Transcription factors, proteins for positively regulating matrine and oxymatrine in plants and application thereof
By constructing an StNAC46 overexpression vector in Sophora flavescens or tobacco and performing genetic transformation, the problem of low matrine and oxymatrine content in Sophora flavescens was solved, and the content of matrine and oxymatrine was significantly increased.
Patent Information
- Application Number
- CN202411384575.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-09-30
AI Technical Summary
Traditional breeding methods limit the increase of matrine and oxymatrine content in Sophora flavescens, and the functional research of NAC transcription factor in Sophora flavescens is still at a blank stage.
By constructing an overexpression vector containing a transcription factor that positively regulates matrine and oxymatrine in plants, and using genetic transformation to transfer it into the plant to be improved, especially Sophora flavescens or tobacco, overexpression of the StNAC46 gene was achieved, thereby increasing the accumulation of matrine and oxymatrine.
Overexpression of the StNAC46 gene increased the matrine content by 1.3 to 13.0 times and the oxymatrine content by 1.1 to 48.4 times, providing a new idea for cultivating high-content Sophora flavescens.
Smart Images

Figure CN119120500B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of crop genetic breeding, and relates to cultivating plants with high content of matrine and oxymatrine. BACKGROUND
[0002] Sophora tonkinensis Gagnep. Sophora tonkinensis Sophora tonkinensis Gagnep. is a dry root and rhizome of Sophora tonkinensis Gagnep. Sophora tonkinensis Gagnep. is bitter and cold in nature, toxic, and belongs to the lung and stomach channels, and has the effects of clearing heat, detoxifying, detumescing and analgesic, and has important medicinal value. According to the Pharmacopoeia of the People's Republic of China (2020 edition), matrine and oxymatrine are the main medicinal active ingredients, which have been proved to have anti-inflammatory, antibacterial, antioxidant, immunomodulatory and anticancer effects. However, the traditional breeding method limits the further improvement of the alkaloid content of Sophora tonkinensis Gagnep.
[0003] The NAC (NAM, ATAF, CUC) transcription factor family plays a key regulatory role in plant growth and development and stress response. Recent studies have shown that certain NAC transcription factors, such as OpNAC1, can target short short snake grass OpLAMT enzyme regulation of camptothecin synthesis and accumulation. The application with publication number CN101473037A discloses a NAC transcription factor with improved yield; the application with publication number CN113736793A discloses a transcription factor NAC that can improve the cold resistance of grape; the application with publication number CN115838760A discloses a transcription factor NAC that can significantly improve the flavonoid content in tea plants; it can be seen that the functions of NAC transcription factors in different plants are not the same, and the function of NAC transcription factors in Sophora tonkinensis Gagnep. is in the blank stage. SUMMARY
[0004] In order to study the function of NAC transcription factors in Sophora tonkinensis Gagnep., the present application discloses a transcription factor, protein and application thereof for positively regulating matrine and oxymatrine in plants, which solves the problem of low yield of matrine and oxymatrine in Sophora tonkinensis Gagnep., and provides a new idea for cultivating plants with high content of matrine and oxymatrine.
[0005] The technical solution of the present application is as follows:
[0006] The present application provides a transcription factor for positively regulating matrine and oxymatrine in plants, and the nucleotide sequence of the transcription factor has 90% similarity with the sequence shown in SEQ ID No. 1.
[0007] Further, the nucleotide sequence of the above-mentioned transcription factor is as shown in SEQ ID No. 1.
[0008] The protein encoded by the above-mentioned transcription factor has an amino acid sequence as shown in SEQ ID No. 2.
[0009] The application further provides a method for increasing the content of matrine and oxymatrine in plants, comprising the following steps: constructing a overexpression vector containing the transcription factor, and transforming the overexpression vector into a plant to be improved by a genetic transformation method to obtain a plant with high content of matrine and oxymatrine.
[0010] Further, the plant is Sophora flavescens or tobacco.
[0011] The application further provides a method for increasing the content of matrine and oxymatrine in plants, comprising the following steps: constructing a overexpression vector containing the transcription factor, and transforming the overexpression vector into a plant to be improved by a genetic transformation method to obtain a plant with high content of matrine and oxymatrine.
[0012] Preferably, the nucleotide sequence of the transcription factor is shown as SEQ ID No. 1.
[0013] Preferably, the overexpression vector is a plant overexpression vector.
[0014] Preferably, the genetic transformation method is an Agrobacterium transformation method, preferably a leaf disc method.
[0015] Preferably, the plant to be improved is Sophora flavescens or tobacco.
[0016] The application has the following beneficial effects:
[0017] 1. The application obtains a trans-Sophora flavescens tobacco plant through transgenic technology, and finds that the expression of StNAC46 can affect the biosynthesis of matrine and oxymatrine in Sophora flavescens. StNAC46 6. The overexpression of the gene can increase the content of matrine and oxymatrine in plants, and provides a new idea for cultivating Sophora flavescens with high content of matrine and oxymatrine. StNAC4 6. The overexpression of the gene can increase the content of matrine and oxymatrine in plants, and provides a new idea for cultivating Sophora flavescens with high content of matrine and oxymatrine. StNAC46 The transcription factor can increase the accumulation of matrine and oxymatrine in tobacco. StNAC46 The gene of Sophora flavescens is used as a target for regulating the content of matrine and oxymatrine in plants, and a new genetic improvement method is developed, which has important scientific and application values.
[0018] 2. The application constructs a overexpression vector of the gene of Sophora flavescens, and performs genetic transformation to confirm that StNAC46 The gene can increase the accumulation of matrine and oxymatrine in plants, and provides a new idea for cultivating Sophora flavescens with high content of matrine and oxymatrine. StNAC46 The gene can increase the accumulation of matrine and oxymatrine in plants, and provides a new idea for cultivating Sophora flavescens with high content of matrine and oxymatrine. BRIEF DESCRIPTION OF DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments or prior art description. Obviously, the drawings described below are only some embodiments of the present application, and all other drawings obtained by those of ordinary skill in the art without creative effort based on these drawings also belong to the protection scope of the present application.
[0020] Figure 1 It is agarose gel electrophoresis of total RNA extraction of Millettia pinnata (A) and StNAC46 gene amplification product (B); wherein A: M: DL2000 DNA Maker; 1: root total RNA band; 2: leaf total RNA band; B: M: DL2000 DNA Maker; 1: target gene band.
[0021] Figure 2 It is the restriction enzyme detection result of vector pBWA(V)HS-O-StNAC46; DNA Marker (MR IV): 5000, 3000, 2000, 1500, 750, 500, 250, 100 bp; EcorV restriction band: 5324, 2691, 1969, 1134 bp.
[0022] Figure 3 It is the vector map of pBWA(V)HS-O-StNAC46; vector eukaryotic resistance: Hygromycin, prokaryotic resistance: Kanamycin.
[0023] Figure 4 It is genetic transformation of Nicotiana benthamiana.
[0024] Figure 5 It is transgenic tobacco. StNAC46 Gene plant PCR detection.
[0025] Figure 6 It is the expression level analysis of target gene of transgenic tobacco. DETAILED DESCRIPTION
[0026] The technical solutions of the present application will be described clearly and completely below by combining the embodiments of the present application. Obviously, the described embodiments are only some embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort belong to the protection scope of the present application.
[0027] The experimental methods used in the following experimental examples are all conventional methods without special instructions; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels without special instructions.
[0028] The application provides a transcription factor for positively regulating matrine and oxymatrine in plants, and the nucleotide sequence of the transcription factor has 90% similarity with the sequence shown in SEQ ID No. 1.
[0029] Further, the nucleotide sequence of the transcription factor is shown in SEQ ID No. 1.
[0030] The protein encoded by the transcription factor is shown in SEQ ID No. 2.
[0031] The application further provides application of the transcription factor or the protein in increasing the content of matrine and oxymatrine in plants.
[0032] Further, the plant is Sophora flavescens or tobacco.
[0033] The application further provides a method for increasing the content of matrine and oxymatrine in plants, and the method comprises the following steps: constructing an overexpression vector containing the transcription factor, and introducing the overexpression vector into a plant to be improved by a genetic transformation method, so that a plant with high content of matrine and oxymatrine is obtained.
[0034] Preferably, the nucleotide sequence of the transcription factor is shown in SEQ ID No. 1.
[0035] Preferably, the overexpression vector is a plant overexpression vector.
[0036] Preferably, the genetic transformation method is a leaf disc method or an Agrobacterium transformation method.
[0037] Preferably, the plant to be improved is Sophora flavescens or tobacco.
[0038] The application provides a method for increasing the content of matrine and oxymatrine in Sophora flavescens. StNAC46 The application provides a method for increasing the content of matrine and oxymatrine in Sophora flavescens. StNAC46 The application provides a method for increasing the content of matrine and oxymatrine in Sophora flavescens.
[0039] Specifically, the following examples are used for detailed description: Example
[0040] I. Cloning of StNAC46 gene
[0041] 1) Extraction of RNA and synthesis of cDNA
[0042] Freeze the leaves and roots of Euchresta japonica Hance in liquid nitrogen and grind them into powder. Extract RNA using FastPure Universal Plant Total RNA Isolation Kit (Vazyme, Nanjing). Synthesize cDNA using Transscript One-Step gDNA Removal and cDNA Synthesis Super Mix TransScript (Quanxi Gold, Beijing) reverse transcription kit.
[0043] 2) StNAC46 Gene PCR amplification
[0044] Use the obtained Euchresta japonica Hance cDNA as a template to perform fragment amplification of the target gene.
[0045] Design a 50 μL reaction system: nuclease-free water 20 μL, high-fidelity enzyme 2×Phanta Max Buffer Mix 25 μL, forward primer (10 μM / L) 1.5 μL, reverse primer (10 μM / L) 1.5 μL, cDNA template 2 μL.
[0046] Forward primer: ATGGACAGCACAGATTCATCATC;
[0047] Reverse primer: TCAGTTCCAATTTATGCCTCCAAG.
[0048] The PCR amplification program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 55℃ annealing for 15 sec, 72℃ extension for 1.5 min, a total of 35 cycles, 72℃ re-extension for 5 min, and finally 16℃ storage.
[0049] 3) Gel recovery of target fragments
[0050] Use DNA gel reagent kit (B518131, Shenguo) for gel recovery.
[0051] 4) Connection of target fragments and cloning of vectors and transformation of E. coli
[0052] Connect the PCR-amplified StNAC46 gene with 5×TA / Blunt-Zero Cloning Mix vector, and then transform it into E. coli DH5α for 37℃ overnight dark culture.
[0053] 5) Identification of positive strains and sequencing
[0054] The strains were identified by PCR, and after ensuring the correct identification, they were sent to Biotechnology Co., Ltd. for sequencing. The PCR reaction system was nuclease-free water 8.2 μL, high-fidelity enzyme 2x Phanta Max Buffer Mix 25 μL, forward primer (10 μM / L) 0.4 μL, reverse primer (10 μM / L) 0.4 μL, cDNA template 1 μL. The amplification program was as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 sec, 58°C annealing for 15 sec, 72°C extension for 1 min, a total of 35 cycles, 72°C extension for 5 min, and finally 16°C storage.
[0055] The extracted total RNA of Sophorae tonkinensis was detected by PCR amplification and gel electrophoresis observation, and the obtained fragment met the expected size of the target gene Figure 1 B). After gel recovery, it was sent to Shanghai Jeli Biological Technology Co., Ltd. for sequencing. After sequencing and comparison by DNAMAN software, it was considered to be consistent with the coding sequence ORF sequence of the target gene. The StNAC46 sequencing and determining the length of 1083 bp. The nucleotide content was A (28.53%, 309), T (25.95%, 281), G (21.42%, 232), and C (24.10%, 261), and there was no unresolved nucleotide in the sequence.
[0056] II. Construction of pBWA(V)HS-O-StNAC46 overexpression vector and transformation of plants
[0057] 1) Construction of overexpression vector
[0058] ① The positive strains obtained by sequencing were subjected to positive plasmid extraction according to the instructions of the kit.
[0059] ② According to the nucleotide information of the gene obtained by sequencing, specific primers containing enzyme digestion sites were designed:
[0060] Forward primer: AACACGGGGGACTTTGCAACatggacagcacagattcatcatcatgctc;
[0061] Reverse primer: TGAAGACAGAGCTAGTTACAtcagttccaatttatgcctggaagttgaaattgttg;
[0062] and PCR amplification, and the positive plasmid was obtained. The extracted positive plasmid was double-digested, and the enzyme digestion verification result is shown in Figure 2 .
[0063] PCR reaction system as follows: nuclease-free water 20 μL, high-fidelity enzyme 2* Biorun Pfu PCR Mix 25 μL, NAC46(+) 2 μL, NAC46(-) 2 μL, cDNA 1 μL.
[0064] PCR amplification procedure as follows: 94℃ pre-denaturation 5 min, 94℃ denaturation 30 sec, 50℃ annealing 45 sec, 72℃ extension 65 sec, a total of 30 cycles, 72℃ re-extension 10 min, finally 16℃ preservation.
[0065] 1% agarose gel electrophoresis, 5v / cm voltage, 20 min, the electrophoresis fragment of StNAC46 (1083bp) is cut out under ultraviolet lamp, placed in a system for sol-gel recovery, dissolved in 40uL total volume of water to recover DNA, and the recovery product is labeled as: rDNAs, after detection, recombined with the vector.
[0066] Enzyme digestion and ligation system: nuclease-free water 13 μL, 10*Buffer 2 μL, BsaI / Eco31I 1 μL, pBWA(V)HS-ccdB 4 μL.
[0067] Enzyme digestion and ligation reaction conditions: 37℃ 1 hours.
[0068] Recombination reaction components: Biorun 2*EasyClone Mix 10 μL, rDNAs 5 μL, pBWA(V)HS-ccdB 5 μL.
[0069] Recombination reaction conditions: 37℃ 30 min.
[0070] 2) Plasmid transformation
[0071] The ligation product is transformed into E. coli DH5α competent cells, coated on LB (100 mg / mL Kana) solid medium, and incubated in a 37℃ incubator overnight. Single colonies are inoculated in LB (100 mg / mL Kana) liquid medium, and cultured at 37℃ for about 6 h. Bacterial liquid PCR is performed, and the primers for pBWA(V)HS- StNAC46 are as follows:
[0072] Forward primer: tTCATTTGGAGAGAACACGGGggac (2861bp);
[0073] Reverse primer: gagaaagttgacatcgtcgg (3503bp).
[0074] Take 1-3 positive bands corresponding to the bacterial liquid, take 100 μL for sequencing, and the sequencing result is 1083 bp. After sequencing, the overexpression recombinant plasmid containing the target gene is named pBWA(V)HS-O- StNAC46 , the schematic diagram of vector construction is shown in Figure 3 .
[0075] 3) Agrobacterium transformation of Nicotiana benthamiana
[0076] ① Pre-culture: In the clean bench, the tobacco seeds were soaked in 75% alcohol for 1 min, washed with sterile water for 3-5 times, 1 min / time; the sterilized tobacco seeds were sowed on MS medium and cultured in 25℃ tissue culture room for 4-5 weeks (16h light / 8h dark), the tender leaves of tobacco were cut into small pieces with a scalpel and inoculated on the pre-cultured medium (MS+7% agar+2.5% sucrose+0.2 mg / L NAA+1 mg / L 6-BA), the front of the leaf was downward, and about 10 leaf discs were placed in each bottle.
[0077] ② Infection and co-culture: the Agrobacterium collected from "4.2" was resuspended with MS resuspension solution (4.432 g / L MS+30 g / L sucrose), the OD600 of the resuspended Agrobacterium was adjusted to 0.2, the tobacco leaves pre-cultured for 2-3 days were inoculated in the Agrobacterium suspension for 10-15 min, the infected tobacco leaves were placed on sterile filter paper to absorb the residual bacterial solution, and then inoculated on the co-culture medium (MS+7% agar+2.5% sucrose+0.2 mg / L NAA+1 mg / L 6-BA+100 μM acetosyringone) with the back of the leaf facing down, and cultured in the dark for 48-72 h.
[0078] ③ Induction and selection: the co-cultured leaves were transferred to the induction medium to induce callus, and cultured at 23℃ with 16h light, and the medium was replaced every 2 weeks. The effective callus was selected and transferred to the selection medium corresponding to the resistance, and cultured for 15-30 d at 23±2℃;
[0079] ④ Differentiation and rooting: the positive callus after selection was transferred to the differentiation medium (MS+7% agar+2.5% sucrose+1 mg / L 6-BA+0.2 mg / L NAA+500 mg / L Cef+100 mg / L Kan), 4-5 calli per dish, and cultured at 23℃ with light for 15-30 d. During the differentiation process, the callus with seedlings was inoculated into the root induction medium (MS+7% agar+2.5% sucrose+0.2 mg / L NAA+500 mg / L Cef+100 mg / L Kana) for growth.
[0080] (5) Seedling transplanting: after the Nicotiana benthamiana root system developed completely, the seedlings were transplanted into the soil for cultivation after 1 day of seedling training, and the soil ratio was peat soil: perlite: vermiculite 3:1:1.
[0081] Three, StNAC46 Transgenic tobacco positive identification:
[0082] The 4-week-old aseptic Nicotiana benthamiana seedlings were used as materials, the pBWA(V)HS-O-StNAC46 plasmid was transformed into wild-type Nicotiana benthamiana by leaf disc method, and the infected tobacco leaves were dark cultured on the medium for 2-3 days. The tobacco leaves after dark culture induced callus. After the vigorous growing callus grew, it was transferred to the screening medium for differentiation, and tiny buds grew. The buds successfully transformed with pBWA(V)HS-O-StNAC46 could grow normally on the medium containing hygromycin (T0) Figure 4 ), and 6 T2 generation transgenic lines were screened, and PCR positive identification was performed:
[0083] The genomic DNA was used as a template, and the primer (481 bp) of the resistance marker gene hygromycin in the pBWA(V)HS-O- StNAC46 vector:
[0084] Forward primer: CTGCCCGCTGTTCTACAACCGG;
[0085] Reverse primer: GGAGCATATACGCCCGGAGTC;
[0086] The transgenic plants were detected to determine whether the constructed vector was transferred into tobacco. The seeds (T0) of the positive plants were continuously screened with hygromycin, and after the screened positive plants gradually grew and the root system developed, they were moved to the greenhouse for routine cultivation to obtain T1 generation seeds.
[0087] The harvested seeds (T1) were screened on 1 / 2 MS medium containing 50 mg / mL hygromycin, and then the positive plants were screened by PCR, and then cultured in the light tissue culture room to obtain T2 generation plants.
[0088] Negative control: the empty vector transgenic Nicotiana benthamiana without inserting the target fragment was used as a negative control.
[0089] The results are shown in Figure 5 : The transgenic plants appeared a fragment of about 500 bp, which was consistent with the amplification results of the resistance marker gene hygromycin, while no characteristic band was found in the wild-type tobacco (negative control) lane, which preliminarily proved that the foreign gene StNAC46 was integrated into the tobacco gene Figure 5 .
[0090] Four,StNAC46 Real-time fluorescent quantitative PCR identification of transgenic tobacco
[0091] In order to detect StNAC46 The T2 generation transgenic tobacco with positive PCR detection results was selected for overexpression in transgenic tobacco. The RNA of different tobacco strains and control N. benthamiana (WT) seedlings was extracted by Nuaidian RNA extraction kit, and real-time fluorescent quantitative PCR was performed.
[0092] N. benthamiana (N. Nicotiana benthamiana ) elongation factor gene (NbEF1α) as an internal reference gene.
[0093] The primer was used for real-time fluorescent quantitative PCR to detect the expression level of the target gene of different tobacco strains and control N. benthamiana seedlings. StNAC46
[0094] Forward primer: TCCTCTGGCTGCTGGTCCTC;
[0095] Reverse primer: TCTCCGTAGAAAGCTCCTTGTCATC.
[0096] The results (Fig. Figure 6 ) showed that the exogenous gene of transgenic plants was successfully expressed, but the expression level was different. Compared with the wild type (WT), the expression level of OE-1, OE-3, OE-4 and OE-6 was significantly improved.
[0097] After antibiotic screening, PCR detection and qRT-PCR detection, transgenic tobacco with stable exogenous gene and successful expression was finally obtained.
[0098] Five, StNAC46 Effect of overexpression on alkaloid content of plants
[0099] Three transgenic tobacco strains OE-1, OE-3 and OE-6 with high expression of target genes and wild type plants (WT) were selected, and ESI-HPLC-MS / MS method was used to determine the content of matrine and oxymatrine. The results are shown in Table 1.
[0100] Table 1 Analysis of matrine and oxymatrine content in transgenic tobacco
[0101]
[0102] From Table 1, we can know that: StNAC46 The matrine content of transgenic tobacco OE-1, OE-3 and OE-6 was 2.78, 2.86 and 27.20 ng / g, respectively, and the oxymatrine content was 5.74, 5.94 and 253.04 ng / g, respectively.Figure 6 As shown in Table 2, compared with wild type plants (WT), the matrine in StNAC46 overexpression lines increased by 1.3-13.0 folds, and the oxymatrine increased by 1.1-48.4 folds. It is indicated that StNAC46 The transcription factor can improve the accumulation of matrine and oxymatrine in tobacco.
[0103] The above merely describes preferred embodiments of the present application but not to limit the present application, any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A method for positively regulating the transcription factors of matrine and oxymatrine in plants, characterized in that: The nucleotide sequence of the transcription factor is shown in SEQ ID No.
1.
2. The protein encoded by the transcription factor according to claim 1, whose amino acid sequence is shown in SEQ ID No.
2.
3. Use of the transcription factor according to claim 1 or the protein according to claim 2 for increasing the content of matrine and oxymatrine in plants, characterized in that: The plant is tobacco.
4. A method for increasing the content of matrine and oxymatrine in plants, characterized in that: The method comprises the following steps: constructing an overexpression vector containing the transcription factor according to claim 1, and transferring the vector into a plant to be improved by genetic transformation to obtain a plant with high matrine and oxymatrine content; the plant is tobacco.
5. The method for increasing the content of plant matrine and oxymatrine according to claim 4, characterized in that: The overexpression vector is a plant overexpression vector.
6. The method for increasing the content of plant matrine and oxymatrine according to claim 5, characterized in that: The genetic transformation method is Agrobacterium transformation.
Citation Information
Patent Citations
Plants with modulated expression of NAC transcription factors having enhanced yield-related traits and a method for making the same
CN101473037A
NAC transcription factor gene VaNAC08 and application thereof
CN113736793A
Plasmid containing tea tree NAC transcription factor CsNAC002 gene and application thereof
CN115838760A
Application of vietnamese sophora root polysaccharide extract in protection and treatment on liver injury caused by acetaminophen
CN104224822A
EjNAC1 gene related to loquat fruit development as well as encoding protein and application of EjNAC1 gene
CN118652314A