A gene for improving drought resistance of tomato plants and a method thereof

Abstract

The application discloses a gene for improving drought resistance of tomato plants and a method thereof, wherein the nucleotide sequence of the gene is shown in a figure Seq No. 1. SlERF.D2 The complete coding sequence of the gene is obtained from tomato, a target is designed, the target is connected to a CRISPR-Cas9 vector, a plant is transformed by using an agrobacterium infection method, a gene editing plant is obtained, and the gene editing plant is analyzed, and the result shows that the gene editing plant can improve drought resistance of tomato plants.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, relates to a gene and method for regulating drought stress in tomato plants, and particularly relates to an AP2 / ERF family transcription factor SlERF.D2, and application of the gene in regulating drought stress in tomato plants. Background Art

[0002] tomato( Solanum lycopersicum As an important vegetable and cash crop, tomato is a crucial food source for humans. However, most tomato varieties have poor environmental adaptability, making their growth and development susceptible to abiotic stresses such as drought. Therefore, identifying tomato genes associated with stress resistance and developing corresponding resistant varieties are crucial for tomato production. Furthermore, tomatoes are self-pollinating, have a short growth cycle, and have a fully sequenced genome, making them a popular model crop.

[0003] AP2 / ERF transcription factors, one of the largest transcription factor families in plants, were once considered unique to the plant kingdom, possessing important regulatory functions. Ethylene response factors (ERFs) not only promote seed germination, fruit development, and organ abscission, but also participate in plant stress responses. As sessile organisms, plant growth and development are constantly influenced by various environmental conditions. Adverse stress has severe adverse effects on plant growth and development, including crop yield. Plants have evolved complex regulatory pathways to respond to various abiotic stresses. Plant water status is influenced by factors such as leaf relative water content (RWC) and transpiration rate. After drought stress, the transpiration rate of plant leaves is typically significantly lower than that of unstressed leaves, while the malondialdehyde (MDA) content in leaves increases significantly. Furthermore, under drought stress, the reduction in available water is often accompanied by a decrease in total nutrient uptake and nutrient concentrations in various tissues and organs. In addition, drought-induced stomatal closure limits the absorption of CO2 by leaves, leading to a decrease in the plant's photosynthesis rate and increasing the plant's sensitivity to light damage.

[0004] Knocking out CPK27 in tomato reduces the drought resistance of tomato plants and impairs the response of abscisic acid (ABA) regulated plants to drought stress, providing a way to improve plant drought resistance by manipulating CPK27, thereby making plants drought resistant under changing climate conditions (Zhu C, Jing B, Lin T, et al. 2024, Plant Physiol.195(2):1005-1024). Overexpression of WRKY39 gene in Populus trichocarpa can improve the drought resistance and salt-tolerant regulation of transgenic plants during seed germination and vegetative growth (Niu Y, Li X, Xu C, et al. 2021 Plant Signal Behav.;16(7):1918885).

[0005] Genome studies a DREB transcription factor gene (TaDTG6-B) closely related to drought tolerance in wheat, and a 26 bp deletion in the coding region of TaDTG6-B can induce the gain-of-function of TaDTG6-BDel574. Compared with the TaDTG6-BIn574 encoded by the allele lacking the deletion, TaDTG6-BDel574 shows stronger transcription activation, protein interaction and binding activity to dehydration response element (DRE) / CRT cis-elements, thereby conferring greater drought tolerance to wheat seedlings carrying the variation (Mei F, Chen B, Du L, et al. 2022 Plant Cell. 34(11):4472-4494). However, there are few reports on AP2 / ERF family transcription factors in tomato that can improve the drought resistance of tomato plants. SUMMARY

[0006] The purpose of the present application is to provide a gene and method for improving the drought resistance of tomato plants.

[0007] To achieve the above and other related purposes, the technical solution provided by the present application is: a gene for improving the drought resistance of tomato plants, the nucleotide sequence of which is shown in Seq No. 1.

[0008] To achieve the above and other related purposes, the technical solution provided by the present application is: a method for improving the drought resistance of tomato plants, comprising the following steps:

[0009] Step 1: Preparation of gRNA target site adapter primer;

[0010] Step 2: gRNA expression cassette construction: prepare an enzyme digestion and ligation reaction solution containing the target site adapter primer in step 1, and use the cut-and-ligate method to connect the target site adapter to the gRNA expression cassette to expand the gRNA expression cassette;

[0011] Step 3: The product of step 2 is used as a template for first-round PCR amplification; the first-round PCR product is used as a template for second-round PCR amplification, and the product concentration is detected by agarose gel electrophoresis, followed by purification and recovery of the second-round PCR product using a DNA purification kit to obtain a purified product;

[0012] Step 4: The purified product of step 3 is connected to the CRISPR-Cas9 plasmid using the method of cutting and connecting at the same time to obtain a connected plasmid;

[0013] Step 5: The connected plasmid of step 4 is transformed into E. coli DH5a competent cells to obtain positive monoclonal colonies;

[0014] Step 6: The positive monoclonal colonies obtained in step 5 are picked for PCR identification, and if correct, the plasmid is extracted to obtain SlERF.D2 -CRISPR-Cas9 plasmid;

[0015] Step 7: The SlERF.D2 -CRISPR-Cas9 plasmid is transformed into EHA105 Agrobacterium competent cells to obtain an Agrobacterium monoclonal colony of the constructed SlERF.D2 -CRISPR-CAS9 vector;

[0016] Step 8: The Agrobacterium monoclonal colony of the constructed SlERF.D2 -CRISPR-Cas9 vector is used for genetic transformation of tomatoes.

[0017] The preferred technical solution is that the preparation of the gRNA target point primer connector includes: first, the target point one forward primer-F1, the target point one reverse primer-R1, the target point two forward primer-F2, and the target point two reverse primer-R2 are configured to obtain 100 µM of mother liquor, respectively; then the target point one forward primer-F1 mother liquor and the target point one reverse primer-R1 mother liquor are mixed and diluted to 1 µM to obtain a first mixed primer, and the target point two forward primer-F2 mother liquor and the target point two reverse primer-R2 mother liquor are mixed and diluted to 1 µM to obtain a second mixed primer; 90℃, 30s, then transfer to room temperature for cooling to complete annealing;

[0018] Target point one forward primer-F1: 5'-gtcaTACACGTGTGGTATCGGGTC-3';

[0019] Target point one reverse primer-R1: 5'-aaacGACCCGATACCACACGTGTA-3';

[0020] Target point two forward primer-F2: 5'-gtcaGGTGTACGACAACGACCAT-3';

[0021] Target point two reverse primer-R2: 5'-aaacATGGTCGTTGTCGTACACC-3'.

[0022] The preferred technical solution is that in step 2, the target linker is connected with the gRNA expression box by cutting and connecting, and the gRNA expression box is expanded, including:

[0023] gRNA-U#plasmid 1 μL, first mixed primer 0.5 μL, BsaI Enzyme 0.4 μL, 10xCutsmart buffer 1 μL, T4 DNA ligase 0.1 μL, 10xT4 DNA ligase buffer 0.5 μL, ddH2O supplemented to 10 μL, PCR program setting is 37°C, 5 min; 20°C, 5 min; 5 cycles, to obtain the first ligation product;

[0024] gRNA-U#plasmid 1 μL, second mixed primer 0.5 μL, BsaI Enzyme 0.4 μL, 10xCutsmart buffer 1 μL, T4 DNA ligase 0.1 μL, 10xT4 DNA ligase buffer 0.5 μL, ddH2O supplemented to 10 μL, PCR program setting is 37°C, 5 min; 20°C, 5 min; 5 cycles, to obtain the second ligation product.

[0025] The preferred technical solution is that in step 3,

[0026] Each gRNA expression box contains 2 rounds of PCR reaction, and in the first round of PCR, a total of 4 reactions are contained;

[0027] The reaction one of the target one is: taking 1 μL of the first ligation product as the template, 2 μL of U-F, 2 μL of target one reverse primer R1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5xSuper-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O supplemented to 50 μL, to obtain the third ligation product;

[0028] The reaction two of the target point one is: taking 1 μL of the first ligation product as a template, 2 μL of gRNA-R, 2 μL of the target point one forward primer F1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O is supplemented to 50 μL, to obtain the fourth ligation product;

[0029] The reaction one of the target point two is: taking 1 μL of the second ligation product as a template, 2 μL of U-F, 2 μL of the target point two reverse primer R1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O is supplemented to 50 μL, to obtain the fifth ligation product;

[0030] The reaction two of the target point two is: taking 1 μL of the second ligation product as a template, 2 μL of gRNA-R, 2 μL of the target point two forward primer F1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O is supplemented to 50 μL, to obtain the sixth ligation product;

[0031] The PCR program is set as: 95°C pre-denaturation for 1 min, 95°C denaturation for 10 s, 60°C annealing for 15 s, 72°C extension for 15 s, 25 cycles; finally 72°C extension for 10 min; after amplification, detection is performed;

[0032] U-F: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0033] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0034] Before the second round of PCR reaction, the position-specific primer pair is mixed into a 10× working solution in advance, 1.5 μM of each: primer combination working solution PT1 = 1.5 μL of B1' + 1.5 μL of B2 + 7 μL of ddH2O, primer combination working solution PT2L = 1.5 μL of B2' + 1.5 μL of BL + 7 μL of ddH2O;

[0035] The target site 1 reaction system consists of 1 µL each of the third and fourth ligation products from the first round of PCR amplification, 3 µL of primer combination working solution PT1, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 µL of ddH2O. Mix well and place in a PCR instrument to amplify the seventh ligation product.

[0036] The target site 2 reaction system consists of: 1 µL each of the fifth and sixth ligation products from the first round of PCR amplification, 3 µL of primer combination working solution PT2L, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 µL of ddH2O. Mix well and place in a PCR instrument to amplify the eighth ligation product.

[0037] The PCR reaction conditions were as follows: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 18 cycles; 72°C, 10 min; 4°C, ∞;

[0038] B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3';

[0039] B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3';

[0040] B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3';

[0041] BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'.

[0042] The preferred technical solution is: in step 4, the purified product of step 3 is connected to the CRISPR-Cas9 plasmid by the cutting and ligating method, including: the reaction system is: 0.2 μL of the purified product of step 3, 1 μL of the CRISPR-Cas9 plasmid, BsaI Enzyme 0.5 µL, 10× BsaIBuffer 1.5µL, ddH2O 11.8µL, digest at 37℃ for 10 min; add 10×NEB T4 DNA ligase buffer 0.4µL, T4 DNA ligase 0.1µL, set the PCR instrument at 37℃ for 2 min; 10℃ for 3 min; 20℃ for 5 min; 13 cycles, and finally at 37℃ for 2 min to obtain the ligated plasmid; the purified product in step 3 refers to the product obtained by mixing the seventh ligation product and the eighth ligation product in a 1:1 volume ratio and then purifying it.

[0043] The preferred technical solution is as follows: in step 5, 5 μL of the ligated plasmid is transferred into 50 μL of Escherichia coli DH5α competent cells, the bottom of the centrifuge tube is manually stirred to make it uniform, ice bath for 25 minutes, heat shock at 42°C for 45 seconds, and ice bath for 2 minutes; liquid LB medium is added thereto, and the cells are shaken in a shaker at 37°C and 200 rpm for 0.5-1.5 hours; the cultured bacterial liquid is centrifuged to obtain the supernatant, the bacterial liquid is pipetted and mixed, and then spread on solid LB medium containing kanamycin, and the tube is inverted and cultured in an incubator overnight to obtain positive monoclonal colonies.

[0044] The preferred technical solution is: in step 6, the identification system is 25 μL: 2 μL of the bacterial solution obtained in step 5, 1 μL each of SP-L primer and SP-R primer, 12.5 μL of 2×Taq enzyme, and 8.5 μL of ddH2O; the reaction conditions in the PCR instrument are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, and 72°C extension for 15 s, for a total of 35 cycles, and 72°C post-extension for 5 min; after the PCR reaction is completed, 8 μL of sample is taken for agarose gel electrophoresis detection to see whether the size of the electrophoresis band meets the theoretical value, and the bacterial solution with the correct band is transferred to 3 mL of liquid LB containing kanamycin for expansion culture, and cultured at 37°C and 200 rpm for 16 h. The plasmid is extracted using a plasmid extraction kit and run agarose gel electrophoresis detection. The extracted plasmid is further sequenced to obtain SlERF.D2 -CRISPR-Cas9 plasmid;

[0045] SP-L primer: GTCGTGCTCCACATGTTG;

[0046] SP-R primer: CCCGACATAGATGCAATAACTTC.

[0047] The preferred technical solution is: in step 7, take 100 μL EHA105 Agrobacterium competent cells, divide them into two tubes, wait for them to melt in an ice bath, add 1 μL SlERF.D2-CRISPR-Cas9 plasmid, the bottom of the centrifuge tube is stirred by hand to mix, and then sequentially placed on ice for 5 min, liquid nitrogen for 5 min, 37 DEG C water bath for 5 min, ice bath for 5 min; 700 muL of LB liquid culture medium without antibiotics is added, and the mixture is cultured at 28 DEG C for 2-3h; the bacteria are collected by centrifugation at 5000 rpm for 5 min, about 100 muL of supernatant is reserved, the bacterial body is resuspended, and then coated on LB-Kana / Rif solid culture medium and cultured in a 28 DEG C incubator for 2-3 days to obtain the constructed SlERF.D2 -Agrobacterium single colony of CRISPR-Cas9 vector.

[0048] The preferred technical scheme is that in step 8, the constructed SlERF.D2 -Agrobacterium single colony of CRISPR-Cas9 vector is dissolved in 10 muL of sterile water to prepare a bacterial solution, the bacterial solution is added to 3 mL of liquid LB medium containing Kana and Rif, and the mixture is cultured at 200 rpm and 28 DEG C overnight, then 400 muL is taken into 30 mL of liquid LB medium containing Kana and Rif, and the mixture is cultured at 200 rpm and 28 DEG C for 3-6 h, and the OD 600 of the bacterial solution is detected by a spectrophotometer until the OD 600 of the bacterial solution is 0.6-0.8, and the bacterial body is collected by centrifugation at 5000 rpm and room temperature for 5 min, the supernatant is discarded, and the bacterial body is blown and sucked to an OD 600 of 0.1-0.15; after the tomato cotyledon and stem segment are pre-cultured in the dark for 2 days, they are soaked in the diluted Agrobacterium infection solution, the infection solution is poured out after 5 min of infection, and the cotyledon and stem segment are placed on the medium containing different plant hormones for germination, bud elongation and rooting, the rooted explants are transferred to nutrient soil for culture, and subsequent sequencing identification is carried out, so that the transformed tomato plant is obtained.

[0049] Thanks to the use of the above technical scheme, the present application has the following advantages compared with the prior art:

[0050] The coding sequence of the SlERF.D2 gene is obtained from the tomato, the primers of the CRISPR-Cas9 vector are designed, the corresponding vector is constructed, the Agrobacterium competent cell is successfully infected, and the SlERF.D2 gene edited tomato plant of CRISPR-Cas9 is obtained. SlERF.D2 Compared with the wild type tomato plant, the CRISPR-Cas9 plant shows obvious drought resistance. SlERF.D2 The results show that the gene can improve the drought resistance of the tomato plant.

[0051] Figure 1 is identified; A:erf.d2 Sequencing results; B: WT and erf.d3 Comparison of sequence peak maps.

[0052] Figure 2 Wild type (WT), S. lycopersicum plant, erf.d2 Differences in the phenotype of genetically edited tomato plants under drought conditions.

[0053] Figure 3 Wild type (WT), S. lycopersicum plant, erf.d2 Differences in the phenotype of genetically edited tomato leaves under drought conditions.

[0054] Figure 4 Wild type (WT), S. lycopersicum plant, erf.d2 Changes in the water content of genetically edited tomato leaves.

[0055] Figure 5 Wild type (WT), S. lycopersicum plant, erf.d2 Differences in the phenotype of genetically edited tomato plants after rehydration. DETAILED DESCRIPTION

[0056] The following specific examples illustrate the embodiments of the present application, and those skilled in the art can easily understand other advantages and effects of the present application from the content disclosed in the examples.

[0057] Please refer to Figures 1-5 It should be understood that the structures, proportions, sizes, etc. shown in the drawings attached to the present specification are only used to illustrate the content disclosed in the present specification, to be understood and read by those skilled in the art, and do not have technical significance to limit the conditions that the present application can be implemented. The following examples are provided to better understand the present application, not to limit the present application. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0058] Example 1: A gene for improving the drought resistance of tomato fruit plants and a method thereof

[0059] A method for improving the drought resistance of tomato fruit plants, comprising the following steps:

[0060] SlERF.D2 Construction of CRISPR-Cas9 deletion vector

[0061] (1) Obtain SlERF.D2 Gene sequence and design gRNA target primer.

[0062] (2) Preparation of gRNA target adapter.

[0063] (3) gRNA expression cassette construction and connection: gRNA vector is cut, and the target joint is connected with the gRNA expression cassette by the cutting and connecting method, and the gRNA expression cassette is expanded.

[0064] (4) The product of step (3) is used as a template for one round of PCR amplification. The one-round PCR product is used as a template for two-round PCR amplification, and the product concentration is observed by running a gel. The two-round PCR product is purified and recovered by using a DNA purification kit.

[0065] (5) The gRNA expression cassette is connected with the Cas9 plasmid by the cutting and connecting method.

[0066] (6) The product connected in step (5) is transformed into E. coli DH5α competent cells.

[0067] (7) The positive monoclonal strain is picked and identified, and the obtained product is detected by agarose gel.

[0068] (8) The SlERF.D2 CRISPR-Cas9 plasmid is transformed into EHA105 Agrobacterium competent cells.

[0069] (9) The Agrobacterium competent cells containing the SlERF.D2 CRISPR-Cas9 plasmid are used for genetic transformation of tomatoes.

[0070] The preferred embodiment is that in step (1), the gene sequence of tomato SlERF.D2 is obtained from the NCBI database, gRNA target point primer design is performed through the website http: / / crispr.dbcls.jp / , two pairs of target point primers F1 / F2 and R1 / R2 are designed, the GC content is not less than 50% and not higher than 70%, and the Tm value is 55-70℃.

[0071] The preferred embodiment is that in step (2), the linker primer is dissolved into a 100 µM mother liquor and mixed and diluted to 1 µM. About 90℃ for 30 s, then transferred to room temperature for cooling to complete annealing, and the concentration is detected.

[0072] The preferred embodiment is that in step (3), in order to ensure the activity of the enzyme, a 10 µL reaction system is first prepared, BsaI BsaI ​Enzyme 0.5 μΐ, 1 μΐ gRNA-U# plasmid, 10x Cutsmart buffer 1 μΐ, ddH2O to 10 μΐ, 37℃, 15 min, then agarose gel electrophoresis to check whether the target band is cut out. The total reaction system of gRNA vector enzyme digestion is 10 μΐ, including gRNA-U# plasmid 1 μΐ, reacting in PCR instrument for 20 min, finally 70℃, 5 min to inactivate the enzyme. The target linker and gRNA expression cassette ligation reaction is: 1 μΐ 10x T4 DNA ligase buffer, 1 μΐ gRNA-U# plasmid, 0.5 μΐ target linker, ddH2O to 10 μΐ, finally add 0.1 μΐ T4 DNA ligase.

[0073] The preferred embodiment is that in step (4), two reactions are included in one round of PCR, and the total PCR system is 50 μΐ. Reaction one contains 1 μΐ of ligation product, 1 μΐ of primer U-F, 1 μΐ of reverse primer R, 5 μΐ of dNTPs, 3 μΐ of MgSO4, 1 μΐ of KOD enzyme, 5 μΐ of 10x KOD buffer, and 33 μΐ of ddH2O. Reaction two only changes the primer pair to gRNA-R and forward primer F1, and the others are the same as reaction one. The PCR reaction conditions are: 95℃ pre-denaturation for 1 min, 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles, 72℃ post-extension for 10 min, and agarose gel electrophoresis detection of the product.

[0074] The preferred embodiment is that in step (5), the method of cutting and connecting is used to perform PCR reaction. The reaction system is 0.2 μΐ of purified product of step (4), 1 μΐ of CRISPR-Cas9 plasmid, BsaI Enzyme 0.5 μΐ, 10x BsaI buffer 1.5 μΐ, ddH2O 11.8 μΐ, 37℃ enzyme digestion for 10 min. Add 10x NEB T4 DNA ligase buffer 0.4 μΐ, T4 DNA ligase 0.1 μΐ. Set 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min in PCR instrument, 13 cycles, finally 37℃ for 2 min.

[0075] The preferred embodiment is that in step (6), 5 μL of the connected plasmid is transferred into 50 μL of E. coli DH5α competent cells, the bottom of the centrifuge tube is gently stirred to make it uniform, ice bath for 25 min, 42℃ heat shock for 45 s, ice bath for 2 min. 350 μL of liquid LB is added, and the bacteria are shaken in a 37℃, 200 rpm shaker for 1 h. The bacterial solution obtained by culture is centrifuged at 6000 rpm for 1 min, and 100 μL of supernatant is reserved. After blowing and stirring the bacterial solution, it is spread on solid LB containing kana (100 μL of 100 mL), and inverted in a 37℃ incubator for overnight culture.

[0076] The preferred embodiment is that in step (7), the identification system is 25 μL, containing 2 μL of bacterial solution, 1 μL of SP-L / SP-R primer, 2×Taq enzyme 12.5 μL, and ddH2O 8.5 μL. The reaction conditions in the PCR instrument are as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles, and 72℃ post-extension for 5 min. The reaction conditions in the PCR instrument are as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 3 s, a total of 35 cycles, and 72℃ post-extension for 5 min. After the PCR reaction is completed, 8 μL of sample is taken for agarose gel electrophoresis detection to see if the electrophoresis band size meets the theoretical value. The bacterial solution with correct band is transferred to 3 mL of liquid LB containing kanamycin for expansion culture, 37℃, 200 rpm shaking culture for 16 h, and then the plasmid is extracted using a plasmid extraction kit and detected by agarose gel electrophoresis. The extracted plasmid is sent to Shengong Company for further sequencing;

[0077] SP-L sequence: GTCGTGCTCCACATGTTG;

[0078] SP-R sequence: CCCGACATAGATGCAATAACTTC.

[0079] The preferred embodiment is that in step (8), 100 μL of Agrobacterium competent cells stored at -80℃ is divided into two tubes, and then melted in an ice bath. 2 μL of correctly sequenced plasmid DNA is added, and the bottom of the centrifuge tube is gently stirred to make it uniform. It is sequentially placed on ice for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, and ice bath for 5 min. 700 μL of antibiotic-free LB liquid medium is added, and the bacteria are shaken at 28℃ for 3 h. The bacteria are centrifuged at 5000 rpm for 5 min, and about 200 μL of supernatant is reserved. The bacterial cells are resuspended by blowing and stirring, and then spread on LB-Kana / Rif solid LB medium and inverted in a 28℃ incubator for 2-3 days.

[0080] The preferred embodiment is that in step (9), the constructed SlERF.D2 The Agrobacterium single colony of the CRISPR-Cas9 vector is dissolved in 10 μL sterile water to make a bacterial solution, and the bacterial solution is added to 3 mL liquid LB medium containing Kana and Rif, and cultured at 200 rpm and 28°C overnight. Then, 400 μL is taken and added to 30 mL liquid LB medium containing Kana and Rif, and cultured at 200 rpm and 28°C for 3-6 h. The OD of the bacterial solution is detected by spectrophotometry. 600 The OD of the bacterial solution is detected by spectrophotometry. 600 The OD of the bacterial solution is detected by spectrophotometry.Tomato cotyledons and stem segments are pre-cultured in the dark for 2 d, then soaked in the diluted Agrobacterium infection solution, and shaken for 5 min. The infection solution is then discarded, and the cotyledons and stem segments are placed on culture medium containing different plant hormones for germination, bud elongation, and rooting. The rooted explants are transferred to nutrient soil for subsequent sequencing and identification, and then the transformed tomato plants are obtained. Then, by designing upstream and downstream primers of the target site, DNA of the transgenic tomato plants is extracted, PCR amplification is performed, and sequencing and identification are performed to analyze whether the gene is edited. SlERF.D2

[0081] Example 2: A gene for improving drought resistance of tomato fruit plants and a method thereof

[0082] A gene for improving drought resistance of tomato fruit plants, wherein the nucleotide sequence of the gene for tomato fruit maturation is shown as Seq No. 1.

[0083] Seq No. 1:

[0084] ATGTATTCAGGGTATTGTGATTCTCAGGCGAGAGATATGTCGGAGATGGTGACGGAGTTTACACGTGTGGTATCGGGTCAGGATTATCGACCCGATACCAGATGTTATTCGGTTAATTCACCGTCTCCGGCTTATTCTTCGTCCAGCTCGGGTTCTAGAGCTGGACTGAAGAGAAGCCGTGATCAACAAGAATTTGGAACTGGGTTGTCATCTTCTTCCTCTGTTAAAATTGAAGAAGCTACAAGTATGGTTGCACCAATTCCCGCTTTCACAACCACAATCACAACCACGACCACAACAGGTGAGGGTTCGAGCGAAGAAACAGGAGGAGATAGGAGGAGGAAATACAGAGGTGTACGACAACGACCATGGGGTAAATGGGCAGCGGAAATAAGAGATCCACATAAAGCCGCCAGAGTTTGGTTAGGAACATTCGATACAGCAGAAGCTGCAGCAAGAGCATATGATGAAGCTGCATTGAGATTTCGAGGAAACAGAGCAAAACTCAACTTCCCTGAGAACGCCAGATTGTCATCGTTACCACAAACACAAAATACTGTAACGTCAACAATCTCCAATCCATCCCCTCTAATAGCTCAACCAACGTCGTTCCTCAATCCTATCCAGAGTTCAGATACAACAAGAGACTACTGGGAATACTCACAATTGTTGCAAAATCCAGGAGATTTTACGGATCAACAACCATCAAACTTATTGGAACAAATGTTCGTTGCCTCATCGATGGCAATGTTGCATTCAAACACATTGCCATTAATATCTTCGTCTTCATCGTTAGCTACATCAGCAACTTCTTCAACGTCATATCCCCTGTTATTTTCGAGTTATTACACACCACAAACTAATCAAATTCAAGGAACCAACACAAGTAGCACCAGCACCACTAGCAGCTCAAGTTTTTCTACAACATTTTGGAGTAGCTCTAGCCAATATCCTCCATCTTCTAGTTAA

[0085] A method for improving drought resistance of tomato plants, comprising the following steps:

[0086] Step 1: Preparation of gRNA target site primer adapter;

[0087] Step 2: gRNA expression cassette construction: prepare a restriction enzyme ligation reaction solution containing the target site primer adapter in step 1, use the method of cutting and connecting to connect the target site adapter with the gRNA expression cassette, and expand the gRNA expression cassette;

[0088] Step 3: Use the product of step 2 as a template to perform first-round PCR amplification; then use the first-round PCR product as a template to perform second-round PCR amplification, use agarose gel electrophoresis to detect the product concentration, and then use a DNA purification kit to purify and recover the second-round PCR product;

[0089] Step 4: Use the method of cutting and connecting to connect the purified product of step 3 with the CRISPR-Cas9 plasmid to obtain the connected plasmid;

[0090] Step 5: Transform the connected plasmid of step 4 into E. coli DH5α competent cells;

[0091] Step 6: Pick the positive monoclonal colonies obtained in step 5 for PCR identification, and use agarose gel electrophoresis to detect the obtained product to obtain SlERF.D2 -CRISPR-Cas9 plasmid;

[0092] Step 7: Transform SlERF.D2 -CRISPR-Cas9 plasmid into EHA105 Agrobacterium competent cells to obtain Agrobacterium monoclonal colonies of the constructed SlERF.D2 -CRISPR-Cas9 vector;

[0093] Step 8: Use the Agrobacterium monoclonal colonies of the constructed SlERF.D2 -CRISPR-Cas9 vector to perform genetic transformation on tomatoes.

[0094] The preferred embodiment is that the preparation of the gRNA target site primer adapter is to first dissolve the target site primer adapter into a 100 µM stock solution, then mix and dilute the target site one forward primer F1 and the target site one reverse primer R1 to 1 µM to obtain a first mixed primer, and mix and dilute the target site two forward primer F2 and the target site two reverse primer R2 to 1 µM to obtain a second mixed primer; 80-100℃ for 30s, then transfer to room temperature for cooling to complete annealing;

[0095] The nucleotide sequence of the target site primer adapter is as follows:

[0096] Target site one forward primer-F1: 5'-gtcaCAGCAGCAACCAAGGCTTAC-3';

[0097] Target one reverse primer-R1: 5′-aaacGTAAGCCTTGGTTGCTGCTG-3′;

[0098] Target two forward primer-F2: 5′-gtcaTTCTTCAGCGCCTGCTGCTG-3′;

[0099] Target two reverse primer-R2: 5'-aaacCAGCAGCAGGCGCTGAAGAA-3'.

[0100] The preferred embodiment is: in step 2,

[0101] To ensure BsaI Enzyme activity, first BsaI The enzyme activity was detected in 10 μL reaction system, which contained BsaI 0.5µL enzyme, 1 µL RNA-U# plasmid, 1 µL 10× Cutsmart buffer, ddH2O supplemented to 10 µL, PCR program set to 37℃, 15 min, then agarose gel electrophoresis to check whether the target band is cut out; if the target band is cut out, it means BsaI The enzyme activity is good and can be used;

[0102] The target linker and gRNA expression cassette are cut and ligated by a cutting and ligation method, including:

[0103] gRNA-U# plasmid 1 µL, first mixed primer 0.5 µL, BsaI 0.4 µL of enzyme, 1 µL of 10× Cutsmart buffer, 0.1 µL of T4 DNA ligase, 0.5 µL of 10× T4 DNA ligase buffer, and ddH2O were added to 10 µL. The PCR program was set at 37°C for 5 min, 20°C for 5 min, and 5 cycles to obtain the first ligation product.

[0104] gRNA-U# plasmid 1 µL, second mixed primer 0.5 µL, BsaI 0.4 µL of enzyme, 1 µL of 10× Cutsmart buffer, 0.1 µL of T4 DNA ligase, 0.5 µL of 10× T4 DNA ligase buffer, and ddH2O were added to 10 µL. The PCR program was set to 37°C for 5 min, 20°C for 5 min, and 5 cycles to obtain the second ligation product.

[0105] The preferred embodiment is: in step 3,

[0106] Each gRNA expression cassette contains 2 rounds of PCR reactions, and the first round contains 4 reactions, with a total reaction system of 50 μL;

[0107] Reaction one of target one: take 1 μL of the first ligation product as a template, 2 μL of U-F, 2 μL of target one reverse primer R1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O to 50 μL, to obtain the third ligation product;

[0108] Reaction two of target one: take 1 μL of the first ligation product as a template, 2 μL of gRNA-R, 2 μL of target one forward primer F1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O to 50 μL, to obtain the fourth ligation product;

[0109] Reaction one of target two: take 1 μL of the second ligation product as a template, 2 μL of U-F, 2 μL of target two reverse primer R1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O to 50 μL, to obtain the fifth ligation product;

[0110] Reaction two of target two: take 1 μL of the second ligation product as a template, 2 μL of gRNA-R, 2 μL of target two forward primer F1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O to 50 μL, to obtain the sixth ligation product;

[0111] The PCR program is set as follows: 95℃ pre-denaturation for 1 min, 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, 25 cycles; and finally 72℃ extension for 10 min. After amplification, 5 μL of the product is detected by 2% agarose gel electrophoresis;

[0112] U-F: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0113] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0114] Before the second round of PCR reaction, the position-specific primer pairs were mixed into 10x working solution in advance, 1.5 μΜ each: primer combination working solution PT1 = 1.5 μL B1' + 1.5 μL B2 + 7 μL ddH2O, primer combination working solution PT2L = 1.5 μL B2' + 1.5 μL BL + 7 μL ddH2O;

[0115] The target one reaction system was: 1 μL of the third ligation product and 1 μL of the fourth ligation product of the first round of PCR amplification, 3 μL of primer combination working solution PT1, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5x Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O were mixed and then placed in a PCR instrument, and the seventh ligation product was obtained by amplification;

[0116] The target two reaction system was: 1 μL of the fifth ligation product and 1 μL of the sixth ligation product of the first round of PCR amplification, 3 μL of primer combination working solution PT2L, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5x Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O were mixed and then placed in a PCR instrument, and the eighth ligation product was obtained by amplification;

[0117] The PCR reaction conditions were: 95℃, 1 min; 95℃, 10 s, 60℃, 15 s, 72℃, 15 s, 18 cycles; 72℃, 10 min; 4℃, ∞;

[0118] B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3';

[0119] B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3';

[0120] B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3';

[0121] BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'.

[0122] In a preferred embodiment, in step 4,

[0123] PCR reaction is performed using a method of overlap extension; the reaction system is: 0.2 μL of the purified product of step 3, 1 μL of the CRISPR-Cas9 plasmid, BsaI 0.5 μL of the enzyme, 1.5 μL of 10x BsaI buffer, 11.8 μL of ddH2O, 10 min of enzyme digestion at 37 °C; 0.4 μL of 10x NEB T4 DNA ligase buffer, 0.1 μL of T4 DNA ligase, 2 min at 37 °C, 3 min at 10 °C, 5 min at 20 °C, 13 cycles, and finally 2 min at 37 °C, to obtain the ligated plasmid; the purified product of step 3 refers to the product obtained after mixing the seventh ligation product and the eighth ligation product in a volume ratio of 1:1 and then purifying.

[0124] In a preferred embodiment, in step 5, 5 μL of the ligated plasmid is transferred into 50 μL of E. coli DH5α competent cells, the bottom of the centrifuge tube is hit with hands to make it uniform, ice bath for 25 min, 42 °C heat shock for 45 s, ice bath for 2 min; 350 μL of liquid LB medium is added thereto, and the bacteria are shaken in a shaking incubator at 37 °C and 200 rpm for 1 h; the obtained bacterial solution is centrifuged at 6000 rpm for 1 min, 100 μL of supernatant is reserved, and the bacterial solution is mixed by blowing and sucking and then plated on solid LB containing kanamycin and inverted in a 37 °C incubator for overnight culture.

[0125] In a preferred embodiment, in step 6, the identification system is 25 μL, including 2 μL of the bacterial solution obtained in step 5, 1 μL of each of the SP-L / SP-R primers, 12.5 μL of 2x Taq enzyme, and 8.5 μL of ddH2O; the reaction conditions in the PCR instrument are as follows: 3 min of pre-denaturation at 95 °C, 15 s of denaturation at 95 °C, 15 s of annealing at 55 °C, 15 s of extension at 72 °C, a total of 35 cycles, and 5 min of post-extension at 72 °C; after the PCR reaction is completed, 8 μL of the sample is subjected to agarose gel electrophoresis detection to check whether the electrophoresis band size meets the theoretical value, and the bacterial solution with the correct band is transferred to 3 mL of liquid LB containing kanamycin for expansion culture, 37 °C, 200 rpm shaking culture for 16 h, and then the plasmid is extracted using a plasmid extraction kit and subjected to agarose gel electrophoresis detection, and the extracted plasmid is further sequenced to obtain SlERF.D2 -CRISPR-Cas9 plasmid.

[0126] Preferred implementation: in step 7, take 100 μL EHA105 Agrobacterium competent cells, divide them into two tubes, melt them in an ice bath, add 1 μL SlERF.D2 -CRISPR-Cas9 plasmid, use hands to stir the bottom of the centrifuge tube to mix, sequentially stand on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, ice bath for 5 min; add 700 μL of LB liquid medium without antibiotics, shake culture at 28°C for 2-3 h; centrifuge at 5000 rpm for 5 min to collect the bacteria, take about 200 μL of supernatant, resuspend the bacterial body, and spread on LB-Kana / Rif solid medium, and invert in a 28°C incubator for 2-3 days to obtain the constructed SlERF.D2 Agrobacterium single colony of CRISPR-Cas9 vector.

[0127] Preferred implementation: in step 8, the constructed SlERF.D2 Agrobacterium single colony of CRISPR-Cas9 vector is dissolved in 10 μL sterile water to make a bacterial solution, and the bacterial solution is added to 3 mL of liquid LB medium containing Kana and Rif, and cultured at 200 rpm and 28°C overnight, then 400 μL is taken in 30 mL of liquid LB medium containing Kana and Rif, and cultured at 200 rpm and 28°C for 6-7 h, and detected by spectrophotometer until the OD 600 of the bacterial solution is 0.6-0.8, centrifuge at 5000 rpm and room temperature for 5 min to collect the bacterial body, discard the supernatant, and blow the bacterial body to OD 600 0.1-0.15 with sterile water; after 2 days of dark pre-culture, tomato cotyledons and stem segments are soaked in diluted Agrobacterium infection solution, the infection solution is discarded after 5 min of infection, and the cotyledons and stem segments are placed on medium containing different plant hormones for germination, bud elongation, and rooting, the rooted explants are transferred to nutrient soil for culture, and subsequent sequencing and identification are performed to obtain transformed tomato plants. Then design target upstream and downstream primers, extract tomato plant DNA, and perform PCR amplification with tomato DNA as the template, and through sequencing and identification, analyze SlERF.D2 whether the gene is edited.

[0128] One: SlERF.D2 Identification of gene edited tomato plants

[0129] Constructing SlERF.D2 gene edited tomato plants by CRISPR / Cas9 technology and tissue culture technology, the SlERF.D2 -Cas9 tomato plants of T1 generation are cut to extract 0.1 g of DNA, the amplified product is sequenced after fragment cloning, and the sequencing results are decoded. Compared with the reference sequence,SlERF.D2 Both strands of Cas9 plant DNA sequence were deleted 4bp, which was homozygous mutation. Then the sequencing peak map was compared, in which, compared with WT plant, slerf.d2 Tomato was deleted 4bp, which was consistent with the above results, indicating that this plant was slerf.d2 homozygous deletion Figure 1 ).

[0130] Two: slerf.d2 Tomato plant drought stress

[0131] By recording the drought resistance of WT and slerf.d2 tomato plants under drought conditions, the function of the gene in tomato plants was determined. After about 12 days of water loss treatment, compared with wild type (WT), slerf.d2 mutant showed severe leaf curling and wilting signs slerf.d2 ). At the same time, the phenotype of tomato in vitro leaf after 15 days of drought treatment was observed and the drying treatment was carried out, and it was found that Figure 2 leaf showed higher water loss rate than WT slerf.d2 , 4). Subsequent rehydration treatment found that WT leaf had withered and could not grow new leaves, while Figure 3 could grow fresh green leaves, proving that slerf.d2 tomato plants have strong drought resistance slerf.d2 ). Figure 5

[0132] The above described are only to explain the preferred embodiments of the present application, and are not intended to limit the present application in any form, so any modification or change of the present application made under the same inventive spirit shall still be included in the scope intended to be protected by the present application.​

Claims

1. A method for improving drought resistance of tomato plants, characterized by: The following steps are involved: Step 1: Preparation of gRNA target adapter primers; Step 2: Construction of gRNA expression cassette: Prepare an enzyme digestion and ligation reaction solution containing the target adapter primer in step 1, and use the cleavage and ligation method to connect the target adapter to the gRNA expression cassette to expand the gRNA expression cassette; Step 3: Using the product of step 2 as a template, perform a first round of PCR amplification; then use the first round of PCR product as a template to perform a second round of PCR amplification, detect the product concentration by agarose gel electrophoresis, and then purify and recover the second round of PCR product using a DNA purification kit to obtain a purified product; Step 4: Use the cutting and ligation method to connect the purified product of step 3 with the CRISPR-Cas9 plasmid to obtain a connected plasmid; Step 5: Transform the plasmid connected in step 4 into E. coli DH5α competent cells to obtain positive monoclonal colonies; Step 6: Pick the positive monoclonal colony obtained in step 5 for PCR identification. If it is correct, extract the plasmid to obtain SlERF.D2 -CRISPR-Cas9 plasmid; Step 7: SlERF.D2 -CRISPR-Cas9 plasmid was transformed into EHA105 Agrobacterium competent cells to obtain the constructed SlERF.D2 - Single Agrobacterium colony carrying CRISPR-CAS9 vector; Step 8: Construct SlERF.D2 -Genetic transformation of tomatoes using a single Agrobacterium colony carrying a CRISPR-Cas9 vector; Preparation of gRNA target primer adapters includes: first preparing 100 µM stock solutions of target one forward primer-F1, target one reverse primer-R1, target two forward primer-F2, and target two reverse primer-R2, respectively; then, diluting the target one forward primer-F1 stock solution and the target one reverse primer-R1 stock solution to 1 µM to obtain the first mixed primer; and diluting the target two forward primer-F2 stock solution and the target two reverse primer-R2 stock solution to 1 µM to obtain the second mixed primer; incubating at 90°C for 30 seconds, then transferring to room temperature to cool and complete annealing; Target one forward primer-F1: 5′- gtcaTACACGTGTGGTATCGGGTC -3′; Target one reverse primer-R1: 5′- aaacGACCCGATACCACACGTGTA -3′; Target two forward primer-F2: 5′- gtcaGGTGTACGACAACGACCAT -3′; Target 2 reverse primer-R2: 5'-aaacATGGTCGTTGTCGTACACC -3'.

2. The method for improving drought resistance of tomato plants according to claim 1, characterized in that: In step 2, the target linker is connected to the gRNA expression cassette using the cut-and-ligate method to expand the gRNA expression cassette, including: gRNA-U# plasmid 1 µL, first mixed primer 0.5 µL, BsaI 0.4 µL of enzyme, 1 µL of 10× Cutsmart buffer, 0.1 µL of T4 DNA ligase, 0.5 µL of 10× T4 DNA ligase buffer, and ddH2O were added to 10 µL. The PCR program was set at 37°C for 5 min; 20°C for 5 min; 5 cycles to obtain the first ligation product. gRNA-U# plasmid 1 µL, second mixed primer 0.5 µL, BsaI The enzyme was added to 0.4 µL, 1 µL of 10× Cutsmart buffer, 0.1 µL of T4 DNA ligase, and 0.5 µL of 10× T4 DNA ligase buffer. The volume was filled with ddH2O to 10 µL. The PCR program was set to 37°C for 5 min, 20°C for 5 min, and 5 cycles to obtain the second ligation product.

Images