Molecular marker closely linked with major QTL (quantitative trait loci) at tillering angle of highland barley and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with a major QTL (quantitative trait loci) of the tillering angle of highland barley and application, and belongs to the field of genetic engineering, the molecular marker is an SNP (single nucleotide polymorphism) marker, the SNP marker is positioned on a 7H chromosome of the highland barley and is positioned at the 251 site of a nucleotide sequence as shown in SEQ ID No.1, the base of the site has C / T polymorphism, when the genotype of the site is CC, the highland barley has a larger tillering angle, and when the genotype of the site is CC, the highland barley has a larger tillering angle. The genotype is TT, and highland barley has a small tillering angle. The invention discloses a genetic factor for regulating and controlling the tillering angle of highland barley, and lays a foundation for genetic improvement and molecular design breeding of the tillering angle character. The SNP marker TA10 disclosed by the invention can be used for correctly genotyping in an RIL (Research Institute of Ligand) group, and effectively assists in selecting strains with a large tillering angle (C: C) and a small tillering angle (T: T).

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to a molecular marker closely linked to a major effect QTL of barley tillering angle and its application. Background Art

[0002] Highland barley (Hordeum vulgare var.coeleste L., 2n=14; HH) is naked barley. The yield of gramineous crops is affected by many factors, among which the relationship between plant type and yield is particularly close, and the plant type is jointly determined by traits such as plant height, number of tillers and tiller angle. The tiller angle is the angle between the outermost tiller of gramineous crops such as rice, wheat and barley and the vertical line, reflecting the looseness of the crop plant type. Too large or too small tiller angle affects the crop's ventilation and light transmission, light interception efficiency and resistance to pests and diseases, and determines the effective planting density and yield per unit area within the crop population. Therefore, choosing a moderate and compact tiller angle is the core agronomic trait that breeders have long selected, and is also the key to achieving high crop yields.

[0003] Tillering angle is a hot topic and difficulty in the study of plant type of Gramineae crops. As a complex quantitative trait, it is regulated by genetic genes, environmental factors and cultivation conditions. Its research progress is slower than other plant type related traits such as plant height and tiller number. In barley, the existing reports mainly focus on the study of tillering angle in the seedling stage, while there are few reports on tillering angle after the adult stage. TALAMè et al. identified three QTLs related to the tillering angle of barley seedlings, which are located on chromosomes 1H, 3H and 6H, respectively. Among them, the QTL on 3H is located in the same region as the semi-dwarf gene sdw / denso that controls the creeping growth of barley. Zhou Yi used the F1 formed by the hybridization of barley mutant 'VV-HD' (creeping growth) and wild barley 'Buloke' (upright growth) to construct a DH population after anther in vitro culture. He identified the gene locus controlling the creeping growth of barley on barley chromosome 3H and limited it to a candidate segment of about 4Mb. Zhou Hong used the Middle Eastern wild barley material 'AWCS276' and barley cultivars 'Morex' and 'Baudin' to construct two RIL (Recombinant Inbred Lines, RIL) populations (MARILs and BARILs), respectively. A total of 6 QTLs controlling tillering angle were identified in the two populations. Among them, TA-MA-2H identified in MARILs is a major effect QTL stably expressed in multiple environments, explaining 16.77% of the phenotypic variation.

[0004] Relatively speaking, the genetic research on rice tiller angle is relatively in-depth. In rice, researchers used genetic positioning and genome-wide association analysis GWAS (Genome Wide Association Studies, GWAS) of F2 (Intercross, F2), DH (Doubled Haploid, DH), BC (Back Crossing, BC), CSSL (Chromosome Segment Substitution Lines, CSSL) and RIL populations to detect the quantitative trait loci (QTL) controlling rice tiller angle, including QTa1, QTa2, QTa5, QTa8, qTA-9a, qTA-9b, qTA-12, tt2.1, tt5.1, tt9.1, QTa8-2, QTa9-2, Ta, qTA8a and qTA3, explaining 2.7% to 47.5% of the phenotypic variation. Then, the TAC1 (Tiller Angle Control Gene) controlling the rice tiller angle was cloned through the constructed secondary positioning population map. 1), LPA1 (Loose Plant Architecture 1), OsLAZY1 (LA1) and PROG1 (PROSTRATEGROWTH 1). Yu et al. (2007) used a large F2 population to positionally clone TAC1 on rice chromosome 9 and confirmed that the 3' end base mutation in the intron caused abnormal mRNA splicing, which affected the gene transcription level and reduced the tillering angle, ultimately making the rice plant compact and upright. Wu et al. (2013) used an F2 population to positionally clone LPA1 on rice chromosome 3 and confirmed that T-DNA insertion in the exon caused premature termination of LPA1 transcription. This gene belongs to IDD

[0005] (INDETERMINATE DOMAIN) protein family, with a typical Cys-2 / His-2 zinc finger structure, regulates tillering angle and stem geotropism by affecting the deposition rate of starch plasmids. Li et al. (2007) cloned LAZY1 on rice chromosome 11 and confirmed that the mutation of LAZY1 led to enhanced polar auxin transport capacity in plants, changes in the distribution of endogenous auxin at the stem tip, weakened gravitropism, and ultimately increased rice tillering angle and loose plant type. Wu et al. (2018) confined PROG1 to a segment of about 8.9Kb on rice chromosome 7, in which there is a 110Kb sequence deletion. This deletion, as a rice structural domestication RPAD (RICE PLANT ARCHITECTURE DOMESTICATION) site, promotes the key transition from creeping growth of wild rice to upright growth of cultivated rice. At present, there is no report on the study of tillering angle of highland barley. Summary of the invention

[0006] The technical problem to be solved by the present invention is: how to provide a molecular marker of a major effect QTL related to the tillering angle of highland barley and its application.

[0007] The technical solution of the present invention is: a method for assisting in predicting the tillering angle trait of highland barley, detecting the nucleotide at position 41790765 of highland barley 7H chromosome, and judging by the genotype of the site: if the genotype is CC, it has a larger tillering angle, and if the genotype is TT, it has a smaller tillering angle, and the reference genome version is barley IBSC_v2.

[0008] The invention discloses an application of a SNP marker in detecting the prediction of the tillering angle trait of highland barley or assisting breeding. The SNP marker is located on the highland barley chromosome 7H, at position 251 of the nucleotide sequence shown in SEQ ID No.1. The base of the site has a C / T polymorphism. When the genotype of the site is CC, the highland barley has a larger tillering angle, and when the genotype is TT, the highland barley has a smaller tillering angle.

[0009] A reagent for detecting the polymorphism or genotype of the SNP marker.

[0010] Furthermore, the reagent is a KASP primer, which consists of forward primers F1, F2 and a reverse primer R, the nucleotide sequence of the forward primer F1 is shown in SEQ ID No.2, the nucleotide sequence of the forward primer F2 is shown in SEQ ID No.3, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No.4.

[0011] A kit, characterized in that it contains the KASP primers described above.

[0012] The present invention uses the RIL population constructed with highland barley varieties 'Dazhang Zi' (loose plant type) and 'Kunlun No. 10' (compact plant type) as parents as materials, and based on high-density genetic maps, QTL positioning of highland barley tillering angle is carried out in multiple environments, and the identified major effect QTL qTA7H-1 is finely positioned using the remaining heterozygous lines derived from the RIL population. qTA7H-1 is defined within a physical interval of about 9.54Mb between PC08 (32,252,397) and PA10 (41,790,765). The qTA7H-1 flanking marker PA10 is closely linked to it, and PA10 is located at position 41790765 of highland barley chromosome 7H, with T / C polymorphism. The prediction of highland barley tillering angle can be achieved by detecting the genotype of this site.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention discloses the genetic factors regulating the tillering angle of highland barley, laying a foundation for the genetic improvement and molecular design breeding of tillering angle traits. The SNP marker TA_10 of the present invention can correctly genotype in the RIL population and effectively assist in selecting strains with large tillering angle (C:C) and small tillering angle (T:T). BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Schematic diagram of measuring tillering angle of highland barley;

[0016] Figure 2 Distribution characteristics of tillering angle phenotypes of DZZ / KL10 recombinant inbred lines, parents and F1 under three environments;

[0017] Figure 3 Fine mapping of the major QTL qTA7H-1 for tillering angle in highland barley;

[0018] Figure 4 Genotyping and significance analysis of tillering angle phenotype of TA_10RIL population. DETAILED DESCRIPTION

[0019] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0020] 1 Materials and methods

[0021] 1.1 Test materials

[0022] The highland barley variety 'Dazhang Zi' was used as the female parent and 'Kunlun No. 10' was used as the male parent to obtain the F1. After seven generations of continuous self-pollination using the single-seed method, 117 families of F1 were obtained. 7:8Recombinant inbred lines. 'Dazhang Zi' is a farmer's highland barley variety with a loose plant structure and a large tillering angle, while 'Kunlun No. 10' is a major highland barley variety with a compact plant structure and a small tillering angle. The two have significant differences in tillering angles.

[0023] 1.2 Field trials

[0024] The test materials were planted in Yuanmou, Yunnan (101°35′E, 25°23′N), Xining, Qinghai (101°77'E, 36°62′N) and Menyuan, Qinghai (101°62′E, 37°38′N) in 2022 and 2023, respectively. RILs, parents and F1 were planted in one row each, with 8 plants per row. The row length was 1m and the row spacing was 0.25m in the Yunnan environment, and the row length was 1.5m and the row spacing was 0.2m in the Qinghai environment. The soil fertility, fertilization, irrigation, insect control and weeding of the experimental fields were basically the same, and the field management was the same as general field production.

[0025] 1.3 Phenotypic determination and data analysis

[0026] The tillering angle is defined as the angle formed between the outermost tillers of the entire plant. The measurement method refers to the methods of He Jiwai (2016) and Zhao Dehui (2020) on rice and wheat with slight modifications. The tillering angle of highland barley gradually increases after heading, and the tillering angle is the largest 15 days after heading, and remains basically unchanged until maturity. There are 8 lines in each row of RILs, parents and F1. In order to eliminate the data measurement error caused by the marginal effect of plants on both sides of the row, the middle 5 plants in each row are measured, and the average value represents the phenotypic data of each row. The tillering angle measurement period is carried out 15 days after the heading of the plant. We first mark the two points (b and c) of the two outermost tiller stalks of the plant extending 30 cm from the base. Secondly, connect the two points and measure the straight line width (a), that is, the distance between the two outermost stalks. Finally, the three sides of the isosceles triangle are delineated, and the cosine theorem cosA=(b 2 +c 2 -a 2 ) / 2bc, find the cosine value of the vertex angle A, then use the arc cosine function to find the radian value of the vertex angle A, and convert the radian value into the corresponding angle, and finally get the tiller angle TA (TA), the calculation formula is:

[0027] TA=DEGREES[Acos(cosA)]( Figure 1 ).

[0028] SPSS21.0 software was used to perform descriptive statistics and variance analysis on the tillering angle phenotypic traits of the parents and RIL populations. 2 =σ 2 G / (σ 2G +σ 2 GE / n+σ 2 E / nr)×100%, where σ 2 G is the genetic variance, σ 2 E is the environmental variance, σ 2 GE is the interaction between gene and environment and the error variance, n is the number of environments, and r is the number of replications for each environment.

[0029] The results showed that the tillering angle of 'DZZ' was 40.01-64.48, and the tillering angle of 'KL10' was 27.19-32.74. 'DZZ' was greater than 'KL10', and there were significant differences in the environments of Yuanmou, Yunnan (2022YM), Menyuan, Qinghai (2023MY) and Xining, Qinghai (2023XN) (P<0.05). The tillering angle of the RIL population in the three environments ranged from 15.97 to 83.77, and the absolute values ​​of kurtosis and skewness were close to 1, showing continuous distribution and obeying normal distribution, showing a genetic model of quantitative traits ( Figure 2 ).

[0030] 1.4 Genetic map construction and QTL positioning

[0031] Individual genomic DNA libraries of 117 RILs and their parents were constructed and paired-end 150 bp (PE150) sequencing was performed using the Illumina HiSeq platform. Raw reads were obtained by base calling analysis and clean reads were obtained by filtering. The sequencing data were compared with the barley reference genome (IBSC_v2,

[0032] The BAM file was obtained by comparison with the genotyped DNA sequence of hordeum vulgare (https: / / ftp.ensemblgenomes.org / pub / plants / release-50 / fasta / hordeum_vulgare / dna / ), and then the variant sites were detected using GATK (version 3.7) software to obtain SNP (Single Nucleotide Polymorphism, SNP) and InDel (Insertion Deletion Length Polymorphism, InDel). The 117 RILs were genotyped according to the method of Xie et al. (2010), and the recombination rate between markers was evaluated using MSTMap software. Then, the genetic distance between markers was calculated using the Kosambi mapping function to construct a high-density genetic linkage map. The markers in the genetic map are all represented by bin markers: based on SNP typing, the parental origin of the chromosome segment of the RIL population is determined. When the parental origin changes, the place where the change occurs is the recombination breakpoint. The breakpoints on each chromosome are a block. The chromosomes of all samples are linearly compared, and the chromosomes of all RIL samples are divided into several regions with each recombination breakpoint as the boundary. Each region is a bin.

[0033] Using simplified genome sequencing data, a high-density genetic linkage map was constructed after filtering, screening and de-redundancy. The total length of the map is 1140.621cM, including 246,247 SNP markers, 1,369 bin markers, and the average genetic distance between markers is 0.849cM, covering 7 chromosomes of highland barley. The number of bin markers distributed on the 7 chromosomes is 185, 234, 230, 143, 209, 151 and 217, respectively, and the linkage lengths are 148.472cM, 177.321cM, 181.153cM, 128.204cM, 165.557cM, 153.546cM and 186.368cM, respectively. The collinearity analysis of the position of the markers on the genome and the genetic map showed that the order of most markers on each linkage group is consistent with the genome, with good collinearity, and the calculation accuracy of the genetic recombination rate is high.

[0034] QTL detection was performed using the Composite Interval Mapping (CIM) method in Windows QTL Cartographer V2.5 software, and the LOD threshold was determined by 1000 permutation tests. QTL naming followed the principles of McCouch et al. (1997), and all QTLs on the same chromosome were sorted according to the genetic position information on the chromosome, such as qTA1H-1, q represents QTL, TA represents the tillering angle trait, and 1H-1 represents the first QTL on chromosome 1 of highland barley. If QTLs have the same or overlapping marker intervals, they are designated as the same QTL. QTLs with a contribution rate of more than 10% are identified as major effect QTLs, and QTLs detected in at least two environments are environmentally stable consistent QTLs.

[0035] The results showed that QTL qTA7H-1 was a stable and consistent locus detected repeatedly in multiple environments, explaining an average phenotypic contribution of 17.46%. It was a major effect locus, and its additive effect was negative in both environments. The reduced effect locus came from 'KL10', which could reduce the tillering angle (Table 1).

[0036] Table 1qTA7H-1 localization information

[0037]

[0038] 1.5 Verification analysis of major QTL

[0039] Using the Inclusive Composite Interval Mapping (ICIM) method in QTL IciMapping V4.1, the LOD threshold was set to 2.0, combined with the phenotypic values ​​of extreme single plants (15% to 18%) in the RIL population of the three environments, further verification and analysis of the major effect QTL was performed based on the linkage map. Target-seq technology was used to obtain the genotype data of the secondary mapping population: DNA sample detection of extreme population single plants, design of target site-specific primers, PCR capture of target sites, connection of adapters, pooling and purification, library quality control and sequencing. Among them, Primer3 software was used to design amplification primers for each target site: the length of the primer sequence was between 17-32bp, the Tm value was between 60-64℃, the product size did not exceed 500bp, the sequencing reads must be able to cover the target site, and the amplification specificity of each pair of primers was tested. Genotype data analysis: Use the MEM algorithm of BWA software to align clean reads to a short sequence reference sequence containing the target site and flanking sequences, use a python script to analyze the genotype of the target site, and convert the genotype of the offspring population to A and B based on the genotype of the parents.

[0040] The residual heterozygous lines (RHL) population is suitable for fine QTL mapping. Molecular markers can be used to directly screen out individuals that are heterozygous in the target interval and homozygous in the background from the recombinant inbred line (RIL) population, and then self-pollinate to construct an RHL population that only separates in the target interval, forming near isogenic lines (NILs) for fine site mapping. Through QTL mapping of tillering angle in highland barley, the main effect loci and flanking markers were obtained. According to the genotyping results of genetic markers in the target interval, the RIL (F 8:9 ) Four remaining heterozygous plants RHL11, RHL55, RHL86 and RHL94 were screened and derived from self-pollination to form four F2 segregating populations. Fourteen molecular markers were encrypted in the target segment covering the major effect locus (Table 2). Genotyping and phenotypic investigation were performed on the progeny of the individual plants in the F2 segregating population. The extreme plants in the F2 segregating population were selected for positioning, among which 15 plants with extreme large and small tillering angles were selected, represented by Large TA and Small TA, respectively. According to the genotyping results of the extreme plants, the recombinant plants were screened and the fine positioning interval of the major effect locus was delineated.

[0041] Table 2 Molecular markers used for fine mapping

[0042]

[0043]

[0044] Based on the resequencing data of both parents, molecular markers were developed in and around the qTA7H-1 positioning interval, and 14 molecular markers with polymorphism between the parents were screened (Table 1). The secondary positioning population selected the F2 population consisting of the offspring of four derived strains that were heterozygous in the qTA7H-1 interval of RIL (F8). The F2 population containing 242 strains was genotyped using 14 polymorphic molecular markers, and the genotype homozygous extreme single plants (Large TA, 15 strains B1) and (Small TA, 15 strains B2) were used for positioning. A total of 5 types of exchange single plants were screened, and qTA7H-1 was finally further limited from the 28.61Mb interval to the physical segment of about 9.54Mb between markers PC08 (32,252,397) and PA10 (41,790,765) ( Figure 3 ).

[0045] 1.6 Development of molecular markers for the major QTL locus qTA7H-1 for tillering angle in highland barley

[0046] A RIL (F8) population was constructed using the large-tillering highland barley variety 'Dazhangzi' and the small-tillering highland barley variety 'Kunlun 10'. Molecular markers linked to it were developed in the qTA7H-1 segment, and the parents and F1 were scanned. A total of 14 pairs of polymorphic markers were screened. The F2 population containing 242 strains (the remaining heterozygous lines) constructed by scanning this site using the 14 pairs of markers obtained the flanking marker PA10 closely linked to it, and qTA7H-1 was finely positioned within a physical interval of about 9.54Mb on the highland barley chromosome 7H. The qTA7H-1 flanking marker PA10 was closely linked to it. PA10 was located at SNP [T / C] 41790765 of the highland barley chromosome 7H. The upstream and downstream flanking sequences of the SNP site in the barley reference genome were extracted using the Gramene website, and the KASP primers for the SNP site were designed using the Bacthprimer 3 software and named TA_10. The KASP marker consists of two specific primers and one universal primer, and a fluorescent linker sequence (GAAGGTGACCAAGTTCATGCT is a FAM fluorescent linker sequence; GAAGGTCGGAGTCAAC GGATT is a HEX fluorescent linker sequence) is connected to the 5' end of the specific primer.

[0047] The fluorescent linkers of the primers labeled with TA_10 molecules include FAM and HEX / VIC, and the primers are composed of F1, F2 and R;

[0048] The nucleotide sequence of the primer F1 is: gaaggtgaccaagttcatgctATGGATAGAGATTTGTAATATTTGGT The nucleotide sequence of the primer F2 is: gaaggtcggagtcaacggattTGGATAGAGATTTGTAATATTTGGC

[0049] The nucleotide sequence of the primer R: ACTAAACGGGGTAATAAGCGTCA

[0050] 1.7 Application of molecular markers for the major QTL locus qTA7H-1 for tillering angle in highland barley

[0051] TA_10, which is tightly linked to qTA7H-1, was used to genotype the parents, F1 and RIL populations.

[0052] The PCR reaction system is as follows:

[0053]

[0054]

[0055] The PCR amplification procedure is as follows:

[0056] Pre-denaturation at 94°C for 15 minutes; first step amplification reaction, denaturation at 94°C for 20 seconds, annealing and extension at 65°C-57°C for 60 seconds, 10 cycles, annealing and extension temperature decreased by 0.8°C in each cycle; second step amplification reaction, denaturation at 94°C for 20 seconds, annealing and extension at 57°C for 60 seconds, 30 cycles. In the typing method, after the reaction is completed, the KASP reaction product is read by the Arraytape scanning system, and the result of the fluorescence scanning is automatically converted into a graph.

[0057] The results showed that the genotype of parent P1 (large tiller angle) was C:C, the genotype of parent P2 (small tiller angle) was T:T, and the genotype of F1 was C:T; 46 plants in the RIL population carried the C:C genotype, and 65 plants carried the T:T genotype. Based on the genotype combined with the 22YM tiller angle phenotype, a difference analysis was performed. The results showed that in the 2022YM environment, the tiller angle of the plant carrying the qTA7H-1 positive effect site (C:C) was significantly higher than that of the plant not carrying the qTA7H-1 positive effect site (T:T) (Table 3, Figure 4 ). Therefore, SNP marker TA_10 can be correctly genotyped in the RIL population and effectively assist in the selection of lines with large tillering angle (C:C) and small tillering angle (T:T).

[0058] Table 3 Phenotype and genotype of tillering angle of RIL population and parents

[0059]

[0060]

Claims

1. A method for assisting in predicting the tillering angle of highland barley, It is characterized in that The nucleotide at position 41790765 of chromosome 7H of highland barley was detected, and the genotype of the site was used to determine: if the genotype was CC, it had a larger tillering angle, and if the genotype was TT, it had a smaller tillering angle. The reference genome version was barley IBSC_v2.

2. Application of SNP markers in detecting the prediction of highland barley tillering angle traits or assisting breeding. The SNP marker is located on chromosome 7H of highland barley, at position 251 of the nucleotide sequence shown in SEQ ID No.

1. The base at this site has a C / T polymorphism. When the genotype of this site is CC, highland barley has a larger tillering angle, and when the genotype is TT, highland barley has a smaller tillering angle.

3. A reagent for detecting the SNP marker polymorphism or genotype according to claim 2.

4. The reagent according to claim 3, It is characterized in that The reagent is a KASP primer, which consists of a forward primer F1, a forward primer F2 and a reverse primer R. The nucleotide sequence of the forward primer F1 is shown in SEQ ID No.2, the nucleotide sequence of the forward primer F2 is shown in SEQ ID No.3, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No.

4.

5. A kit, It is characterized in that Containing the KASP primer according to claim 4.

Images