An Indel molecular marker for identifying Arisaema amurense and Arisaema sikokianum
By developing the Indel molecular markers of Northeast South Star and Nasalus, using high-throughput sequencing and PCR technology, the problem of distinguishing between Northeast South Star and Nasalus was solved, and a fast and simple identification method was achieved to ensure the accuracy of the management of Chinese medicinal materials and germplasm resources.
Patent Information
- Application Number
- CN202310905833.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-24
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2043-07-24
AI Technical Summary
The existing technology is difficult to effectively distinguish between the Northeast South Star and the Lantern Floral, which leads to mistakenly treating the Lantern Floral as the Northeast South Star as the medicine, affecting the quality of Chinese medicinal materials and the management of germplasm resources.
A kind of Indel molecular marker was developed to design primers using 143bp insertion sequences of the Northeast South Star and Lancet genomes through high-throughput sequencing and PCR technology to achieve the distinction between the two.
It has achieved rapid, simple and effective distinction between Northeast South Star and Lantern Festival, ensuring the accuracy of Chinese medicinal materials and the management of germplasm resources, and supporting planting, breeding and resource utilization.
Smart Images

Figure CN119120748B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to Indel molecular markers for identifying Arisaema confusa and Echeveria caerulea and applications thereof. Background Art
[0002] Arisaema amurense Maxim. and Arisaema bockii Engler. are both perennial herbs of the genus Araceae in the family Araceae. Arisaema amurense Maxim. is one of the authentic origins of the Araceae medicinal material specified in the Chinese Pharmacopoeia. According to the description of the identification points of the two species in the Flora of China, Arisaema amurense Maxim. has one leaf and Arisaema bockii Engler. has two leaves. However, in field observations of Arisaema amurense and Arisaema bockii Engler., it was found that Arisaema amurense often has two leaves, and Arisaema bockii Engler also often has one leaf. Both have short-stalked rod-shaped appendages, and the leaves are bird-toed compound leaves ( Figure 1 ).
[0003] Therefore, it is difficult to distinguish the two according to the description in Flora of China, so that the single-leaf type of Asterix lanceolata was mistakenly included in Flora of Anhui as Asterix lanceolata. It can be seen that professionals may make mistakes in distinguishing Asterix lanceolata from Asterix lanceolata according to traditional taxonomy, which may lead to Asterix lanceolata being mistakenly used as medicine for Asterix lanceolata. Therefore, it is necessary to find new ways to distinguish the two, among which molecular identification is a relatively fast and reliable identification method nowadays. By developing molecular markers to identify Asterix lanceolata and Asterix lanceolata, it can provide important basis for the management of germplasm resources of the two and the formulation of Chinese medicinal materials for medicine. Summary of the invention
[0004] The present invention mainly aims at the above technical problems, provides a simple molecular marker method to achieve identification and differentiation of Arisaema confusa and Aster fasciata, and specifically provides an Indel molecular marker for identifying Arisaema confusa and Aster fasciata and its application.
[0005] Specifically, the present invention provides the following technical solutions:
[0006] In a first aspect, the present invention provides an Indel molecular marker for identifying and distinguishing Arisaema confusa and Acanthus fasciatus. The Indel molecular marker is the base sequence at positions 495-637 of SEQ ID NO.1, which can be amplified by the primer pair shown in SEQ ID NO.3-12.
[0007] The present invention uses high-throughput sequencing to assemble genomic contigs from the whole genome sequences of *Arisaema amurense* and *Arisaema sikokianum*, and compares the genomic contigs of *Arisaema amurense* and *Arisaema sikokianum*. Compared with *Arisaema sikokianum*, there is an insertion of 143 bp in the genome of *Arisaema amurense*. This sequence is relatively long and is speculated to be used as an Indel molecular marker. *Arisaema amurense* and *Arisaema sikokianum* can be identified and distinguished by conventional PCR and agarose gel electrophoresis.
[0008] Furthermore, primers are designed for the above insertion sequence so that the above insertion sequence is included within the primer amplification product.
[0009] Samples of *Arisaema amurense* and *Arisaema sikokianum* with different numbers of leaves are selected, and PCR amplification is performed using the designed primers.
[0010] The electrophoresis results show that the length of the PCR product of *Arisaema amurense* (in sample wells 1-6) is significantly longer than that of *Arisaema sikokianum* (in sample wells 7-12), which is consistent with the expectation and is independent of the number of leaves of the species.
[0011] In another embodiment, any DNA or RNA fragment containing the above Indel molecular marker sequence can be used as an identification molecular marker for identifying and distinguishing *Arisaema amurense* and *Arisaema sikokianum*.
[0012] In the second aspect, the present invention provides primers for amplifying the above Indel molecular marker, and the amplification product sequence of the primers contains the above Indel molecular marker sequence.
[0013] In a preferred embodiment, the primers of the present invention include at least one forward primer and one reverse primer sequence shown in SEQ ID NO.3-SEQ ID NO.12, preferably the primer sequences shown in SEQ ID NO.3 and SEQ ID NO.8.
[0014] In the third aspect, the present invention provides a kit containing the above primers.
[0015] In the fifth aspect, the present invention provides any one of the following applications of the above Indel molecular marker, primer or kit:
[0016] (1) Application in identifying *Arisaema amurense* and *Arisaema sikokianum*;
[0017] (2) Application in the identification, improvement or molecular marker-assisted breeding of germplasm resources of *Arisaema amurense* and *Arisaema sikokianum*;
[0018] (3) Application in screening or creating different varieties of *Arisaema amurense* and *Arisaema sikokianum*;
[0019] (4) Application in constructing the DNA fingerprint database of *Arisaema amurense* and *Arisaema sikokianum*;
[0020] (5) Applications in the quality detection of the seedlings of *Arisaema amurense* and *Arisaema sikokianum* Franch. et Sav.
[0021] By using the single Indel molecular marker of the present invention, it is possible to simply and effectively distinguish whether the variety to be tested is *Arisaema amurense* or *Arisaema sikokianum* Franch. et Sav., providing guarantee for the identification, cultivation, resource utilization and breeding of *Arisaema amurense* and *Arisaema sikokianum* Franch. et Sav. It is also of great significance for the study of the classification, phylogeny, phylogeography of the Araceae species, as well as the protection and utilization of the Araceae resources, etc. Description of the Drawings
[0022] Figure 1 Samples of *Arisaema amurense* and *Arisaema sikokianum* Franch. et Sav. with different numbers of leaves; among them, A is *Arisaema sikokianum* Franch. et Sav. with two leaves, B is *Arisaema sikokianum* Franch. et Sav. with one leaf, C is *Arisaema amurense* with two leaves, and D is *Arisaema amurense* with one leaf.
[0023] Figure 2 It is the result of high-throughput sequencing assembly and comparative analysis, showing the Indel molecular markers obtained for *Arisaema amurense* and *Arisaema sikokianum* Franch. et Sav.; among them, sequence 1 is *Arisaema amurense*, and sequence 2 is *Arisaema sikokianum* Franch. et Sav.
[0024] Figure 3 It is the electrophoresis picture of the PCR products amplified from 6 samples of *Arisaema amurense* (3 for each of the two leaf numbers) and 6 samples of *Arisaema sikokianum* Franch. et Sav. (3 for each of the two leaf numbers) by using SEQ ID NO.3 - 4, where M is the marker, 1 - 3 are *Arisaema amurense* with two leaves, 4 - 6 are *Arisaema amurense* with one leaf, 7 - 9 are *Arisaema sikokianum* Franch. et Sav. with two leaves, and 10 - 12 are *Arisaema sikokianum* Franch. et Sav. with one leaf. Detailed Embodiments
[0025] In order to make the objectives, technical solutions and beneficial technical effects of the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the following embodiments are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention. The experimental methods used in the following embodiments are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0026] The plant samples of *Arisaema amurense* and *Arisaema sikokianum* Franch. et Sav. used in the following embodiments can be obtained through commercial purchase or collected from the wild.
[0027] Example 1 Collection of *Arisaema amurense* and *Arisaema sikokianum* Franch. et Sav.
[0028] The *Arisaema amurense* and *Arisaema sikokianum* Franch. et Sav. of the present invention are respectively collected from Jilin City, Jilin Province and Lu'an City, Anhui Province.
[0029] Example 2 Development of Specific Molecular Markers for Arisaema amurense and Arisaema sikokianum
[0030] The specific molecular marker, namely the Indel molecular marker, for distinguishing Arisaema amurense and Arisaema sikokianum is obtained through the following steps:
[0031] 1) Collect the leaves of Arisaema amurense and Arisaema sikokianum;
[0032] 2) Extract the total DNA from the leaves of Arisaema amurense and Arisaema sikokianum;
[0033] 3) Perform second-generation high-throughput sequencing on the above total DNA to obtain sequencing reads;
[0034] 4) Assemble the genomes of Arisaema amurense and Arisaema sikokianum to obtain genomic contig sequences.
[0035] 5) Compare the genomic contigs of Arisaema amurense and Arisaema sikokianum to obtain insertion-deletion fragments, namely Indel molecular markers.
[0036] The results are shown in Figure 2 , compared with Arisaema sikokianum, there is an inserted sequence of 143 bp in the genome of Arisaema amurense. This sequence is relatively long and is speculated to be used as an Indel molecular marker to identify and distinguish Arisaema amurense and Arisaema sikokianum through conventional PCR and agarose gel electrophoresis.
[0037] The 143-bp inserted sequence in the genome of Arisaema amurense is as follows. The underlined part of SEQ ID NO.1 is the inserted fragment unique to Arisaema amurense, and the homologous region sequence in the corresponding genome of Arisaema sikokianum is shown as SEQ ID NO.2. The short line '-' represents the fragment deleted in the homologous region of the Arisaema sikokianum genome relative to the Arisaema amurense gene:
[0038] 5’-GCCGAAAAGAACGAGCATCCTTATGTATTTGCATATATCTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATAT ACAAGATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTTGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCTCAACCCAAGGGAGGGTATCTTCCACTGGTCCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTTCGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAAATCATAATCATATTAAATCATAAGAAATC ATATATATAAATCATAAATCATAATA AATCATATTCATATACATATTCATATAATCATATATATAATATATATAATAAATCATAATCATATATAAATCATAT CATATATAAATCATATTAAATCATATATAAATCATATTCAT ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACAACACAAAAAAAAATTATTTCTTTCAATACTCATTCGTATTAGTTAACGATCCAAACGGCTGGATCCATATGCTTAATTCTGATACGAAATCAAATAGTAAAATAATTATTCATCGAATGACTATTCATCCATTATATTTTCAAATAAGGCGCGGGAAGATTCTATG-3’(SEQ ID NO.1)
[0039] 5’-GCCGAAAAGAACGAGCATCCTCATGTATTTGCATATATCTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATATACAAG ATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTGGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCTCAACCCAAGGGAGGGTATCTTCCACCGGTCCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTTCGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAAATCATAATCATATTAAATCATAAGAAATC-----------------------------------------------------------------------------------------------------------------------------------------------ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACAACACAAAAAAAAATTATTTCTTTCAATA CTCATTCGTATTAGTTAACGACCCAAACGGCTGGATCCATATGTTTAATTCTGATACGAAATCAAATAGTAAAATAATTATTCATCGAATGACTATTCATCCATTATATTTTCAAATAAGGCGCGGGAAGATTCTATG-3’(SEQ ID NO.2)
[0040] Example 3 Primer Design for Specific Molecular Markers of Arisaema amurense and Arisaema sikokianum
[0041] According to the comparison results in Example 2, combined with the corresponding contigs sequences, multiple pairs of PCR primers for identifying *Arisaema amurense* and *Arisaema sikokianum* were designed using Geneious software, and the primer sequences are as follows:
[0042] Forward primer TM-4F1: 5'-GCCGAAAAGAACGAGCATCC-3' (SEQ ID NO.3)
[0043] Forward primer TM-4F2: 5'-CCGCTGCTTGTGAGATTTGG-3' (SEQ ID NO.4)
[0044] Forward primer TM-4F3: 5'-TGAGCCGAAAAGAACGAGCA-3' (SEQ ID NO.5)
[0045] Forward primer TM-4F4: 5'-TATACAGAATGCGCAGGGGC-3' (SEQ ID NO.6)
[0046] Forward primer TM-4F5: 5'-CGTTCCGTGTCGTGTTCCTA-3' (SEQ ID NO.7)
[0047] Reverse primer TM-4R1: 5'-CATAGAATCTTCCCGCGCCT-3' (SEQ ID NO.8)
[0048] Reverse primer TM-4R2: 5'-TGGGGATCCAGGGTCTCATT-3' (SEQ ID NO.9)
[0049] Reverse primer TM-4R3: 5'-TTGTGTTGTGGGGATCCAGG-3' (SEQ ID NO.10)
[0050] Reverse primer TM-4R4: 5'-TCCATAGAATCTTCCCGCGC-3' (SEQ ID NO.11)
[0051] Reverse primer TM-4F5: 5'-TCTTCCCGCGCCTTATTTGA-3' (SEQ ID NO.12)
[0052] Example 4 Identification of *Arisaema amurense* and *Arisaema sikokianum*
[0053] 1) Leaves of *Arisaema amurense* and *Arisaema sikokianum* plants were collected separately as samples to be detected, with 3 double-leaf and single-leaf samples for each of the two plants;
[0054] 2) Total DNA of the samples to be detected was extracted;
[0055] 3) Using the primers (TM-4F1 and TM-4R1) designed in Example 3, perform PCR on the total DNA of the above samples respectively;
[0056] The PCR amplification reaction system is 25 μL, including 12.5 μL of 2×PhantaMax Master Mix, 1 μL each of the upstream primer (10 μM) / downstream primer (10 μM), 200 - 300 ng of DNA template, and supplemented with ddH2O to 25 μL. 2×PhantaMax Master Mix contains PhantaMax Super-Fidelity DNA Polymerase, dNTP, protective agent, and buffer system;
[0057] The PCR amplification program is as follows: ① Pre-denaturation at 95 °C for 3 min; ② Denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, extension at 72 °C for 75 s, for 35 cycles; ③ Extension at 72 °C for 5 min; 4) Detection of PCR amplification products:
[0058] The PCR products are detected by 1% agarose gel electrophoresis, stained with 10×Loading Buffer and loaded, and the PCR amplification is observed under a gel imaging system, with clear main bands.
[0059] It can be seen from the electrophoresis diagram ( Figure 3 ) that the length of the PCR products of Arisaema amurense (in sample wells 1 - 6) is significantly longer than that of Arisaema sikokianum (in sample wells 7 - 12), which is in line with expectations. It can be seen that the aforementioned Indel molecular marker and corresponding primers can be used for conventional PCR gel electrophoresis to achieve simple and effective identification and differentiation of Arisaema amurense and Arisaema sikokianum.
[0060] In summary, first of all, the present invention is a powerful supplement to traditional species identification, and the sample identification process is effective, capable of realizing automation and standardization, breaking through the excessive dependence on experience, and can use fresh or dried leaves of plants, such as specimen samples, for rapid and effective identification, and can establish an easy-to-use application system in a relatively short time. Finally, the method of the present invention is of great significance for the classification, phylogeny, phylogeography research of Araceae species, as well as the protection and utilization of Arisaema resources, etc.
[0061] According to the disclosure and teaching of the above specification, those skilled in the art to which the present invention pertains can also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the protection scope of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for convenience of description and do not constitute any limitation to the present invention.
Claims
1. An Indel molecular marker for identifying and differentiating Arisaema amurense Maxim. and Arisaema sikokianum Franch. var. serratum (Makino) Hand.-Mazz., characterized in that, The Indel molecular marker has an Indel at positions 495 - 637 of SEQ ID NO.
1. The genotype of the Indel molecular marker in the genome of *Arisaema amurense* is as shown in SEQ ID NO.1, and the genotype in the genome of *Arisaema sikokianum* is as shown in SEQ ID NO.
2.
2. Primers for identifying and differentiating Arisaema amurense and Arisaema sikokianum, characterized in that, The primers are SEQ ID NO.3 and SEQ ID NO.
8.
3. A kit containing the primers according to claim 2.
4. Use of the primer according to claim 2 or the kit according to claim 3 in identifying and differentiating Arisaema amurense Maxim. and Arisaema sikokianum Franch. Hance var. serratum (Makino) Hand.-Mazz., characterized in that, The amplified product sequence of the primers or the kit is as shown in SEQ ID NO.1 in *Arisaema amurense*, and the amplified product sequence of the primers or the kit is as shown in SEQ ID NO.2 in *Arisaema sikokianum*.
Citation Information
Patent Citations
PCR primer pair and method for identifying arisaema erubescens by utilizing same
CN103993009A
Fluorescent PCR detection kit for identifying four kinds of Araceae medicinal plants, and application
CN108977571A