 bp on SEQ ID No. 1, which is 2206-2183 bp away from the start codon ATG of the Wx gene, and the PAM is AGG);
[0053] Target 2: 5'-CGCCCTGCATGAGAAGCTCGCGG-3' (SEQ ID No. 5, as shown in the segment of 2027-2050 bp on SEQ ID No. 1, which is 2050-2027 bp away from the start codon ATG of the Wx gene, and the PAM is CGG).
[0054] The sgRNA targeting Target 1 in the CRISPR / Cas9 method is denoted as sgRNA1, and the sgRNA targeting Target 2 in the CRISPR / Cas9 method is denoted as sgRNA2.
[0055] II. Construction of sgRNA expression cassette
[0056] 1. Construction of sgRNA1 expression cassette pOsU3-WxgRNA
[0057] 1. Construction of sgRNA1 expression cassette pOsU3-WxgRNA
[0058] PCR amplification of pOsU3-WxgRNA expression cassette was carried out with U-F, gRNA-R, U3-OsWx-F, U3-OsWx-R as primers and pYLsgRNA-OsU3 plasmid as template. The pOsU3-WxgRNA expression cassette can encode sgRNA1, which is the sgRNA1 expression cassette, and bacterial liquid PCR was carried out. The positive monoclonal with a band size of about 0.8 kb was selected for sequencing, and the sequencing primer was SP1. The sequence of the primer used is as follows:
[0059] U3-OsWx-F:
[0060] (SEQ ID No. 6, the sequence indicated by the wavy line is Target 1, and the sequence indicated by the underline is the linker sequence);
[0061] U3-OsWx-R:
[0062] (SEQ ID No. 7, the sequence indicated by the wavy line is reverse complementary to Target 1, and the sequence indicated by the underlined is a linker sequence);
[0063] U-F: 5'- CTCCGTTTTACCTGTGGAATCG -3' (SEQ ID No. 8);
[0064] gRNA-R: 5'- CGGAGGAAAATTCCATCCAC -3' (SEQ ID No. 9).
[0065] The PCR product was diluted 10 times as a template for the second round of PCR amplification. The B-L and B2 primers were used for the second round of PCR amplification, and a Bsal enzyme recognition site was introduced. The primer sequences used are as follows:
[0066] B-L: 5'-TTCAGA GGTCTC TCTCGACTAGTATGGAATCGGCA GCAAAGG-3' (SEQ ID No. 10, the sequence indicated by the underlined is a Bsal enzyme recognition site);
[0067] B2: 5'-AGCGTG GGTCTC GTCAGGGTCCATCCACTCCAAGCT C-3' (SEQ ID No. 11, the sequence indicated by the underlined is a Bsal enzyme recognition site).
[0068] The amplification product was detected by agarose gel electrophoresis, and the target fragment was recovered by purification.
[0069] 2. Construction of sgRNA2 expression cassette pOsU6a-WxgRNA
[0070] The pOsU6a-WxgRNA expression cassette was amplified by fusion PCR using the U-F, gRNA-R, U6a-Wx-F, U6a-Wx-R primers and the pYLsgRNA-OsU6a plasmid as a template. The pOsU6a-WxgRNA expression cassette can encode sgRNA2, which is the sgRNA2 expression cassette. The primer sequences used are as follows:
[0071] (SEQ ID No. 12, the sequence indicated by the wavy line is Target 2, and the sequence indicated by the underlined is a linker sequence);
[0072] (SEQ ID No. 13, the sequence indicated by the wavy line is reverse complement to Target 2, and the sequence indicated by the underlined is a linker sequence);
[0073] U-F: 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID No. 8);
[0074] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID No. 9).
[0075] The PCR product was diluted 10 times as a template for the second round of PCR amplification. The second round of PCR amplification was performed with B2', B-R as primers, and a Bsal enzyme recognition site was introduced. The sequences of the primers used are as follows:
[0076] B2': 5'-TTCAGA GGTCTC TCTGACACTGGAATCGGCAGCAA AGG-3' (SEQ ID No. 14, the sequence indicated by the underlined is a Bsal enzyme recognition site);
[0077] B-R: 5'-AGCGTG GGTCTC GACCGACGCGTATCCATCCACTC CAAGCTC-3' (SEQ ID No. 15, the sequence indicated by the underlined is a Bsal enzyme recognition site).
[0078] The amplification product was detected by agarose gel electrophoresis, and the target fragment was recovered by purification.
[0079] 3. Construction of recombinant expression vector CRISPR-OsWx-1Target
[0080] The second round of PCR purified product obtained in step 1 and the second round of PCR purified product obtained in step 2 were constructed on pYLCRISPR / Cas9Pubi-H (the vector skeleton map is shown in Figure 3 ) according to the conventional molecular experimental operation "cutting and connecting" method. Then, DH5a was transformed, and single colonies were picked.
[0081] The recombinant plasmid was sequenced, and it was determined that the correct expression vector was obtained, wherein the sequencing primer is:
[0082] SP1: 5'-CCGACATAGATGCAATAACTTC-3' (SEQ ID No. 16).
[0083] The recombinant plasmid with correct sequencing is named as CRISPR-OsWx-1Target, and for the convenience of identification and distinction from other plasmids, it is referred to as Wx-1 plasmid. The CRISPR-OsWx-1Target contains sgRNA1 expression cassette pOsU3-WxgRNA, sgRNA2 expression cassette pOsU6a-WxgRNA and cas9 coding gene, and can express sgRNA1 and sgRNA2 and Cas9. In the same way, Wx-2 and Wx-3 plasmids are obtained, which are different from Wx-1 plasmid in that the target sequences are different, which are described in detail above.
[0084] Example 2, construction and phenotype identification of "Pig Drum Sticking" plant with Wx gene promoter special segment knockout
[0085] 1. Cultivation of "Pig Drum Sticking" plant with Wx gene promoter special segment knockout
[0086] The Wx-1, Wx-2 and Wx-3 plasmids obtained in Example 1 are transformed into Agrobacterium EHA105 by the conventional electroporation method in the art, respectively, and the callus of "Pig Drum Sticking" is infected with Agrobacterium, and the callus is screened with hygromycin 50 mg / L, and the callus is differentiated, and the transformed seedlings are obtained after about 4 months. After 1-2 weeks of seedling raising, they are transplanted into soil, and after about 3 months of growth, the genomic DNA of the transformed seedlings is extracted, and the OsWx-1, OsWx-2 and OsWx-3 series strains are amplified by specific primers.
[0087] Among them, the primer pair for amplifying OsWx-1 is composed of OsWx-1-F and OsWx-1-R:
[0088] OsWx-1-F: 5'-CAGCCGTGGGAGAGGAGAT-3', (SEQ ID No. 17);
[0089] OsWx-1-R: 5'-TTGGGGTGTGCGTGGAGCG-3', (SEQ ID No. 18).
[0090] The genomic editing material is selected, the fragment is amplified to obtain a product, and the product is sent for sequencing to determine the mutation type. This embodiment establishes a "Pig Drum Sticking" genetic transformation system and obtains a series of mutant plants with reduced amylose content, and performs sequencing identification, and the results show that the mutant plants with fragment knockout are obtained for the three plasmids, Figure 4The gene mutation of different mutant plants is shown. After collecting seeds from single plants, T1 generation materials are obtained by continuous planting. The RNA of rice leaves of each T1 material is extracted, reverse transcribed into cDNA, and subjected to real-time fluorescent quantitative PCR experiment of Wx gene. The results show that the relative expression amount of Wx gene in Wx-1 material is reduced to about 0.3 compared with wild type Pidugubia, and the relative expression amount of Wx gene in Wx-2 and Wx-3 materials is obviously reduced( Figure 5 ). The amylose content of each material is counted, and it is found that the amylose content in Wx-1 material is slightly reduced, reaching about 5%, reaching the waxy level, while the amylose content in Wx-2 and Wx-3 is significantly reduced( Figure 6 ).
[0091] 2, Phenotype of "Pidugubia" with special segment knockout of Wx gene promoter
[0092] The Wx different knockout materials are planted in the field, and the Wx gene resequencing of the double-target knockout of target 1, 2, target 3, 4 and target 5, 6 is shown in Figure 4 . The plant numbers of T1 generation different site mutant strains are Wx-1-4, Wx-1-7 and Wx-1-12. Figure 8 The sequencing results of Wx-1-4 mutant and wild type are shown, and a base A is inserted in target 2; Figure 9 The sequencing results of Wx-1-7 mutant and wild type are shown, and a sequence including target 3 and target 4 is knocked out; Figure 10 The sequencing results of Wx-1-12 mutant and wild type are shown, and a sequence including target 5 and target 6 is knocked out; Figure 11 The appearance, rough rice rate, thousand-grain weight and proanthocyanidin content of the three mutant strains are shown. Figure 8-10 The mismatch of the sequence before and after in the sequencing map is the sequencing error base existing at the beginning of the sequencing reaction.
[0093] The field phenotypes of these materials are observed, and compared with the wild type "Pidugubia", it can be seen that the amylose content of the three Wx mutant strains is changed( Figure 11 ). In order to more accurately identify the phenotype, the amylose content of "Pidugubia" wild type and the three Wx mutant strains and the relative expression amount of Wx gene in each strain are measured and counted, and it is found that the relative expression amount of Wx gene in the three Wx mutant strains is lower than that of the wild type strain, and the expression amount of each strain is between 0.3-0.7 times of the wild type( Figure 5 ). The amylose content of the three Wx mutant strains is significantly lower than that of the wild type material, and the gel consistency is significantly higher than that of the wild type material only in Wx-1Figure 6 、 7 ). The amylose and gel consistency of the three strains changed to some extent, especially the CT base insertion of target 2 caused a substantial change in amylose, indicating that the CT base on target 2 is the key site in the Wx gene promoter sequence that regulates amylose content. It can be seen that the promoter region where target 2 is located is the core promoter region of the Wx gene, and the CT base on target 2 (the segment 2034-2033 bp away from the ATG of the Wx gene start codon) is the core promoter region that plays the most critical regulatory role.
[0094] Therefore, in the Guizhou local high-quality rice "Piguang", by editing the special segment of the Wx gene promoter, the amylose content can be accurately reduced, helping to improve the quality and nutritional value of rice, and thus improving the market competitiveness of rice. Through this method, we can produce rice that is more in line with consumer demand, and contribute to the development of rice planting industry.
[0095] Finally, it should be pointed out that the above examples are only more representative examples of the present application. Obviously, the technical solutions of the present application are not limited to the above examples, but can also have many variations. All variations that can be directly derived or inferred from the content disclosed in the present application by those of ordinary skill in the art should be considered as falling within the scope of protection of the present application.
Claims
1. A combination of target sequences for gene editing, characterized in that, The target sequence combination consists of Target 1 and Target 2, the nucleotide sequence of Target 1 is shown as SEQ ID No. 4, and the nucleotide sequence of Target 2 is shown as SEQ ID No.
5.
2. The use of the target sequence combination according to claim 1 in cultivating red rice with low amylose content, which is gene editing knockout.
3. A method for gene editing of red rice using the target sequence combination of claim 1, wherein, The method comprises the following steps: using a CRISPR / Cas9 system, the sgRNA of the CRISPR / Cas9 system is sgRNA1 and sgRNA2, the target sequence of the sgRNA1 is shown as SEQ ID No. 4, and the target sequence of the sgRNA2 is shown as SEQ ID No.
5.
4. A method for improving amylose content of red rice amylose precisely, characterized in that, The mutant red rice plant is obtained after gene editing by using the gene editing method according to claim 3 for knockout.
Citation Information
Patent Citations
Method for creating rice amylose content variation by using promoter editing
CN110964743A